GPVID	ALLELE	ALLELE_change	drug_name	Disease
GPV0001	Allele A	Correlated with the decreased drug concentrations in patients (compare with allele G)	Methadone	Opioid-Related Disorders
GPV0001	Allele A	Correlated with the decreased likelihood of event-free survival in patients (compare with allele G)	Vincristine	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0001	Allele A	Correlated with the decreased myalgia risk in patients (compare with allele G)	Simvastatin	Hypercholesterolemia
GPV0001	Allele A	Correlated with the decreased toxic liver disease risk in patient (compare with allele G); Correlated with the increased likelihood of toxicity-related treatment failure in patients (compare with allele G)	Nelfinavir	HIV Infection
GPV0001	Allele A	Correlated with the increased adverse drug event risk in patients (compare with allele G); Irrelevant to the drug discontinuation in patients (compare with allele G); Irrelevant to the drug response in patients (compare with Allele G)	Methotrexate	Rheumatoid Arthritis
GPV0001	Allele A	Correlated with the increased disease risk in patients (compare with allele G)	Clopidogrel	Hemorrhage
GPV0001	Allele A	Correlated with the increased disease risk in patients (compare with allele G); Irrelevant to the drug exposure in patients (compare with allele G); Irrelevant to the the drug antiplatelet effect or clinical outcomes in patients (compare with Allele G)	Clopidogrel	Acute Coronary Syndrome
GPV0001	Allele A	Correlated with the increased drug serum concentrations in patients (compare with allele G)	Digoxin	Congestive Cardiac Insufficiency; Arrhythmias; Heart Failure
GPV0001	Allele A	Correlated with the increased likelihood of disease in patients (compare with allele G)	Codeine	CNS Depression
GPV0001	Allele A	Correlated with the increased likelihood of drug resistance in patients (compare with allele G); Irrelevant to the drug concentrations in patients (compare with allele G); Irrelevant to the drug metabolism in patients (compare with Allele G); Irrelevant to the increased drug response in patients (compare with Allele G)	Carbamazepine	Epilepsy
GPV0001	Allele A	Correlated with the increased likelihood of mucositis in patients (compare with allele G)	Everolimus	Breast Neoplasm
GPV0001	Allele A	Correlated with the increased likelihood of myalgia in patients (compare with allele G)	Atorvastatin	Coronary Artery Disease
GPV0001	Allele A	Correlated with the increased plasma drug levels in healthy individuals (compare with genotype GG)	Phenytoin	Healthy Individuals
GPV0001	Allele A	Correlated with the positive relationship between drug plasma levels and positive symptom reduction in patients (compare genotype GG)	Olanzapine	Psychotic Disorders
GPV0001	Allele A	Irrelevant to the acute cellular rejection in patients (compare with allele G); Irrelevant to the dose-adjusted trough concentrations in patients (compare with allele G); Irrelevant to the drug bioavailability in patients (compare with allele G); Irrelevant to the drug clearance in patients (compare with Allele G); Irrelevant to the drug clearance in patients (compare with allele G); Irrelevant to the drug metabolism in patients (compare with Allele G); Irrelevant to the drug trough concentrations in patients (compare with Allele G); Irrelevant to the likelihood of achieving target concentrations of drug in patients (compare with Allele G)	Tacrolimus	Kidney Transplantation
GPV0001	Allele A	Irrelevant to the drug clearance in patients (compare with Allele A)	Paliperidone	Bipolar Disorder
GPV0001	Allele A	Irrelevant to the drug clearance in patients (compare with Allele A)	Paliperidone	Psychotic Disorders
GPV0001	Allele A	Irrelevant to the drug clearance in patients (compare with Allele A)	Risperidone	Bipolar Disorder
GPV0001	Allele A	Irrelevant to the drug clearance in patients (compare with Allele A)	Risperidone	Psychotic Disorders
GPV0001	Allele A	Irrelevant to the drug clearance in patients (compare with Allele G)	Tacrolimus	Hemopoietic Stem Cell Transplant
GPV0001	Allele A	Irrelevant to the drug clearance in patients (compare with Allele G)	Tacrolimus	Liver Transplantation
GPV0001	Allele A	Irrelevant to the drug clearance in patients (compare with allele G)	Cyclosporine	Kidney Transplantation
GPV0001	Allele A	Irrelevant to the drug metabolism in patients (compare with Allele G)	Sirolimus	Kidney Transplantation
GPV0001	Allele A	Irrelevant to the drug response in patients (compare with Allele G)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0001	Allele A	Irrelevant to the drug response in patients (compare with Allele G)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0001	Allele A	Irrelevant to the drug response in patients (compare with Allele G)	Clopidogrel	Angina Pectoris
GPV0001	Allele A	Irrelevant to the drug response in patients (compare with Allele G); Irrelevant to the the antiplatelet effect or drug clinical outcomes in patients (compare with Allele G)	Clopidogrel	Platelet Reactivity
GPV0001	Allele A	Irrelevant to the drug toxicity in patients (compare with allele G)	Sunitinib	Renal Cell Carcinoma
GPV0001	Allele A	Irrelevant to the increased disease risk in patients (compare with allele G)	Clopidogrel	St-Segment Elevation Myocardial Infarction
GPV0001	Allele A	Irrelevant to the increased drug response in patients (compare with Allele G)	Valproic acid	Epilepsy
GPV0001	Allele A	Irrelevant to the increased drug response in patients (compare with Allele G)	Phenytoin	Epilepsy
GPV0001	Allele A	Irrelevant to the increased drug response in patients (compare with Allele G)	Phenobarbital	Epilepsy
GPV0001	Allele A	Irrelevant to the increased high on-treatment platelet reactivity risk in patients (compare with Allele G); Irrelevant to the increased myocardial infarction (mI) or composite outcome of non-fatal mI, all cause death and stent thrombosis risk in patients (compare with Allele G); Irrelevant to the major adverse cardiac risk in patients (compare with Allele G)	Clopidogrel	Coronary Artery Disease
GPV0001	Allele A	Irrelevant to the increased high post-treatment platelet reactivity risk in patients (compare with Allele G)	Clopidogrel	Percutaneous Coronary Intervention
GPV0001	Allele A	Irrelevant to the increased mortality risk in patients (compare with Allele G)	Clopidogrel	Myocardial Infarction
GPV0001	Allele A	Irrelevant to the increased on-treatment platelet activity risk in patients (compare with Allele G)	Clopidogrel	Coronary Disease
GPV0001	Allele A	Irrelevant to the likelihood of treatment failure in patients (compare with Allele G)	Ritonavir	HIV Infection
GPV0001	Allele A	Irrelevant to the overall survival in patients (compare with Allele G)	Ranitidine	Breast Neoplasm
GPV0001	Allele A	Irrelevant to the overall survival in patients (compare with Allele G)	Dexamethasone	Breast Neoplasm
GPV0001	Allele A	Irrelevant to the overall survival in patients (compare with Allele G)	Paclitaxel	Breast Neoplasm
GPV0001	Allele G	Correlated with the increased likelihood of drug resistance in patients (compare with Allele A); Irrelevant to the drug response in patients (compare with allele A)	Phenytoin	Epilepsy
GPV0001	Allele G	Irrelevant to the dose decrease or drug switching risk (compare with allele A)	Atorvastatin	Coronary Artery Disease
GPV0001	Allele G	Irrelevant to the dose decrease or drug switching risk (compare with allele A)	Atorvastatin	Hypercholesterolemia
GPV0001	Allele G	Irrelevant to the dose decrease or drug switching risk (compare with allele A)	Simvastatin	Coronary Artery Disease
GPV0001	Allele G	Irrelevant to the dose decrease or drug switching risk (compare with allele A)	Simvastatin	Hypercholesterolemia
GPV0001	Allele G	Irrelevant to the drug concentrations in patients (compare with Allele A)	Tacrolimus	Organ Transplantation
GPV0001	Allele G	Irrelevant to the drug metabolism in patients (compare with allele A)	Tacrolimus	Kidney Transplantation
GPV0001	Allele G	Irrelevant to the drug response in patients (compare with allele A)	Methotrexate	Rheumatoid Arthritis
GPV0001	Allele G	Irrelevant to the drug response in patients (compare with allele A)	Fluorouracil	Esophageal Neoplasm
GPV0001	Allele G	Irrelevant to the drug response in patients (compare with allele A)	Clopidogrel	Acute Coronary Syndrome
GPV0001	Allele G	Irrelevant to the drug response in patients (compare with allele A)	Clopidogrel	Myocardial Infarction
GPV0001	Allele G	Irrelevant to the drug response in patients (compare with allele A)	Cisplatin	Esophageal Neoplasm
GPV0001	Allele G	Irrelevant to the drug response in patients (compare with allele A)	Carbamazepine	Epilepsy
GPV0001	Allele G	Irrelevant to the drug response in patients (compare with allele A)	Valproic acid	Epilepsy
GPV0001	Allele G	Irrelevant to the drug response in patients (compare with allele A)	Phenobarbital	Epilepsy
GPV0001	Allele G	Irrelevant to the hyperbilirubinemia risk in patients (compare with allele A); Irrelevant to the severity of hyperbilirubinemia in patients (compare with allele A); Irrelevant to the trough concentration of drug in patients (compare with allele A)	Ritonavir	HIV Infection
GPV0001	Allele G	Irrelevant to the increased drug metabolism in patients (compare with Allele A)	Paliperidone	Schizophrenia
GPV0001	Allele G	Irrelevant to the increased drug metabolism in patients (compare with Allele A)	Risperidone	Schizophrenia
GPV0001	Allele G	Irrelevant to the likelihood of drug toxicity in patients (compare with allele A)	Fluorouracil	Breast Neoplasm
GPV0001	Allele G	Irrelevant to the likelihood of drug toxicity in patients (compare with allele A)	Cyclophosphamide	Breast Neoplasm
GPV0001	Genotype AA	Correlated with the decreased bleeding events in patients (compare with genotype GG); Correlated with the decreased drug exposure in patients (compare with genotypes AG + GG); Correlated with the decreased drug peak plasma concentration (Cmax) and the total area under the plasma concentration-time curve (AUC) in patients (compare with genotypes GG + AG); Correlated with the decreased drug response in patients (compare with genotypes AG + GG); Correlated with the increase early major adverse cardiovascular events (mACE) risk in patients (compare with genotype GG)	Clopidogrel	Coronary Artery Disease
GPV0001	Genotype AA	Correlated with the decreased drug clearance in patients (compare with genotypes AG + GG); Correlated with the decreased drug metabolism in patients (compare with genotype GG); Correlated with the increased drug dose in patients (compare with genotype AG)	Tacrolimus	Kidney Transplantation
GPV0001	Genotype AA	Correlated with the decreased drug metabolism (compare with genotype GG)	Digoxin	Congestive Cardiac Insufficiency; Arrhythmias; Heart Failure
GPV0001	Genotype AA	Correlated with the decreased drug plasma concentration in healthy individuals (compare with genotypes GG + AG)	Fexofenadine	Healthy Individuals
GPV0001	Genotype AA	Correlated with the decreased drug response in patients (compare with Genotype AA + AG)	Fentanyl	Neoplasm
GPV0001	Genotype AA	Correlated with the decreased drug response in patients (compare with genotypes AG + GG)	Methotrexate	Rheumatoid Arthritis
GPV0001	Genotype AA	Correlated with the decreased likelihood of Arthralgia in patients (compare with genotypes AG + GG)	Anastrozole	Breast Neoplasm
GPV0001	Genotype AA	Correlated with the decreased likelihood of Postoperative nausea and Vomiting in patients (compare with genotypes AG + GG); Correlated with the increased drug response in patients (compare with genotypes AG + GG)	Pantoprazole	Helicobacter Infections
GPV0001	Genotype AA	Correlated with the decreased neutropenia risk in patients (compare with genotypes AG + GG)	Sunitinib	Renal Cell Carcinoma
GPV0001	Genotype AA	Correlated with the decreased osteonecrosis risk in patients (compare with genotypes GG + AG)	Methylprednisolone	Kidney Transplantation
GPV0001	Genotype AA	Correlated with the decreased osteonecrosis risk in patients (compare with genotypes GG + AG)	Prednisolone	Kidney Transplantation
GPV0001	Genotype AA	Correlated with the increased agranulocytosis and neutropenia risk in patients (compare with genotypes AG + GG); Correlated with the increased drug plasma concentrations in patients (compare with genotype GG)	Clozapine	Schizophrenia
GPV0001	Genotype AA	Correlated with the increased anemia and thrombocytopenia risk in patients (compare with genotypes AG + GG)	Vincristine	Lymphoma
GPV0001	Genotype AA	Correlated with the increased anemia and thrombocytopenia risk in patients (compare with genotypes AG + GG)	Doxorubicin	Lymphoma
GPV0001	Genotype AA	Correlated with the increased anemia and thrombocytopenia risk in patients (compare with genotypes AG + GG)	Prednisolone	Lymphoma
GPV0001	Genotype AA	Correlated with the increased anemia and thrombocytopenia risk in patients (compare with genotypes AG + GG); Correlated with the increased drug concentrations in patients (compare with genotype GG); Correlated with the increased toxic liver disease risk in patients (compare with genotype GG)	Methotrexate	Lymphoma
GPV0001	Genotype AA	Correlated with the increased cardiovascular death, myocardial infarction, or stroke risk in patients  (compare with genotypes GG + AG); Correlated with the increased thrombosis risk in pstients(compare with genotypes AG + GG)	Clopidogrel	Acute Coronary Syndrome
GPV0001	Genotype AA	Correlated with the increased cardiovascular events risk in patients (compare with genotype GG); Correlated with the increased platelet reactivity in patients (compare with genotypes AG + GG)	Clopidogrel	Myocardial Infarction
GPV0001	Genotype AA	Correlated with the increased CD4 t cell count in patients (compare with genotype AG + GG)	Nelfinavir	HIV Infection
GPV0001	Genotype AA	Correlated with the increased dose-adjusted trough concentrations in patients (compare with genotype GG)	Tacrolimus	Rheumatoid Arthritis
GPV0001	Genotype AA	Correlated with the increased drug clearance in healthy individuals (compare with genotypes AG + GG)	Talinolol	Healthy Individuals
GPV0001	Genotype AA	Correlated with the increased drug clearance in patients (compare with genotypes AG + GG)	Methadone	Opioid-Related Disorders
GPV0001	Genotype AA	Correlated with the increased drug dose in patients (compare with genotype GG)	Methadone	Heroin Dependence
GPV0001	Genotype AA	Correlated with the increased drug exposure (compare with genotype GG)	Tramadol	Pain
GPV0001	Genotype AA	Correlated with the increased drug metabolism in patients (compare with genotypes AG + GG)	Morphine	Pain
GPV0001	Genotype AA	Correlated with the increased drug response in patients (compare with genotypes AG + GG)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0001	Genotype AA	Correlated with the increased likelihood of respiratory insufficiency in patients (compare with Genotype AA + AG)	Fentanyl	Postoperative Pain
GPV0001	Genotype AA	Correlated with the increased reduction in pain in patients (compare with genotypes AG + GG)	Morphine	Neoplasm
GPV0001	Genotype AA	Correlated with the increased reduction in total cholesterol in patients (compare with genotype GG)	Simvastatin	Coronary Artery Disease
GPV0001	Genotype AA	Irrelevant to the drug concentrations in patients (compare with genotypes AG + GG)	Tacrolimus	Liver Transplantation
GPV0001	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AG + GG)	Daunorubicin	Acute Myeloid Leukemia
GPV0001	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AG + GG)	Cytarabine	Acute Myeloid Leukemia
GPV0001	Genotype AA	Irrelevant to the neurotoxicity syndromes risk in patients (compare with genotypes AG + GG)	Methotrexate	Hematologic Neoplasm
GPV0001	Genotype AG	Correlated with the decreased disease control rate and lower overall survival rate in patients (compare with genotype GG)	Paclitaxel	Breast Neoplasm
GPV0001	Genotype AG	Correlated with the decreased drug toxicity risk in patients (compare with genotype GG)	Methotrexate	Rheumatoid Arthritis
GPV0001	Genotype AG	Correlated with the increased disease recurrence risk in patients (compare with genotype GG); Correlated with the increased disease recurrence risk in patients (compare with genotypes AA + GG)	Tamoxifen	Breast Neoplasm
GPV0001	Genotype AG	Correlated with the increased drug concentrations in patients (compare with genotypes AA + GG)	Methadone	Opioid-Related Disorders
GPV0001	Genotype AG	Correlated with the increased hypokalemia risk in patients (compare with genotypes AA + GG); Correlated with the increased transplant rejection risk in patients (compare with genotypes AA + GG); Irrelevant to the drug concentrations in patients (compare with genotype GG)	Tacrolimus	Kidney Transplantation
GPV0001	Genotype AG	Correlated with the increased recurrence-free survival in patients (compare with genotype AA)	Oxaliplatin	Colorectal Neoplasm
GPV0001	Genotype AG	Irrelevant to the drug metabolism in patients (compare with genotypes AA + GG)	Carbamazepine	Epilepsy
GPV0001	Genotype GA	Correlated with the increased nonresponse risk in patients	Methotrexate	Rheumatoid Arthritis
GPV0001	Genotype GG	Correlated with the decreased diarrhea risk in patients (compare with genotype AA); Irrelevant to the drug response in patients (compare with genotypes AA + AG); Irrelevant to the drug toxicity in patients (compare with genotypes AA + AG)	Fluorouracil	Colorectal Neoplasm
GPV0001	Genotype GG	Correlated with the decreased drug concentrations in patients (compare with genotype AA); Correlated with the decreased drug intracellular and blood concentration in patients (compare with genotypes AA + AG)	Cyclosporine	Transplantation
GPV0001	Genotype GG	Correlated with the decreased drug metabolism in healthy individuals (compare with genotypes AA + AG)	Verapamil	Healthy Individuals
GPV0001	Genotype GG	Correlated with the decreased drug response in patients (compare with genotypes AA + AG); Irrelevant to the drug response in patients (compare with genotype AA)	Atorvastatin	Coronary Artery Disease
GPV0001	Genotype GG	Correlated with the decreased survival in patients (compare with genotype AA)	Vincristine	Multiple Myeloma
GPV0001	Genotype GG	Correlated with the decreased survival in patients (compare with genotype AA)	Dexamethasone	Multiple Myeloma
GPV0001	Genotype GG	Correlated with the decreased survival in patients (compare with genotype AA)	Doxorubicin	Multiple Myeloma
GPV0001	Genotype GG	Correlated with the decreased survival rate in patients (compare with genotypes AA + AG)	Fluorouracil	Esophageal Neoplasm
GPV0001	Genotype GG	Correlated with the decreased survival rate in patients (compare with genotypes AA + AG)	Cisplatin	Esophageal Neoplasm
GPV0001	Genotype GG	Correlated with the increased anemia risk in patients (compare with genotypes AA + AG)	Fluorouracil	Breast Neoplasm
GPV0001	Genotype GG	Correlated with the increased anemia risk in patients (compare with genotypes AA + AG)	Doxorubicin	Breast Neoplasm
GPV0001	Genotype GG	Correlated with the increased anemia risk in patients (compare with genotypes AA + AG)	Cyclophosphamide	Breast Neoplasm
GPV0001	Genotype GG	Correlated with the increased drug clearance (compare with genotype AG)	Probenecid	Gout; Hyperuricemia
GPV0001	Genotype GG	Correlated with the increased drug clearance (compare with genotype AG)	Dicloxacillin	Cystic Fibrosis
GPV0001	Genotype GG	Correlated with the increased drug concentrations in patients (compare with genotype AG); Irrelevant to the drug resistance in patients (compare with genotypes AA + AG)	Carbamazepine	Epilepsy
GPV0001	Genotype GG	Correlated with the increased drug exposure in healthy individuals (compare with Genotypes AA + AG)	Paliperidone	Healthy Individuals
GPV0001	Genotype GG	Correlated with the increased drug exposure in healthy individuals (compare with Genotypes AA + AG)	Risperidone	Healthy Individuals
GPV0001	Genotype GG	Correlated with the increased drug metabolism (compare with genotype AA)	Digoxin	Congestive Cardiac Insufficiency; Arrhythmias; Heart Failure
GPV0001	Genotype GG	Correlated with the increased drug metabolism in patients (compare with genotypes AA + AG)	Etoposide	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0001	Genotype GG	Correlated with the increased drug metabolism in patients (compare with genotypes AA + AG); Irrelevant to the drug dose-adjusted trough concentrations in patients (compare with genotypes AA + AG); Irrelevant to the drug metabolism in patients (compare with genotypes AA + AG)	Tacrolimus	Liver Transplantation
GPV0001	Genotype GG	Correlated with the increased drug resistance in patients (compare with genotype AA)	Clopidogrel	Hypertension
GPV0001	Genotype GG	Correlated with the increased drug resistance in patients (compare with genotype AA)	Phenobarbital	Epilepsy
GPV0001	Genotype GG	Correlated with the increased drug response in patients (compare with genotypes AA + AG); Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0001	Genotype GG	Correlated with the increased drug toxicity risk in patients (compare with genotypes AA + AG)	Methotrexate	Rheumatoid Arthritis
GPV0001	Genotype GG	Correlated with the increased exanthema and mucositis risk in patients (compare with genotypes AA + AG)	Sunitinib	Renal Cell Carcinoma
GPV0001	Genotype GG	Correlated with the increased ischaemic events risk in patients (compare with genotypes AA + AG)	Clopidogrel	Acute Coronary Syndrome
GPV0001	Genotype GG	Correlated with the increased likelihood of 3-year Event Free Survival in patients (compare with genotypes AA + AG); Correlated with the increased likelihood of complete remission in patients (compare with genotypes AA + AG)	Cytarabine	Acute Myeloid Leukemia
GPV0001	Genotype GG	Irrelevant to the decreased survival in patients (compare with genotype AA)	Cytarabine	Acute Multiple Myeloma
GPV0001	Genotype GG	Irrelevant to the drug clearance in patients (compare with genotypes AA + AG); Irrelevant to the drug dose-adjusted trough concentrations in patients (compare with Allele T); Irrelevant to the drug dose-adjusted trough concentrations in patients (compare with genotypes AA + AG); Irrelevant to the drug metabolism in patients (compare with genotypes AA + AG); Irrelevant to the glomerular filtration rate in patients (compare with genotypes AA + AG)	Tacrolimus	Kidney Transplantation
GPV0001	Genotype GG	Irrelevant to the drug concentrations in patients (compare with genotypes AA + AG)	Bilirubin	HIV Infection
GPV0001	Genotype GG	Irrelevant to the drug concentrations in patients (compare with genotypes AA + AG)	Tacrolimus	Organ Transplantation
GPV0001	Genotype GG	Irrelevant to the drug dose-adjusted trough concentrations in patients (compare with genotypes AA + AG)	Tacrolimus	Rheumatoid Arthritis
GPV0001	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Simvastatin	Hypercholesterolemia
GPV0001	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG); Irrelevant to the drug toxicity in patients (compare with genotypes AA + AG)	Irinotecan	Colorectal Neoplasm
GPV0001	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG); Irrelevant to the drug toxicity in patients (compare with genotypes AA + AG)	Oxaliplatin	Colorectal Neoplasm
GPV0001	Genotypes AA + AG	Correlated with the decreased drug metabolism in patients (compare with genotype GG); Correlated with the decreased drug response in patients (compare with genotype GG); Correlated with the increased early major adverse cardiovascular events (mACE) risk in patients (compare with genotype GG); Irrelevant to the drug response in patients (compare with genotype GG); Irrelevant to the increased high on-treatment platelet reactivity risk in patients (compare with genotype GG)	Clopidogrel	Acute Coronary Syndrome
GPV0001	Genotypes AA + AG	Correlated with the decreased drug response in patients (compare with genotype GG)	Clopidogrel	Platelet Reactivity
GPV0001	Genotypes AA + AG	Correlated with the decreased drug response in patients (compare with genotype GG); Correlated with the decreased drug trough concentration in patients (compare with genotype GG)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0001	Genotypes AA + AG	Correlated with the decreased glomerular filtration rate in patients (compare with genotype GG); Irrelevant to the drug dose-adjusted trough concentrations in patients (compare with genotype GG); Irrelevant to the renal transplant failure risk in patients (compare with genotype GG); Irrelevant to the transplant rejection risk in patients (compare with genotype GG)	Tacrolimus	Kidney Transplantation
GPV0001	Genotypes AA + AG	Correlated with the decreased lymph node metastases risk in patients (compare with genotype GG)	Fluorouracil	Esophageal Neoplasm
GPV0001	Genotypes AA + AG	Correlated with the decreased lymph node metastases risk in patients (compare with genotype GG)	Cisplatin	Esophageal Neoplasm
GPV0001	Genotypes AA + AG	Correlated with the increased drug concentrations in patients (compare with genotype GG)	Tacrolimus	Lung Transplantation
GPV0001	Genotypes AA + AG	Correlated with the increased drug exposure in healthy individuals (compare with genotype GG)	Rivaroxaban	Healthy Individuals
GPV0001	Genotypes AA + AG	Correlated with the increased drug exposure in healthy individuals (compare with genotype GG)	Dabigatran	Healthy Individuals
GPV0001	Genotypes AA + AG	Correlated with the increased drug response in patients (compare with genotype GG)	Losartan	Hypertension
GPV0001	Genotypes AA + AG	Correlated with the increased drug toxicity risk in patients (compare with genotype GG); Irrelevant to the drug concentrations in patients (compare with genotype GG); Irrelevant to the mucositis risk in patients (compare with genotype GG)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0001	Genotypes AA + AG	Correlated with the increased hypertension risk in patients (compare with genotype GG)	Sorafenib	Renal Cell Carcinoma
GPV0001	Genotypes AA + AG	Correlated with the increased low-density lipoprotein cholesterol in patients (compare with genotype GG); Correlated with the increased total cholesterol in patients (compare with genotype GG)	Sirolimus	Kidney Transplantation
GPV0001	Genotypes AA + AG	Correlated with the increased major adverse cardiovascular events (mACE) risk in patients (compare with genotype GG); Irrelevant to the all-cause mortality in patients (compare with genotype GG); Irrelevant to the increased high on-treatment platelet reactivity risk in patients (compare with genotype GG); Irrelevant to the increased ischemic stroke risk in patients (compare with genotype GG); Irrelevant to the increased major adverse cardiovascular events (MACE) risk in patients (compare with genotype GG); Irrelevant to the increased myocardial Infarction risk in patients (compare with genotype GG); Irrelevant to the stent thrombosis in patients (compare with genotype GG)	Clopidogrel	Coronary Artery Disease
GPV0001	Genotypes AA + AG	Correlated with the increased major cardiovascular events (mACE) risk in patients (compare with genotype GG)	Clopidogrel	Myocardial Infarction
GPV0001	Genotypes AA + AG	Correlated with the increased overall survival in patients (compare with genotype GG)	Cytarabine	Acute Multiple Myeloma
GPV0001	Genotypes AA + AG	Irrelevant to the drug concentrations in patients (compare with genotype GG); Irrelevant to the increased drug discontinuation in patients (compare with genotype GG)	Ritonavir	HIV Infection
GPV0001	Genotypes AA + AG	Irrelevant to the increased drug response in patients (compare with genotype GG)	Paclitaxel	Breast Neoplasm
GPV0001	Genotypes AG + GG	Correlated with the increased drug clearance in patients (compare with genotype AA)	Tacrolimus	Liver Transplantation
GPV0001	Genotypes AG + GG	Correlated with the increased drug clearance in patients (compare with genotype AA); Correlated with the increased drug dose-adjusted trough concentrations in patients (compare with genotype AA); Irrelevant to the drug metabolism in patients (compare with genotype AA)	Tacrolimus	Kidney Transplantation
GPV0001	Genotypes AG + GG	Correlated with the increased drug resistance in patients (compare with genotype AA)	Lamivudine	HIV Infection
GPV0001	Genotypes AG + GG	Correlated with the increased drug resistance in patients (compare with genotype AA)	Lopinavir	HIV Infection
GPV0001	Genotypes AG + GG	Correlated with the increased drug resistance in patients (compare with genotype AA)	Zidovudine	HIV Infection
GPV0001	Genotypes AG + GG	Correlated with the increased drug resistance in patients (compare with genotype AA)	Ritonavir	HIV Infection
GPV0001	Genotypes AG + GG	Irrelevant to the decreased clinical outcome in patients (compare with genotype AA)	Gemcitabine	Neoplasm
GPV0001	Genotypes AG + GG	Irrelevant to the decreased clinical outcome in patients (compare with genotype AA)	Epirubicin	Neoplasm
GPV0001	Genotypes AG + GG	Irrelevant to the decreased clinical outcome in patients (compare with genotype AA)	Docetaxel	Neoplasm
GPV0001	Genotypes AG + GG	Irrelevant to the decreased clinical outcome in patients (compare with genotype AA)	Cisplatin	Neoplasm
GPV0001	Genotypes AG + GG	Irrelevant to the drug metabolism in patients (compare with genotype AA); Irrelevant to the drug response in patients (compare with genotype AA)	Tacrolimus	Ulcerative Colitis
GPV0001	Genotypes AG + GG	Irrelevant to the prognosis in patients (compare with genotype AA)	Fluorouracil	Colorectal Neoplasm
GPV0001	Genotypes AG + GG	Irrelevant to the prognosis in patients (compare with genotype AA)	Leucovorin	Colorectal Neoplasm
GPV0001	Genotypes AG + GG	Irrelevant to the prognosis in patients (compare with genotype AA)	Cisplatin	Colorectal Neoplasm
GPV0002	Allele A	Correlated with the decreased myalgia risk in patients (compare with allele G)	Simvastatin	Hypercholesterolemia
GPV0002	Allele A	Correlated with the increased drug serum concentrations in patients (compare with allele G)	Digoxin	Congestive Cardiac Insufficiency; Arrhythmias; Heart Failure
GPV0002	Allele A	Correlated with the increased likelihood of CnS depression when used drug (compare with allele G)	Codeine	Pain
GPV0002	Allele A	Correlated with the increased plasma drug levels in healthy individual (compare with genotype GG)	Phenytoin	Healthy Individuals
GPV0002	Allele A	Irrelevant to the dose-adjusted trough concentrations in patients (compare with allele G); Irrelevant to the drug clearance in patients (compare with Allele G); Irrelevant to the drug metabolism in patients (compare with Allele G)	Tacrolimus	Kidney Transplantation
GPV0002	Allele A	Irrelevant to the drug clearance in patients (compare with allele G)	Cyclosporine	Kidney Transplantation
GPV0002	Allele A	Irrelevant to the drug clearance in patients (compare with Allele G); Irrelevant to the drug metabolism in patients (compare with Allele G)	Tacrolimus	Liver Transplantation
GPV0002	Allele A	Irrelevant to the drug concentrations in patients (compare with allele G); Irrelevant to the drug response in patients (compare with Allele G)	Carbamazepine	Epilepsy
GPV0002	Allele A	Irrelevant to the drug discontinuation in patients (compare with allele G)	Methotrexate	Rheumatoid Arthritis
GPV0002	Allele A	Irrelevant to the drug metabolism in patients (compare with Allele G)	Sirolimus	Kidney Transplantation
GPV0002	Allele A	Irrelevant to the drug response in patients (compare with Allele G)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0002	Allele A	Irrelevant to the drug response in patients (compare with Allele G)	Valproic acid	Epilepsy
GPV0002	Allele A	Irrelevant to the drug response in patients (compare with Allele G)	Phenytoin	Epilepsy
GPV0002	Allele A	Irrelevant to the drug response in patients (compare with Allele G)	Phenobarbital	Epilepsy
GPV0002	Allele A	Irrelevant to the drug toxicity in patients (compare with allele G)	Sunitinib	Renal Cell Carcinoma
GPV0002	Allele G	Correlated with the increased death risk in patients (compare with Allele A)	Methotrexate	Osteosarcoma
GPV0002	Allele G	Correlated with the increased death risk in patients (compare with Allele A)	Vincristine	Osteosarcoma
GPV0002	Allele G	Correlated with the increased death risk in patients (compare with Allele A)	Cisplatin	Osteosarcoma
GPV0002	Allele G	Correlated with the increased death risk in patients (compare with Allele A)	Doxorubicin	Osteosarcoma
GPV0002	Allele G	Correlated with the increased death risk in patients (compare with Allele A)	Cyclophosphamide	Osteosarcoma
GPV0002	Allele G	Irrelevant to the drug metabolism in patients (compare with allele A)	Carbamazepine	Epilepsy
GPV0002	Allele G	Irrelevant to the drug response in patients (compare with allele A)	Doxorubicin	Breast Neoplasm
GPV0002	Allele G	Irrelevant to the drug response in patients (compare with allele A)	Cyclophosphamide	Breast Neoplasm
GPV0002	Genotype AA	Correlated with the decreased drug clearance in patients (compare with genotypes AG + GG); Irrelevant to the drug clearance in patients (compare with genotypes AG + GG); Irrelevant to the drug concentrations in patients (compare with genotypes AG + GG)	Tacrolimus	Kidney Transplantation
GPV0002	Genotype AA	Correlated with the decreased drug response in patients (compare with Genotype AG + GG )	Fentanyl	Neoplasm
GPV0002	Genotype AA	Correlated with the decreased neutropenia risk in patients (compare with genotypes AG + GG)	Sunitinib	Renal Cell Carcinoma
GPV0002	Genotype AA	Correlated with the increased diarrhea and exanthema risk in patients (compare with genotypes AG + GG)	Gefitinib	Non-Small-Cell Lung Carcinoma
GPV0002	Genotype AA	Correlated with the increased drug exposure (compare with genotype GG)	Tramadol	Pain
GPV0002	Genotype AA	Correlated with the increased likelihood of respiratory insufficiency in patients (compare with Genotype AG + GG)	Fentanyl	Postoperative Pain
GPV0002	Genotype AA	Correlated with the increased nephrotoxicity risk in patients (compare with genotypes AG + GG)	Cyclosporine	Kidney Transplantation
GPV0002	Genotype AA	Correlated with the increased overall survival in patients (compare with genotype GG)	Oxaliplatin	Colorectal Neoplasm
GPV0002	Genotype AA	Correlated with the increased reduction in total cholesterol in patients (compare with genotype GG)	Simvastatin	Hypercholesterolemia
GPV0002	Genotype AA	Correlated with the increased triglycerides in patients (compare with genotypes AG + GG)	Sirolimus	Kidney Transplantation
GPV0002	Genotype AA	Correlated with the increased trough blood concentration in patients (compare with genotype GG)	Cyclosporine	Myasthenia Gravis
GPV0002	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AG + GG)	Daunorubicin	Acute Myeloid Leukemia
GPV0002	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AG + GG)	Cytarabine	Acute Myeloid Leukemia
GPV0002	Genotype AA	Irrelevant to the increased success rate in achieving short-term remission in patients (compare with genotypes AG + GG)	Tacrolimus	Ulcerative Colitis
GPV0002	Genotype AG	Correlated with the increased drug trough concentrations in patients (compare with genotype GG)	Tacrolimus	Kidney Transplantation
GPV0002	Genotype AG	Correlated with the increased likelihood of drug toxicity in patients (compare with genotype GG)	Methotrexate	Rheumatoid Arthritis; Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0002	Genotype AG	Correlated with the increased overall survival in patients (compare with genotype GG)	Oxaliplatin	Colorectal Neoplasm
GPV0002	Genotype GG	Correlated with the decreased drug concentrations in patients (compare with genotypes AA + AG)	Tacrolimus	Liver Transplantation
GPV0002	Genotype GG	Correlated with the decreased drug exposure in patients (compare with genotypes AA + AG)	Sirolimus	Urinary Bladder Neoplasm
GPV0002	Genotype GG	Correlated with the decreased drug exposure in patients (compare with genotypes AA + AG)	Temsirolimus	Urinary Bladder Neoplasm
GPV0002	Genotype GG	Correlated with the decreased drug response in patients (compare with genotypes AA + AG)	Simvastatin	Hypercholesterolemia
GPV0002	Genotype GG	Correlated with the decreased drug response in patients (compare with genotypes AA + AG); Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0002	Genotype GG	Correlated with the decreased survival in patients (compare with genotypes AA + AG)	Cytarabine	Acute Myeloid Leukemia
GPV0002	Genotype GG	Irrelevant to the drug toxicity risk in patients (compare with genotypes AA + AG)	Gefitinib	Non-Small-Cell Lung Carcinoma
GPV0002	Genotypes AA + AG	Correlated with the decreased diarrhea risk in patients (compare with genotype GG)	Sunitinib	Renal Cell Carcinoma
GPV0002	Genotypes AA + AG	Correlated with the increased drug clearance in patients (compare with genotype GG)	Carbamazepine	Epilepsy
GPV0002	Genotypes AA + AG	Correlated with the increased drug resistance (compare with genotype GG)	Clopidogrel	Acute Coronary Syndrome
GPV0002	Genotypes AA + AG	Correlated with the increased drug response in patients (compare with genotype GG)	Risperidone	Autistic Disorder
GPV0002	Genotypes AA + AG	Correlated with the increased drug toxicity risk in patients (compare with genotype GG)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0002	Genotypes AA + AG	Correlated with the increased infection risk in patients (compare with genotype GG)	Tacrolimus	Heart Transplantation
GPV0002	Genotypes AA + AG	Correlated with the increased infection risk in patients (compare with genotype GG)	Cyclosporine	Heart Transplantation
GPV0002	Genotypes AA + AG	Correlated with the increased overall survival in patients (compare with genotype GG)	Cytarabine	Acute Multiple Myeloma
GPV0002	Genotypes AG + GG	Correlated with the increased drug response in patients (compare with genotype AA); Irrelevant to the drug metabolism in patients (compare with genotype AA)	Tacrolimus	Ulcerative Colitis
GPV0002	Genotypes AG + GG	Irrelevant to the mucositis risk in patients (compare with genotype AA)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0003	Allele A	Correlated with the increased drug serum concentrations in patients (compare with allele C)	Digoxin	Congestive Cardiac Insufficiency; Arrhythmias; Heart Failure
GPV0003	Allele A	Correlated with the increased likelihood of lymphopenia in patients (compare with allele C)	Everolimus	Breast Neoplasm
GPV0003	Allele A	Correlated with the increased transplant rejection risk in patients (compare with genotype CC)	Mycophenolate mofetil	Kidney Transplantation
GPV0003	Allele A	Correlated with the increased transplant rejection risk in patients (compare with genotype CC)	Cyclosporine	Kidney Transplantation
GPV0003	Allele A	Irrelevant to the dose decrease or drug switching risk in patients (compare with Allele T)	Atorvastatin	Hypercholesterolemia
GPV0003	Allele A	Irrelevant to the dose decrease or drug switching risk in patients (compare with Allele T)	Simvastatin	Hypercholesterolemia
GPV0003	Allele A	Irrelevant to the dose-adjusted trough concentrations in patients (compare with allele C); Irrelevant to the drug trough concentrations in patients (compare with Allele C)	Tacrolimus	Kidney Transplantation
GPV0003	Allele A	Irrelevant to the drug clearance in patients (compare with Allele C)	Tacrolimus	Hemopoietic Stem Cell Transplant
GPV0003	Allele A	Irrelevant to the drug metabolism in patients (compare with Allele C)	Tacrolimus	Liver Transplantation
GPV0003	Allele C	Correlated with the increased drug-induced liver injury risk in patients (compare with Allele T)	Atorvastatin	Coronary Artery Disease
GPV0003	Allele C	Irrelevant to the drug metabolism in patients (compare with Allele A)	Sirolimus	Kidney Transplantation
GPV0003	Allele C	Irrelevant to the drug metabolism in patients (compare with Allele A)	Tacrolimus	Kidney Transplantation
GPV0003	Allele C	Irrelevant to the drug metabolism in patients (compare with Allele A); Irrelevant to the increased drug response in patients (compare with Allele T)	Carbamazepine	Epilepsy
GPV0003	Allele C	Irrelevant to the drug response in patients (compare with allele A)	Pravastatin	Hyperlipoproteinemia
GPV0003	Allele C	Irrelevant to the increased drug response in patients (compare with Allele T)	Valproic acid	Epilepsy
GPV0003	Allele C	Irrelevant to the increased drug response in patients (compare with Allele T)	Phenytoin	Epilepsy
GPV0003	Allele C	Irrelevant to the increased drug response in patients (compare with Allele T)	Phenobarbital	Epilepsy
GPV0003	Allele T	Correlated with the drug-resistant phenotype in patients (compare with allele C)	Carbamazepine	Epilepsy
GPV0003	Allele T	Correlated with the drug-resistant phenotype in patients (compare with allele C)	Valproic acid	Epilepsy
GPV0003	Allele T	Correlated with the drug-resistant phenotype in patients (compare with allele C)	Phenytoin	Epilepsy
GPV0003	Allele T	Correlated with the increased drug response in patients (compare with allele A); Correlated with the increased drug response in patients(compare with allele C)	Atorvastatin	Hypercholesterolemia
GPV0003	Allele T	Correlated with the increased Hemorrhage risk in patients (compare with allele A)	Clopidogrel	Coronary Artery Disease
GPV0003	Genotype AA	Correlated with the decreased drug metabolism in patients (compare with genotype CC)	Doxorubicin	Breast Neoplasm
GPV0003	Genotype AA	Correlated with the decreased drug metabolism in patients (compare with genotype CC)	Doxorubicin	Leukemia
GPV0003	Genotype AA	Correlated with the increased drug concentrations in patients (compare with genotypes AC + CC)	Anastrozole	Breast Neoplasm
GPV0003	Genotype AA	Correlated with the increased drug exposure (compare with genotype CC)	Tramadol	Pain
GPV0003	Genotype AA	Correlated with the increased drug resistance risk in patients (compare with genotypes CC + AC)	Cyclosporine	Ulcerative Colitis
GPV0003	Genotype AA	Correlated with the increased drug trough blood concentration in patients (compare with genotype CC)	Cyclosporine	Myasthenia Gravis
GPV0003	Genotype AA	Correlated with the increased likelihood of drug resistance in patients (compare with genotype CC)	Carbamazepine	Epilepsy
GPV0003	Genotype AA	Correlated with the increased likelihood of respiratory insufficiency in patients (compare with Genotype AA)	Fentanyl	Postoperative Pain
GPV0003	Genotype AA	Correlated with the increased reduction in total cholesterol in patients (compare with genotype CC)	Simvastatin	Hypercholesterolemia
GPV0003	Genotype AA	Correlated with the increased sensitivity to drug in vitro (compare with genotypes CC + AC)	Mitoxantrone	Breast Neoplasm
GPV0003	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AC + CC)	Daunorubicin	Acute Myeloid Leukemia
GPV0003	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AC + CC)	Cytarabine	Acute Myeloid Leukemia
GPV0003	Genotype AC	Correlated with the increased drug concentrations in patients (compare with genotypes AA + CC)	Methadone	Opioid-Related Disorders
GPV0003	Genotype AC	Correlated with the increased reduction in total cholesterol in patients (compare with genotype CC)	Simvastatin	Hypercholesterolemia
GPV0003	Genotype AT	Irrelevant to the drug clearance in patients (compare with allele C)	Tacrolimus	Kidney Transplantation
GPV0003	Genotype AT	Irrelevant to the drug clearance in patients (compare with allele C)	Cyclosporine	Kidney Transplantation
GPV0003	Genotype CC	Correlated with the decreased drug clearance in patients (compare with genotypes AC + Ct)	Methadone	Opioid-Related Disorders
GPV0003	Genotype CC	Correlated with the decreased drug exposure in healthy individuals (compare with genotypes AA + AC)	Rivaroxaban	Healthy Individuals
GPV0003	Genotype CC	Correlated with the decreased drug exposure in healthy individuals (compare with genotypes AA + AC)	Dabigatran	Healthy Individuals
GPV0003	Genotype CC	Correlated with the decreased drug metabolism in healthy individuals (compare with genotypes AA + AC)	Verapamil	Healthy Individuals
GPV0003	Genotype CC	Correlated with the decreased survival in patients (compare with genotypes AA + AC)	Cytarabine	Acute Multiple Myeloma
GPV0003	Genotype CC	Correlated with the increased drug clearance in patients (compare with genotype AA)	Cyclosporine	Cystic Fibrosis
GPV0003	Genotype CC	Correlated with the increased drug clearance in patients (compare with genotype AA)	Dicloxacillin	Cystic Fibrosis
GPV0003	Genotype CC	Correlated with the increased drug metabolism (compare with genotype AA)	Digoxin	Congestive Cardiac Insufficiency; Arrhythmias; Heart Failure
GPV0003	Genotype CC	Correlated with the increased drug metabolism in patients (compare with genotypes AA + AC)	Temsirolimus	Urinary Bladder Neoplasm
GPV0003	Genotype CC	Correlated with the increased drug response in patients (compare with genotype AA)	Atorvastatin	Hypercholesterolemia
GPV0003	Genotype CC	Correlated with the increased percent reduction in LDL-cholesterol in patients	Pravastatin	Acute Coronary Syndrome
GPV0003	Genotypes AA + AC	Correlated with the increased drug response in patients (compare with genotype CC)	Atorvastatin	Hypercholesterolemia
GPV0003	Genotypes AA + AC	Irrelevant to the increased overall survival in patients (compare with genotype CC)	Cytarabine	Acute Myeloid Leukemia
GPV0003	Genotypes AA + AT	Correlated with the decreased overall survival in patients (compare with genotypes AC + CC)	Sunitinib	Renal Cell Carcinoma
GPV0003	Genotypes AA + AT	Correlated with the increased drug response in patients (compare with genotypes AC + CC)	Paclitaxel	Ovarian Neoplasm
GPV0003	Genotypes AA + TT	Correlated with the increased drug response in patients (compare with genotypes CC + CT)	Tacrolimus	Nephrotic Syndrome
GPV0003	Genotypes AC + CC	Correlated with the decreased drug dose-adjusted trough concentrations as in patients (compare with genotypes AA + Ct); Correlated with the increased drug dose in patients (compare with genotypes AA + Ct)	Cyclosporine	Kidney Transplantation
GPV0003	Genotypes AC + CC	Correlated with the drug concentrations in patients (compare with genotype AA)	Ritonavir	HIV Infection
GPV0003	Genotypes AC + CC	Correlated with the increased drug dose-adjusted trough concentrations in patients (compare with genotype AA)	Tacrolimus	Kidney Transplantation
GPV0003	Genotypes AC + CC	Correlated with the increased likelihood of constipation in patients (compare with genotype AA)	Fentanyl	Neoplasm
GPV0003	Genotypes AC + CT	Correlated with the increased drug trough concentrations in patients (compare with genotype CC)	Tacrolimus	Kidney Transplantation
GPV0003	Genotypes CC + CT	Correlated with the increased likelihood of constipation in patients (compare with Genotype TT)	Fentanyl	Neoplasm
GPV0003	Genotypes CC + CT	Irrelevant to the drug metabolism in patients (compare with genotypes AC + At)	Tacrolimus	Kidney Transplantation
GPV0003	Genotypes CT + TT	Correlated with the decreased survival in patients(compare with Genotypes AC + CC)	Doxorubicin	Breast Neoplasm
GPV0003	Genotypes CT + TT	Correlated with the decreased survival in patients(compare with Genotypes AC + CC)	Cyclophosphamide	Breast Neoplasm
GPV0004	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele T)	Citalopram	Depression
GPV0005	Allele T	Correlated with the increased likelihood of remission in patients (compare with allele C)	Citalopram	Depression
GPV0006	Allele T	Correlated with the increased drug response in patients (compare with allele G)	Fluorouracil	Neoplasm
GPV0007	Genotype AA	Correlated with the increased drug response in patients (compare with genotype At)	Fluvastatin	Hypercholesterolemia
GPV0008	Allele G	Correlated with the increased likelihood of adverse effects in patients (compare with Allele A)	Citalopram	Major Depressive Disorder
GPV0008	Allele G	Correlated with the increased likelihood of adverse effects in patients (compare with Allele A)	Fluvoxamine	Major Depressive Disorder
GPV0008	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Citalopram	Bipolar Disorder
GPV0008	Genotypes AG + GG	Correlated with the increased likelihood of remission in patients (compare with genotype AA)	Citalopram	Depression
GPV0008	Genotypes AG + GG	Correlated with the increased likelihood of remission in patients (compare with genotype AA)	Fluvoxamine	Depression
GPV0009	Allele C	Irrelevant to the anemia, neutropenia or thrombocytopenia risk in patients (compare with Allele T)	Dexamethasone	Multiple Myeloma
GPV0009	Allele C	Irrelevant to the anemia, neutropenia or thrombocytopenia risk in patients (compare with Allele T)	Lenalidomide	Multiple Myeloma
GPV0009	Genotype CT	Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC)	Vincristine	Non-Hodgkin Lymphoma
GPV0009	Genotype CT	Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC)	Doxorubicin	Non-Hodgkin Lymphoma
GPV0009	Genotype CT	Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC)	Cyclophosphamide	Non-Hodgkin Lymphoma
GPV0009	Genotype CT	Correlated with the increased drug resistance in patients (compare with genotype CC)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0009	Genotype CT	Correlated with the increased drug resistance in patients (compare with genotype CC)	Vincristine	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0009	Genotype CT	Correlated with the increased drug resistance in patients (compare with genotype CC)	Doxorubicin	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0009	Genotype CT	Correlated with the increased drug resistance in patients (compare with genotype CC)	Prednisolone	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0009	Genotype CT	Correlated with the increased likelihood of progression-free survival in patients (compare with genotype CC); Irrelevant to the likelihood of overall survival in patients (compare with genotype CC)	Dexamethasone	Multiple Myeloma
GPV0009	Genotype CT	Correlated with the increased likelihood of progression-free survival in patients (compare with genotype CC); Irrelevant to the likelihood of overall survival in patients (compare with genotype CC)	Lenalidomide	Multiple Myeloma
GPV0009	Genotype CT	Correlated with the increased neutropenia risk in patients (compare with genotype CC)	Valganciclovir	Kidney Transplantation
GPV0009	Genotypes CT + TT	Correlated with the increased renal transplant failure risk in patients (compare with genotype CC)	Tacrolimus	Kidney Transplantation
GPV0010	Allele A	Correlated with the increased likelihood of remission in patients (compare with allele C)	Citalopram	Depression
GPV0010	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AA + AC)	Citalopram	Depression
GPV0011	Allele T	Correlated with the increased likelihood of adverse effects in patients (compare with allele C)	Citalopram	Major Depressive Disorder
GPV0011	Allele T	Correlated with the increased likelihood of adverse effects in patients (compare with allele C)	Fluvoxamine	Major Depressive Disorder
GPV0011	Allele T	Correlated with the increased likelihood of remission in patients (compare with allele C)	Citalopram	Depression
GPV0011	Genotype CT	Correlated with the decreased periorbital edema risk in patients (compare with genotype CC)	Imatinib	Gastrointestinal Stromal Tumors
GPV0012	Allele C	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele A)	Daunorubicin	Neoplasm
GPV0012	Allele C	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele A)	Doxorubicin	Neoplasm
GPV0013	Allele T	Correlated with the increased likelihood of remission in patients (compare with allele C)	Citalopram	Depression
GPV0014	Allele T	Correlated with the increased drug response in patients (compare with allele C)	Citalopram	Major Depressive Disorder
GPV0015	Allele G	Correlated with the increased hypercholesterolemia risk in patients (compare with Allele A)	Atenolol	Hypertension
GPV0017	Allele C	Correlated with the increased death risk in patients (compare with Allele T)	Methotrexate	Osteosarcoma
GPV0017	Allele C	Correlated with the increased death risk in patients (compare with Allele T)	Vincristine	Osteosarcoma
GPV0017	Allele C	Correlated with the increased death risk in patients (compare with Allele T)	Cisplatin	Osteosarcoma
GPV0017	Allele C	Correlated with the increased death risk in patients (compare with Allele T)	Doxorubicin	Osteosarcoma
GPV0017	Allele C	Correlated with the increased death risk in patients (compare with Allele T)	Cyclophosphamide	Osteosarcoma
GPV0017	Allele C	Irrelevant to the drug response in patients (compare with Allele T)	Doxorubicin	Breast Neoplasm
GPV0017	Allele C	Irrelevant to the drug response in patients (compare with Allele T)	Cyclophosphamide	Breast Neoplasm
GPV0018	Allele C	Correlated with the increased drug response in patients (compare with Allele T)	Citalopram	Major Depressive Disorder
GPV0018	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele T)	Citalopram	Depression
GPV0018	Genotype TT	Correlated with the decreased drug metabolism in patients (compare with genotype Ct)	Carbamazepine	Epilepsy
GPV0019	Allele G	Correlated with the increased likelihood of remission in patients (compare with Allele A)	Citalopram	Depression
GPV0019	Genotype AG	Correlated with the increased drug metabolism in patients (compare with genotype AA)	Carbamazepine	Epilepsy
GPV0020	Allele A	Correlated with the decreased neurotoxicity syndromes risk in patients (compare with allele G)	Vincristine	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0022	Allele A	Correlated with the increased likelihood of remission in patients (compare with allele C)	Citalopram	Depression
GPV0022	Allele G	Correlated with the decreased drug response in patients (compare with Allele A)	Clozapine	Schizophrenia
GPV0023	Allele C	Correlated with the decreased drug clearance in patients (compare with Allele T)	Methadone	Opioid-Related Disorders
GPV0023	Allele T	Irrelevant to the drug trough concentration in patients (compare with allele C)	Tacrolimus	Kidney Transplantation
GPV0023	Genotype CT	Correlated with the increased drug concentrations in patients (compare with Genotype TT)	Tacrolimus	Lung Transplantation
GPV0023	Genotypes CC + CT	Correlated with the decreased drug dose-adjusted trough concentrations in patients (compare with Genotype TT)	Tacrolimus	Kidney Transplantation
GPV0023	Genotypes CC + CT	Correlated with the increased respiratory insufficiency risk (compare with Genotype TT)	Morphine	Neoplasm
GPV0024	Allele C	Correlated with the decreased drug response in patients (compare with Allele G)	Atorvastatin	Hyperlipidemias
GPV0024	Allele C	Correlated with the decreased drug response in patients (compare with Allele G)	Pravastatin	Hyperlipidemias
GPV0024	Allele C	Correlated with the decreased drug response in patients (compare with Allele G)	Simvastatin	Hyperlipidemias
GPV0025	Genotype TT	Correlated with the increased HDL-cholesterol in patients (compare with genotype CC)	Pravastatin	Coronary Disease
GPV0027	Allele A	Correlated with the decreased drug response in patients (compare with allele G)	Clozapine	Schizophrenia
GPV0027	Allele G	Correlated with the increased likelihood of remission in patients (compare with Allele A)	Citalopram	Depression
GPV0028	Allele G	Correlated with the increased hypercholesterolemia risk in patients (compare with Allele A)	Atenolol	Hypertension
GPV0029	Allele A	Irrelevant to the drug response in patients (compare with Allele T)	Doxorubicin	Breast Neoplasm
GPV0029	Allele A	Irrelevant to the drug response in patients (compare with Allele T)	Cyclophosphamide	Breast Neoplasm
GPV0029	Allele C	Correlated with the increased death risk in patients (compare with Allele T)	Methotrexate	Osteosarcoma
GPV0029	Allele C	Correlated with the increased death risk in patients (compare with Allele T)	Vincristine	Osteosarcoma
GPV0029	Allele C	Correlated with the increased death risk in patients (compare with Allele T)	Cisplatin	Osteosarcoma
GPV0029	Allele C	Correlated with the increased death risk in patients (compare with Allele T)	Doxorubicin	Osteosarcoma
GPV0029	Allele C	Correlated with the increased death risk in patients (compare with Allele T)	Cyclophosphamide	Osteosarcoma
GPV0030	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele A)	Citalopram	Depression
GPV0031	Allele G	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele T)	Daunorubicin	Neoplasm
GPV0031	Allele G	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele T)	Doxorubicin	Neoplasm
GPV0032	Allele T	Irrelevant to the likelihood of cardiotoxicity in patients (compare with allele C)	Daunorubicin	Neoplasm
GPV0032	Allele T	Irrelevant to the likelihood of cardiotoxicity in patients (compare with allele C)	Doxorubicin	Neoplasm
GPV0033	Genotype CT	Correlated with the increased drug toxicity in patients (compare with genotype CC)	Haloperidol	Psychotic Disorders
GPV0034	Genotype CT	Correlated with the increased changes in FEV1 in patients (compare with genotype CC)	Montelukast	Asthma
GPV0035	Allele T	Irrelevant to the likelihood of cardiotoxicity in patients (compare with allele G)	Daunorubicin	Neoplasm
GPV0035	Allele T	Irrelevant to the likelihood of cardiotoxicity in patients (compare with allele G)	Doxorubicin	Neoplasm
GPV0036	Allele T	Correlated with the increased cardiotoxicity risk in patients (compare with allele G)	Doxorubicin	Non-Hodgkin Lymphoma
GPV0038	Allele G	Correlated with the increased kidney tubular dysfunction in patients (compare with Allele A)	Tenofovir	HIV Infection
GPV0039	Genotype CG	Correlated with the increased drug clearance in healthy individuals (compare with genotype CC)	Pravastatin	Healthy Individuals
GPV0039	Genotype CG	Correlated with the increased expression of ABCC2 mRnA in human liver samples (compare with genotype CC)	Pravastatin	Hypercholesterolemia
GPV0040	Genotype CC	Irrelevant to the neutropenia in patients (compare with genotypes CG + GG)	Docetaxel	Neoplasm
GPV0040	Genotypes CG + GG	Correlated with the decreased drug clearance (compare with genotype CC)	Docetaxel	Breast Neoplasm
GPV0041	Allele A	Correlated with the decreased renal proximal tubulopathy risk in patients (compare with Allele T); Irrelevant to the increased kidney tubular dysfunction risk in patients (compare with Allele T)	Tenofovir	HIV Infection
GPV0041	Allele A	Correlated with the increased cardiotoxicity risk in patients (compare with Allele T)	Doxorubicin	Non-Hodgkin Lymphoma
GPV0042	Allele A	Correlated with the decreased drug exposure in patients (compare with allele G)	Mycophenolic acid	Kidney Transplantation
GPV0042	Allele A	Correlated with the increased renal proximal tubulopathy risk in patients (compare with allele G); Irrelevant to the increased fanconi syndrome risk in patients (compare with Allele G); Irrelevant to the increased kidney tubular dysfunction risk in patients (compare with Allele G); Irrelevant to the likelihood of kidney diseases in patients (compare with Allele G)	Tenofovir	HIV Infection
GPV0042	Allele A	Irrelevant to the drug discontinuation in patients (compare with allele G)	Methotrexate	Rheumatoid Arthritis
GPV0042	Allele A	Irrelevant to the number of seizures per year in patients (compare with Allele G)	Carbamazepine	Epilepsy
GPV0042	Allele G	Irrelevant to the drug metabolism in patients (compare with allele A)	Mycophenolic acid	Kidney Transplantation
GPV0042	Allele G	Irrelevant to the increased drug resistance in patients (compare with allele A)	Carbamazepine	Epilepsy
GPV0042	Genotype AA	Correlated with the increased likelihood of drug toxicity in patients (compare with genotypes AG + GG)	Methotrexate	Rheumatoid Arthritis
GPV0042	Genotype AG	Correlated with the increased drug concentrations in patients (compare with genotype GG)	Mycophenolic acid	Lung Transplantation
GPV0042	Genotype AG	Correlated with the relationship with drug resistance in patients (compare with genotype GG)	Carbamazepine	Epilepsy
GPV0042	Genotype GG	Correlated with the increased anemia risk in patients (compare with genotypes AA + AG)	Fluorouracil	Breast Neoplasm
GPV0042	Genotype GG	Correlated with the increased anemia risk in patients (compare with genotypes AA + AG)	Doxorubicin	Breast Neoplasm
GPV0042	Genotype GG	Correlated with the increased anemia risk in patients (compare with genotypes AA + AG)	Cyclophosphamide	Breast Neoplasm
GPV0042	Genotype GG	Irrelevant to the any pharmacokinetic parameters measured in the study in patients (compare with genotype AA)	Mycophenolic acid	Kidney Transplantation
GPV0042	Genotypes AA + AG	Correlated with the increased drug metabolism in patients (compare with genotype GG)	Irinotecan	Colorectal Neoplasm
GPV0042	Genotypes AA + AG	Correlated with the increased neurological ADR risk in patients (compare with genotype GG); Irrelevant to the drug response in patients (compare with genotype GG)	Carbamazepine	Epilepsy
GPV0042	Genotypes AA + AG	Correlated with the increased overall survival and progression-free survival in patients (compare with genotype GG)	Cisplatin	Mesothelioma
GPV0042	Genotypes AA + AG	Correlated with the increased overall survival and progression-free survival in patients (compare with genotype GG)	Pemetrexed	Mesothelioma
GPV0042	Genotypes AA + AG	Irrelevant to the glomerular disease in patients (compare with genotype GG)	Tenofovir	HIV Infection
GPV0043	Genotype AA	Correlated with the increased recurrence of breast cancer risk in patients  (compare with genotype GG)	Tamoxifen	Breast Neoplasm
GPV0043	Genotype AG	Irrelevant to the disease recurrence risk in patients (compare with genotype AA)	Tamoxifen	Breast Neoplasm
GPV0043	Genotypes AG + GG	Correlated with the increased drug plasma level in patients (compare with genotype AA); Correlated with the increased toxicity risk in patients (compare with genotype AA)	Methotrexate	Acute B-Cell Leukemia
GPV0044	Allele C	Irrelevant to the drug metabolism in patients (compare with Allele T)	Mycophenolic acid	Kidney Transplantation
GPV0044	Allele T	Irrelevant to the drug trough concentration in patients (compare with allele C)	Tacrolimus	Kidney Transplantation
GPV0044	Genotype CC	Correlated with the increased diarrhea risk in patients (compare with Genotypes CT + TT); Irrelevant to the neutropenia in patients (compare with Genotypes CT + TT)	Irinotecan	Non-Small-Cell Lung Carcinoma
GPV0044	Genotype CC	Irrelevant to the any pharmacokinetic parameters measured in the study (compare with Genotype TT)	Mycophenolic acid	Organ Transplantation
GPV0044	Genotype CT	Correlated with the decreased drug concentrations in patients (compare with genotypes CC + tt)	Mycophenolic acid	Lung Transplantation
GPV0044	Genotype TT	Correlated with the increased neutropenia risk in patients (compare with genotypes CC + CT)	Fluorouracil	Breast Neoplasm
GPV0044	Genotype TT	Correlated with the increased neutropenia risk in patients (compare with genotypes CC + CT)	Doxorubicin	Breast Neoplasm
GPV0044	Genotype TT	Correlated with the increased neutropenia risk in patients (compare with genotypes CC + CT)	Cyclophosphamide	Breast Neoplasm
GPV0044	Genotype TT	Irrelevant to the drug resistance in patients (compare with genotype CC)	Carbamazepine	Epilepsy
GPV0044	Genotypes CT + TT	Correlated with the decreased drug dose in patients (compare with genotype CC); Correlated with the increased drug dose-adjusted trough concentrations in patients (compare with genotype CC)	Tacrolimus	Kidney Transplantation
GPV0044	Genotypes CT + TT	Correlated with the decreased drug metabolism in patients (compare with genotype CC)	Carbamazepine	Epilepsy
GPV0044	Genotypes CT + TT	Correlated with the increased nausea risk in patients (compare with genotype CC)	Fluorouracil	Breast Neoplasm
GPV0044	Genotypes CT + TT	Correlated with the increased nausea risk in patients (compare with genotype CC)	Doxorubicin	Breast Neoplasm
GPV0044	Genotypes CT + TT	Correlated with the increased nausea risk in patients (compare with genotype CC)	Cyclophosphamide	Breast Neoplasm
GPV0045	Allele C	Irrelevant to the nephrotoxicity risk in patients (compare with Allele T); Irrelevant to the prolonged high drug concentrations risk patients (compare with Allele T)	Methotrexate	Leukemia
GPV0045	Allele T	Correlated with the decreased drug clearance in patients (compare with Allele C); Correlated with the increased drug toxicity risk in patients (compare with Allele C )	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0045	Allele T	Correlated with the drug exposure in patients (compare with allele C)	Mycophenolic acid	Kidney Transplantation
GPV0045	Allele T	Correlated with the increased drug toxicity risk (compare with Genotype CC)	Lopinavir	HIV Infection
GPV0045	Allele T	Correlated with the increased drug toxicity risk (compare with Genotype CC)	Ritonavir	HIV Infection
GPV0045	Allele T	Correlated with the increased drug toxicity risk (compare with Genotype CC); Irrelevant to the likelihood of kidney diseases in patients (compare with allele C)	Tenofovir	HIV Infection
GPV0045	Genotype CC	Correlated with the increased drug toxicity risk in patients (compare with Genotypes CT + TT)	Fluorouracil	Colonic Neoplasm
GPV0045	Genotype CC	Correlated with the increased drug toxicity risk in patients (compare with Genotypes CT + TT)	Leucovorin	Colonic Neoplasm
GPV0045	Genotype CC	Correlated with the increased drug toxicity risk in patients (compare with Genotypes CT + TT)	Oxaliplatin	Colonic Neoplasm
GPV0045	Genotype CC	Correlated with the increased exanthema risk in patients (compare with genotype Ct)	Sorafenib	Renal Cell Carcinoma
GPV0045	Genotype CC	Correlated with the increased kidney tubular dysfunction risk in patients (compare with Genotypes CT + TT); Irrelevant to the increased renal proximal tubulopathy risk in patients (compare with Genotypes CT + TT)	Tenofovir	HIV Infection
GPV0045	Genotype CT	Correlated with the increased drug response in patients (compare with genotype CC)	Tamoxifen	Breast Neoplasm
GPV0045	Genotype TT	Correlated with the increased drug metabolism (compare with genotypes CC + CT)	Erythromycin	Bacterial Infections
GPV0045	Genotype TT	Correlated with the increased severity of neurotoxicity syndromes in patients (compare with genotypes CC + CT)	Fluorouracil	Colorectal Neoplasm
GPV0045	Genotype TT	Correlated with the increased severity of neurotoxicity syndromes in patients (compare with genotypes CC + CT)	Leucovorin	Colorectal Neoplasm
GPV0045	Genotype TT	Correlated with the increased severity of neurotoxicity syndromes in patients (compare with genotypes CC + CT)	Oxaliplatin	Colorectal Neoplasm
GPV0045	Genotypes CT + TT	Correlated with the decreased drug response in patients (compare with genotype CC)	Atorvastatin	Hypercholesterolemia
GPV0045	Genotypes CT + TT	Correlated with the increased drug clearance in patients (compare with genotype CC)	Methotrexate	Lymphoid
GPV0045	Genotypes CT + TT	Correlated with the increased drug distribution volume in patients (compare with genotype CC)	Leucovorin	Leukemia
GPV0045	Genotypes CT + TT	Irrelevant to the drug response in patients (compare with genotype CC)	Carbamazepine	Epilepsy
GPV0045	Genotypes CT + TT	Irrelevant to the glomerular disease in patients (compare with genotype CC)	Tenofovir	HIV Infection
GPV0046	Genotype CT	Correlated with the decreased drug clearance in patients (compare with genotype CC)	Tenofovir	HIV Infection
GPV0047	Allele T	Correlated with the decreased drug clearance in patients (compare with genotype CC)	Tenofovir	HIV Infection
GPV0048	Allele A	Correlated with the higher drug accumulation in patients (compare with genotype GG)	Lopinavir	HIV Infection
GPV0048	Allele A	Correlated with the increased cardiotoxicity risk in patients (compare with allele G)	Doxorubicin	Non-Hodgkin Lymphoma
GPV0049	Allele G	Correlated with the increased ototoxicity risk in patients (compare with Allele A); Irrelevant to the ototoxicity risk in patients (compare with allele A)	Cisplatin	Neoplasm
GPV0049	Allele G	Irrelevant to the likelihood of ototoxicity in patients (compare with allele A)	Cisplatin	Testicular Neoplasm
GPV0050	Allele T	Correlated with the increased death risk in patients (compare with allele C)	Methotrexate	Osteosarcoma
GPV0050	Allele T	Correlated with the increased death risk in patients (compare with allele C)	Vincristine	Osteosarcoma
GPV0050	Allele T	Correlated with the increased death risk in patients (compare with allele C)	Cisplatin	Osteosarcoma
GPV0050	Allele T	Correlated with the increased death risk in patients (compare with allele C)	Doxorubicin	Osteosarcoma
GPV0050	Allele T	Correlated with the increased death risk in patients (compare with allele C)	Cyclophosphamide	Osteosarcoma
GPV0051	Genotype CC	Correlated with the increased drug metabolism in patients (compare with Genotypes CT + TT)	Morphine	Pain
GPV0052	Allele G	Correlated with the increased likelihood of kidney diseases in patients (compare with Allele A)	Tenofovir	HIV Infection
GPV0053	Genotype AC	Correlated with the decreased drug response in patients (compare with genotype CC)	Latanoprost	Open-Angle Glaucoma
GPV0053	Genotype AC	Correlated with the increased neutropenia risk in patients (compare with genotype CC)	Valganciclovir	Kidney Transplantation
GPV0056	Genotype CT	Correlated with the decreased overall survival in patients (compare with genotype CC)	Irinotecan	Small Cell Carcinoma
GPV0056	Genotype CT	Correlated with the decreased overall survival in patients (compare with genotype CC)	Cisplatin	Small Cell Carcinoma
GPV0057	Allele T	Correlated with the increased drug response in patients (compare with allele G)	Furosemide	Heart Failure
GPV0058	Genotype AA	Correlated with the increased mucositis risk in patients (compare with genotypes AG + GG)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0059	Genotype AG	Correlated with the increased drug response in patients (compare with genotype AA)	Imatinib	Gastrointestinal Stromal Tumors
GPV0060	Allele T	Correlated with the increased adverse drug reaction risk in patients (compare with allele G)	Fluorouracil	Breast Neoplasm
GPV0060	Allele T	Correlated with the increased adverse drug reaction risk in patients (compare with allele G)	Doxorubicin	Breast Neoplasm
GPV0060	Allele T	Correlated with the increased adverse drug reaction risk in patients (compare with allele G); Correlated with the increased gastrointestinal toxicity risk in patients (compare with allele G); Correlated with the increased severity of neutropenia in patients (compare with allele G)	Cyclophosphamide	Breast Neoplasm
GPV0061	Allele T	Correlated with the decreased diarrhea risk in patients (compare with genotype CC)	Irinotecan	Colorectal Neoplasm
GPV0061	Allele T	Correlated with the decreased diarrhea risk in patients (compare with genotype CC)	Fluorouracil	Colorectal Neoplasm
GPV0061	Allele T	Correlated with the decreased diarrhea risk in patients (compare with genotype CC)	Leucovorin	Colorectal Neoplasm
GPV0062	Allele A	Correlated with the increased diarrhea risk in patients (compare with genotype GG)	Irinotecan	Colorectal Neoplasm
GPV0062	Allele A	Correlated with the increased diarrhea risk in patients (compare with genotype GG)	Fluorouracil	Colorectal Neoplasm
GPV0062	Allele A	Correlated with the increased diarrhea risk in patients (compare with genotype GG)	Leucovorin	Colorectal Neoplasm
GPV0063	Allele C	Correlated with the increased toxicity risk in patients (compare with Allele T)	Docetaxel	Prostatic Neoplasm
GPV0064	Allele T	Correlated with the decreased drug concentration in healthy individuals (compare with allele C)	Montelukast	Healthy Individuals
GPV0065	Allele T	Correlated with the increased neutropenia risk in patients (compare with genotype CC)	Irinotecan	Colorectal Neoplasm
GPV0065	Allele T	Correlated with the increased neutropenia risk in patients (compare with genotype CC)	Fluorouracil	Colorectal Neoplasm
GPV0065	Allele T	Correlated with the increased neutropenia risk in patients (compare with genotype CC)	Leucovorin	Colorectal Neoplasm
GPV0066	Allele G	Correlated with the increased sensitivity of drug in K562 cells (compare with Allele A)	Nilotinib	Chronic myelogenous leukaemia
GPV0066	Allele G	Correlated with the increased sensitivity of drug in K562 cells (compare with Allele A)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0066	Allele G	Correlated with the increased sensitivity of drug in K562 cells (compare with Allele A)	Dasatinib	Bacterial infections
GPV0067	Genotype CC	Correlated with the increased drug response in patients (compare with genotypes tt + Ct)	Methotrexate	Psoriasis
GPV0067	Genotypes CC + CT	Correlated with the increased drug response in patients (compare with Genotype TT)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0068	Genotype AG	Correlated with the increased mucositis risk in patients (compare with genotype AA)	Methotrexate	Osteosarcoma
GPV0069	Allele T	Correlated with the increased sensitivity to drug in K562 cells (compare with allele C)	Nilotinib	Chronic myelogenous leukaemia
GPV0069	Allele T	Correlated with the increased sensitivity to drug in K562 cells (compare with allele C)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0069	Allele T	Correlated with the increased sensitivity to drug in K562 cells (compare with allele C)	Dasatinib	Bacterial infections
GPV0069	Genotypes CT + TT	Correlated with the increased diarrhea risk in patients (compare with genotype CC); Irrelevant to the neutropenia in patients (compare with genotype CC)	Irinotecan	Non-Small-Cell Lung Carcinoma
GPV0070	Allele G	Irrelevant to the drug concentrations in patients (compare with Allele T); Irrelevant to the drug response in patients (compare with Allele T)	Lamotrigine	Epilepsy
GPV0070	Allele G	Irrelevant to the drug discontinuation in patients (compare with Allele T)	Methotrexate	Rheumatoid Arthritis
GPV0070	Allele G	Irrelevant to the severity of neutropenia in patients (compare with Allele T)	Gemcitabine	Non-Small-Cell Lung Carcinoma
GPV0070	Allele T	Correlated with the decreased drug response in patients (compare with allele G); Correlated with the increased drug dose in patients (compare with allele G)	Allopurinol	Gout
GPV0070	Allele T	Correlated with the decreased LDL-C in patients (compare with allele G); Correlated with the increased drug plasma concentrations in patients (compare with allele G); Correlated with the increased drug response in patients (compare with allele G); Correlated with the increased reduction in low-density lipoprotein cholesterol (LDL-C) level in patients (compare with allele G)	Rosuvastatin	Hypercholesterolemia
GPV0070	Allele T	Correlated with the increased drug concentrations in patients (compare with allele G)	Lamotrigine	Epilepsy
GPV0070	Allele T	Correlated with the increased drug exposure in healthy individuals (compare with allele G)	Rosuvastatin	Healthy Individuals
GPV0070	Allele T	Correlated with the increased sensitivity to drug in K562 cells (compare with allele G)	Nilotinib	Chronic myelogenous leukaemia
GPV0070	Allele T	Correlated with the increased sensitivity to drug in K562 cells (compare with allele G)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0070	Allele T	Correlated with the increased sensitivity to drug in K562 cells (compare with allele G)	Dasatinib	Bacterial infections
GPV0070	Allele T	Irrelevant to the increased drug toxicity risk in patients (compare with allele G)	Gefitinib	Lung Neoplasm
GPV0070	Genotype GG	Correlated with the decreased drug response in patients (compare with Genotypes GT + TT)	Leucovorin	Colorectal Neoplasm
GPV0070	Genotype GG	Correlated with the decreased drug response in patients (compare with Genotypes GT + TT); Irrelevant to the drug response in patients (compare with Genotypes GT + TT)	Fluorouracil	Colorectal Neoplasm
GPV0070	Genotype GG	Correlated with the decreased drug response in patients (compare with Genotypes GT + TT); Irrelevant to the drug response in patients (compare with Genotypes GT + TT)	Oxaliplatin	Colorectal Neoplasm
GPV0070	Genotype GG	Correlated with the decreased percentage change in LDL-cholesterol levels in patients (compare with Genotype TT)	Rosuvastatin	Hypercholesterolemia
GPV0070	Genotype GG	Correlated with the decreased the total area under the plasma concentration-time curve (AUC) of drug in healthy individuals (compare with genotypes tt + Gt)	Rosuvastatin	Healthy Individuals
GPV0070	Genotype GG	Irrelevant to the drug response in patients (compare with Genotypes GT + TT)	Irinotecan	Colorectal Neoplasm
GPV0070	Genotype GG	Irrelevant to the drug toxicity risk in patients (compare with Genotypes GT + TT); Irrelevant to the increased likelihood of drug toxicity in patients (compare with Genotypes GT + TT)	Gefitinib	Non-Small-Cell Lung Carcinoma
GPV0070	Genotype GT	Correlated with the decreased drug metabolism in patients (compare with genotype GG)	Imatinib	Neoplasm
GPV0070	Genotype GT	Correlated with the increased anemia risk in patients (compare with genotype GG)	Fluorouracil	Breast Neoplasm
GPV0070	Genotype GT	Correlated with the increased anemia risk in patients (compare with genotype GG)	Doxorubicin	Breast Neoplasm
GPV0070	Genotype GT	Correlated with the increased anemia risk in patients (compare with genotype GG)	Cyclophosphamide	Breast Neoplasm
GPV0070	Genotype GT	Correlated with the increased drug exposure in healthy individuals (compare with genotype GG)	Sulfasalazine	Healthy Individuals
GPV0070	Genotype GT	Correlated with the increased drug exposure in healthy individuals (compare with genotype GG)	Rosuvastatin	Healthy Individuals
GPV0070	Genotype GT	Correlated with the increased likelihood of diarrhea in patients (compare with genotype GG)	Gefitinib	Lung Neoplasm
GPV0070	Genotype TT	Correlated with the decreased drug clearance in healthy individuals (compare with genotypes GG + Gt)	Sulfasalazine	Healthy Individuals
GPV0070	Genotype TT	Correlated with the decreased likelihood of adverse events in patients (compare with genotype GG)	Methotrexate	Rheumatoid Arthritis
GPV0070	Genotype TT	Correlated with the decreased neutropenia risk in patients (compare with genotypes GG + Gt); Correlated with the increased drug toxicity risk in patients (compare with genotypes GG + Gt); Correlated with the increased hand-foot syndrome risk in patients (compare with genotypes GG + Gt); Correlated with the increased neutropenia risk in patients (compare with genotypes GG + Gt); Correlated with the increased thrombocytopenia risk in patients (compare with genotypes GG + Gt); Irrelevant to the anemia risk in patients (compare with genotypes GG + Gt)	Sunitinib	Renal Cell Carcinoma
GPV0070	Genotype TT	Correlated with the increased drug concentrations in patients (compare with genotype GG)	Apixaban	Atrial Fibrillation
GPV0070	Genotype TT	Correlated with the increased drug concentrations in patients (compare with genotypes GG + Gt)	Lamotrigine	Epilepsy
GPV0070	Genotype TT	Correlated with the increased drug concentrations in patients (compare with genotypes GG + Gt)	Dolutegravir	HIV Infection
GPV0070	Genotype TT	Correlated with the increased drug exposure in healthy individuals (compare with genotypes GG + Gt)	Fluvastatin	Healthy Individuals
GPV0070	Genotype TT	Correlated with the increased drug exposure in healthy individuals (compare with genotypes GG + Gt)	Simvastatin	Healthy Individuals
GPV0070	Genotype TT	Correlated with the increased drug plasma concentrations in patients (compare with genotype GG)	Rosuvastatin	Hypercholesterolemia
GPV0070	Genotype TT	Correlated with the increased the total area under the plasma concentration-time curve (AUC) in healthy individuals (compare with genotypes GG + Gt)	Rosuvastatin	Healthy Individuals
GPV0070	Genotype TT	Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug in healthy individuals (compare with genotypes GG + Gt)	Atorvastatin	Healthy Individuals
GPV0070	Genotypes GG + GT	Correlated with the increased drug clearance in patients (compare with Genotype TT)	Apixaban	Atrial Fibrillation
GPV0070	Genotypes GT + TT	Correlated with the decreased drug response in patients (compare with genotype GG)	Allopurinol	Gout
GPV0070	Genotypes GT + TT	Correlated with the increased drug concentrations in patients (compare with genotype GG)	Lamotrigine	Epilepsy
GPV0070	Genotypes GT + TT	Correlated with the increased drug concentrations in patients (compare with genotype GG)	Tenofovir	HIV Infection
GPV0070	Genotypes GT + TT	Correlated with the increased drug exposure in patients (compare with genotype GG)	Sunitinib	Neoplasm
GPV0070	Genotypes GT + TT	Correlated with the increased drug response in patients (compare with genotype GG)	Sulfasalazine	Rheumatoid Arthritis
GPV0070	Genotypes GT + TT	Correlated with the increased progression-free survival in patients (compare with genotype GG); Correlated with the increased severity of thrombocytopenia in patients (compare with genotype GG); Irrelevant to the overall survival in patients (compare with genotype GG)	Gemcitabine	Non-Small-Cell Lung Carcinoma
GPV0071	Allele C	Correlated with the increased sensitivity to drug in K562 cells (compare with Allele G)	Nilotinib	Chronic myelogenous leukaemia
GPV0071	Allele C	Correlated with the increased sensitivity to drug in K562 cells (compare with Allele G)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0071	Allele C	Correlated with the increased sensitivity to drug in K562 cells (compare with Allele G)	Dasatinib	Bacterial infections
GPV0072	Allele T	Correlated with the increased sensitivity to drug in K562 cells (compare with allele C)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0072	Allele T	Correlated with the increased sensitivity to drug in K562 cells (compare with allele C)	Dasatinib	Bacterial infections
GPV0073	Allele C	Correlated with the increased sensitivity to drug in K562 cells (compare with Allele A)	Nilotinib	Chronic myelogenous leukaemia
GPV0073	Allele C	Correlated with the increased sensitivity to drug in K562 cells (compare with Allele A)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0073	Allele C	Correlated with the increased sensitivity to drug in K562 cells (compare with Allele A)	Dasatinib	Bacterial infections
GPV0075	Allele A	Correlated with the increased grade 3-4 nonhematological toxicity risk in patients (compare with allele G); Correlated with the increased tumor response rate in patients (compare with allele G)	Irinotecan	Colorectal Neoplasm
GPV0075	Allele A	Correlated with the increased grade 3-4 nonhematological toxicity risk in patients (compare with allele G); Correlated with the increased tumor response rate in patients (compare with allele G)	Fluorouracil	Colorectal Neoplasm
GPV0075	Allele A	Correlated with the increased grade 3-4 nonhematological toxicity risk in patients (compare with allele G); Correlated with the increased tumor response rate in patients (compare with allele G)	Leucovorin	Colorectal Neoplasm
GPV0076	Genotype CG	Correlated with the increase coronary artery disease risk in patients (compare with genotype GG); Irrelevant to the drug response in patients (compare with genotype GG)	Atorvastatin	Coronary Artery Disease
GPV0076	Genotype GG	Irrelevant to the drug response in patients (compare with genotype CG)	Atorvastatin	Hypercholesterolemia
GPV0076	Genotypes CC + CG	Correlated with the increased drug response in patients (compare with genotype GG)	Atorvastatin	Hypercholesterolemia
GPV0077	Allele A	Correlated with the increased drug toxicity risk in patients (compare with allele G)	Docetaxel	Prostatic Neoplasm
GPV0078	Allele A	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele G)	Daunorubicin	Neoplasm
GPV0078	Allele A	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele G)	Doxorubicin	Neoplasm
GPV0079	Allele A	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele G)	Daunorubicin	Neoplasm
GPV0079	Allele A	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele G)	Doxorubicin	Neoplasm
GPV0081	Allele C	Correlated with the increased 24-h excretion of chloride and potassium in healthy individuals (compare with Allele G)	Torsemide	Healthy Individuals
GPV0081	Allele C	Correlated with the increased 24-h excretion of chloride and potassium in healthy individuals (compare with Allele G)	Furosemide	Healthy Individuals
GPV0081	Allele C	Correlated with the increased 24-h excretion of chloride and potassium in healthy individuals (compare with Allele G)	Bumetanide	Healthy Individuals
GPV0081	Genotype CC	Correlated with the increased drug response in healthy individuals (compare with genotype GG)	Torsemide	Healthy Individuals
GPV0081	Genotype CC	Correlated with the increased drug response in healthy individuals (compare with genotype GG)	Furosemide	Healthy Individuals
GPV0081	Genotype CC	Correlated with the increased drug response in healthy individuals (compare with genotype GG)	Bumetanide	Healthy Individuals
GPV0083	Genotype AA	Correlated with the larger mean changes in systolic and diastolic blood pressure in patients (compare with genotype GG)	Nifedipine	Hypertension
GPV0083	Genotype GA	Correlated with the larger mean changes in systolic and diastolic blood pressure in patients (compare with genotype GG)	Nifedipine	Hypertension
GPV0084	Genotype AA	Correlated with the smaller mean changes in systolic and diastolic blood pressure in patients (compare with genotype GG)	Nifedipine	Hypertension
GPV0084	Genotype GA	Correlated with the Smaller mean changes in systolic and diastolic blood pressure in patients (compare with genotype GG)	Nifedipine	Hypertension
GPV0085	Genotype CC	Correlated with the decreased progression-free survival in patients (compare with Genotypes CT + TT)	Sorafenib	Hepatocellular Carcinoma
GPV0086	Allele T	Correlated with the decreased likelihood of ototoxicity in patients (compare with allele C)	Cisplatin	Testicular Neoplasm
GPV0087	Allele A	Correlated with the increased drug non-response risk in patients (compare with Allele T)	Methotrexate	Rheumatoid Arthritis
GPV0088	Allele C	Correlated with the increased vomiting in patients (compare with Allele T); Irrelevant to the differences in plasma or cerebrospinal fluid homocysteine levels or in toxicity in patients (compare with Allele T); Irrelevant to the drug response in patients (compare with Allele T)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Allele C	Irrelevant to the nephrotoxicity risk in patients (compare with Allele T); Irrelevant to the prolonged high drug concentrations risk patients (compare with Allele T)	Methotrexate	Leukemia
GPV0088	Allele T	Correlated with the increased drug response in patients (compare with allele C)	Folic Acid	Rheumatoid Arthritis
GPV0088	Allele T	Correlated with the increased drug response in patients (compare with allele C)	Sulfasalazine	Rheumatoid Arthritis
GPV0088	Allele T	Correlated with the increased drug response in patients (compare with allele C)	Hydroxychloroquine	Rheumatoid Arthritis
GPV0088	Allele T	Correlated with the increased drug response in patients (compare with allele C); Correlated with the increased drug response in patients (compare with allele C); Irrelevant to the drug response in patients (compare with allele C)	Methotrexate	Rheumatoid Arthritis
GPV0088	Allele T	Correlated with the worse prognose in patients (compare with genotype CC)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Genotype CC	Correlated with the increased drug response in patients (compare with Genotypes CT + TT)	Irinotecan	Colorectal Neoplasm
GPV0088	Genotype CC	Correlated with the increased drug response in patients (compare with Genotypes CT + TT)	Fluorouracil	Colorectal Neoplasm
GPV0088	Genotype CC	Correlated with the increased drug response in patients (compare with Genotypes CT + TT)	Leucovorin	Colorectal Neoplasm
GPV0088	Genotype CC	Correlated with the increased drug toxicity risk in patients (compare with Genotypes CT + TT)	Methotrexate	Rheumatoid Arthritis
GPV0088	Genotype CC	Correlated with the increased likelihood of toxic liver disease in patients (compare with genotypes tt + Ct)	Mercaptopurine	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Genotype CC	Correlated with the increased likelihood of toxic liver disease in patients (compare with genotypes tt + Ct)	Leucovorin	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Genotype CC	Correlated with the increased likelihood of toxic liver disease in patients (compare with genotypes tt + Ct); Correlated with the increased severity of mucositis risk in patients (compare with Genotypes CT + TT)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Genotype CC	Correlated with the increased overall survival in patients (compare with Genotype TT)	Methotrexate	Osteosarcoma
GPV0088	Genotype CT	Correlated with the decreased drug response in patients (compare with Genotype TT)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Genotype TT	Correlated with the decreased disease activity in patients (compare with genotypes CC + CT); Correlated with the decreased drug response in patients (compare with genotype CC); Correlated with the increased aminotransferase activity in patients (compare with genotypes CC + CT); Correlated with the increased likelihood of remission in patients (compare with genotype CC); Correlated with the increased methotrexate polyglutamate (mtXPG3-5) levels in patients (compare with genotypes CC + CT)	Methotrexate	Rheumatoid Arthritis
GPV0088	Genotype TT	Correlated with the increased likelihood of myelosuppression in patients (compare with genotypes CC + CT); Correlated with the increased likelihood of staying in remission in patients (compare with genotypes CC + CT); Correlated with the increased likelihood of toxic liver disease in patients (compare with genotypes CC + CT); Correlated with the increased plasma drug levels in patients (compare with genotypes CC + CT); Irrelevant to the drug concentrations in patients (compare with genotypes CC + CT); Irrelevant to the drug toxicity risk in patients (compare with genotypes CC + CT)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Genotype TT	Correlated with the increased likelihood of staying in remission in patients (compare with genotypes CC + CT)	Mercaptopurine	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Genotype TT	Correlated with the increased likelihood of staying in remission in patients (compare with genotypes CC + CT)	Leucovorin	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Genotype TT	Correlated with the increased neoplasm metastasis risk in patients (compare with genotypes CC + CT)	Methotrexate	Osteosarcoma
GPV0088	Genotype TT	Correlated with the increased toxic liver disease risk in patients (compare with genotype CC); Irrelevant to the increased drug concentrations in patients (compare with genotype CC)	Methotrexate	Lymphoma
GPV0088	Genotypes CC + CT	Correlated with the increased gastrointestinal toxicity risk in patients (compare with Genotype TT); Correlated with the increased severity of disease in patients (compare with Genotype TT)	Methotrexate	Rheumatoid Arthritis
GPV0088	Genotypes CC + CT	Irrelevant to the mucositis risk in patients (compare with Genotype TT)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Genotypes CT + TT	Correlated with the decreased drug discontinuation in patients (compare with genotype CC); Correlated with the increased drug response in patients (compare with genotype CC)	Methotrexate	Rheumatoid Arthritis
GPV0088	Genotypes CT + TT	Correlated with the increased drug toxicity risk in patients (compare with genotype CC)	Mercaptopurine	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Genotypes CT + TT	Correlated with the increased drug toxicity risk in patients (compare with genotype CC); Irrelevant to the drug concentrations in patients (compare with genotype CC)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Genotypes TT + CT	Correlated with the increased likelihood of drug toxicity in patients (compare with genotype CC)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0088	Genotypes TT + CT	Correlated with the increased likelihood of drug toxicity in patients (compare with genotype CC); Correlated with the increased likelihood of treatment interruptions in patients (compare with genotype CC)	Mercaptopurine	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0089	Allele G	Correlated with the increased progression-free survival in patients (compare with Allele A)	Pemetrexed	Lung Neoplasm
GPV0089	Genotypes AA + AG	Correlated with the decreased overall survival in patients (compare with genotype GG)	Pemetrexed	Non-Small-Cell Lung Carcinoma
GPV0090	Allele A	Correlated with the decreased drug response in patients (compare with allele G)	Fluorouracil	Uterine Cervical Neoplasm
GPV0090	Allele A	Correlated with the decreased drug response in patients (compare with allele G)	Cisplatin	Uterine Cervical Neoplasm
GPV0090	Allele A	Correlated with the decreased drug response in patients (compare with allele G)	Carboplatin	Uterine Cervical Neoplasm
GPV0091	Genotype AA	Correlated with the decreased drug response in patients (compare with genotypes AG + GG)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0092	Allele T	Correlated with the increased likelihood of treatment inefficacy in patients (compare with allele C)	Methotrexate	Rheumatoid Arthritis
GPV0096	Allele C	Correlated with the increased drug bioavailability (AUC, CL & AUC/CL ratio)	Metformin	Diabetes Mellitus
GPV0096	Allele T	Correlated with the higher o-desmethyltramadol plasma concentrations in healthy individuals (compare with allele C)	Tramadol	Healthy Individuals
GPV0096	Allele T	Correlated with the increased drug exposure in healthy individuals (compare with allele C)	Metformin	Healthy Individuals
GPV0096	Allele T	Irrelevant to the drug response in patients (compare with allele C)	Metformin	Diabetes Mellitus
GPV0096	Allele T	Irrelevant to the drug response in patients (compare with allele C)	Metformin	Polycystic Ovary Syndrome
GPV0096	Genotype TT	Correlated with the decreased drug exposure in healthy individuals (compare with genotype CC)	Metformin	Healthy Individuals
GPV0097	Genotype CC	Correlated with the increased drug clearance in healthy individuals (compare with Genotypes CT + TT)	Metformin	Healthy Individuals
GPV0099	Genotype DEL	Correlated with the increased plasma concentrations of o-desmethyltramadol in healthy individuals (compare with allele A)	Tramadol	Healthy Individuals
GPV0100	Allele GTAAGTTG	Correlated with the gastrointestinal side effects in patients (compare with allele del)	Metformin	Diabetes Mellitus
GPV0102	Allele A	Correlated with the decreased drug response in patients (compare with allele G); Correlated with the gastrointestinal toxicity in patients (compare with allele G)	Metformin	Diabetes Mellitus
GPV0102	Allele A	Irrelevant to the drug response in patients (compare with Allele G)	Lamotrigine	Epilepsy
GPV0102	Genotype GG	Correlated with the increased drug dose in patients (compare with genotypes AA + AG)	Lamotrigine	Epilepsy
GPV0102	Genotypes AA + AG	Correlated with the increased drug concentrations in patients (compare with genotype GG)	Lamotrigine	Epilepsy
GPV0103	Genotype CC	Correlated with the decreased drug concentrations in patients (compare with genotypes CG + GG); Correlated with the increased drug clearance in patients (compare with genotypes CG + GG)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0103	Genotypes CG + GG	Correlated with the increased conjunctival hemorrhage risk in patients (compare with genotype CC)	Imatinib	Gastrointestinal Stromal Tumors
GPV0104	Genotype GAT/DEL	Correlated with the decreased drug trough steady-state concentration in patients (compare with genotype GAt/GAt)	Metformin	Diabetes Mellitus
GPV0105	Allele A	Irrelevant to the likelihood of febrile neutropenia in patients (compare with Allele G)	Doxorubicin	Breast Neoplasm
GPV0105	Allele G	Correlated with the increased likelihood of drug toxicity in patients (compare with Allele A)	Doxorubicin	Breast Neoplasm
GPV0105	Allele G	Correlated with the increased likelihood of drug toxicity in patients (compare with Allele A)	Cyclophosphamide	Breast Neoplasm
GPV0106	Allele G	Correlated with the decreased likelihood of dose delay in patients (compare with Allele A)	Doxorubicin	Breast Neoplasm
GPV0106	Allele G	Correlated with the decreased likelihood of dose delay in patients (compare with Allele A)	Cyclophosphamide	Breast Neoplasm
GPV0106	Genotypes AG + GG	Correlated with the decreased neutropenia risk in patients (compare with Genotype AA)	Fluorouracil	Breast Neoplasm
GPV0106	Genotypes AG + GG	Correlated with the decreased neutropenia risk in patients (compare with Genotype AA)	Doxorubicin	Breast Neoplasm
GPV0106	Genotypes AG + GG	Correlated with the decreased neutropenia risk in patients (compare with Genotype AA)	Cyclophosphamide	Breast Neoplasm
GPV0107	Allele C	Correlated with the decreased likelihood of dose delay in patients (compare with Allele T)	Doxorubicin	Breast Neoplasm
GPV0107	Allele C	Correlated with the decreased likelihood of dose delay in patients (compare with Allele T)	Cyclophosphamide	Breast Neoplasm
GPV0107	Genotype CC	Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug in patients (compare with genotypes tt + Ct)	Doxorubicin	Breast Neoplasm
GPV0107	Genotypes CC + CT	Correlated with the increased nausea risk in patients (compare with Genotype TT)	Fluorouracil	Breast Neoplasm
GPV0107	Genotypes CC + CT	Correlated with the increased nausea risk in patients (compare with Genotype TT)	Doxorubicin	Breast Neoplasm
GPV0107	Genotypes CC + CT	Correlated with the increased nausea risk in patients (compare with Genotype TT)	Cyclophosphamide	Breast Neoplasm
GPV0108	Allele G	Correlated with the decreased likelihood of dose delay in patients (compare with Allele A)	Doxorubicin	Breast Neoplasm
GPV0108	Allele G	Correlated with the decreased likelihood of dose delay in patients (compare with Allele A)	Cyclophosphamide	Breast Neoplasm
GPV0109	Allele A	Correlated with the decreased ototoxicity risk in patients (compare with allele C)	Cisplatin	Neoplasm
GPV0109	Allele A	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele C)	Daunorubicin	Neoplasm
GPV0109	Allele A	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele C)	Doxorubicin	Neoplasm
GPV0109	Allele A	Irrelevant to the steady-state concentration of metformin in healthy individuals (compare with Allele C)	Metformin	Healthy Individuals
GPV0109	Allele C	Irrelevant to the likelihood of ototoxicity in patients (compare with Allele A)	Cisplatin	Testicular Neoplasm
GPV0109	Genotype AC	Correlated with the decreased nephrotoxicity risk in patients (compare with genotype CC)	Cisplatin	Neoplasm
GPV0109	Genotype CC	Correlated with the increased drug clearance (compare with genotypes AA + AC)	L-Tryptophan	Depression
GPV0109	Genotype CC	Correlated with the increased drug clearance in healthy individuals (compare with genotype AC)	Metformin	Healthy Individuals
GPV0109	Genotype CC	Irrelevant to the increased likelihood of nephrotoxicity in patients (compare with genotypes AA + AC)	Cisplatin	Neoplasm
GPV0110	Allele G	Correlated with the decreased drug response in healthy individuals (compare with Allele C)	Metformin	Healthy Individuals
GPV0110	Allele G	Correlated with the decreased expression of SLC22A3 (compare with Allele C)	Metformin	Diabetes Mellitus
GPV0111	Allele T	Correlated with the decreased drug metabolism (compare with allele C)	Metformin	Diabetes Mellitus
GPV0112	Allele T	Correlated with the decreased the drug K(m) (compare with Allele C); Irrelevant to the increased drug toxicity risk in patients (compare with allele C)	Cidofovir	Cytomegalovirus Infection
GPV0112	Allele T	Correlated with the decreased the drug K(m) (compare with Allele C); Irrelevant to the increased drug toxicity risk in patients (compare with allele C)	Tenofovir	HIV Infection
GPV0112	Allele T	Irrelevant to the the drug uptake (compare wuth Allele C)	Methotrexate	Acute B-Cell Leukemia
GPV0115	Genotype GG	Correlated with the decreased hematologic toxicity risk in patients (compare with genotypes AA + AG)	Gemcitabine	Non-Small-Cell Lung Carcinoma
GPV0116	Allele C	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele A)	Daunorubicin	Neoplasm
GPV0116	Allele C	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele A)	Doxorubicin	Neoplasm
GPV0117	Allele T	Irrelevant to the likelihood of cardiotoxicity in patients (compare with allele C)	Daunorubicin	Neoplasm
GPV0117	Allele T	Irrelevant to the likelihood of cardiotoxicity in patients (compare with allele C)	Doxorubicin	Neoplasm
GPV0118	Genotype AA	Irrelevant to the increased drug response in patients (compare with genotypes AC + CC)	Gemcitabine	Pancreatic Neoplasm
GPV0118	Genotype CC	Correlated with the decreased drug response in patients (compare with genotypes AA + AC); Correlated with the decreased hematologic toxicity risk in patients (compare with genotypes AA + AC)	Gemcitabine	Non-Small-Cell Lung Carcinoma
GPV0119	Genotype CC	Correlated with the decreased drug response in patients (compare with Genotypes CT + TT); Correlated with the decreased hematologic toxicity risk in patients (compare with Genotypes CT + TT)	Gemcitabine	Non-Small-Cell Lung Carcinoma
GPV0119	Genotype TT	Correlated with the increased anemia risk in patients (compare with genotypes CC + CT)	Ribavirin	Hepatitis C
GPV0120	Allele A	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele C)	Daunorubicin	Neoplasm
GPV0120	Allele A	Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele C)	Doxorubicin	Neoplasm
GPV0121	Allele A	Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C)	Daunorubicin	Neoplasm
GPV0121	Allele A	Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C)	Doxorubicin	Neoplasm
GPV0123	Allele A	Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C)	Daunorubicin	Neoplasm
GPV0123	Allele A	Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C)	Doxorubicin	Neoplasm
GPV0124	Allele G	Correlated with the decreased drug response in patients (compare with Allele C)	Gemcitabine	Breast Neoplasm
GPV0124	Allele G	Correlated with the decreased drug response in patients (compare with Allele C)	Paclitaxel	Breast Neoplasm
GPV0125	Allele A	Correlated with the decreased drug response in patients (compare with allele G)	Gemcitabine	Breast Neoplasm
GPV0125	Allele A	Correlated with the decreased drug response in patients (compare with allele G)	Paclitaxel	Breast Neoplasm
GPV0125	Genotype GG	Correlated with the decreased drug response in patients (compare with genotypes AA + AG)	Gemcitabine	Pancreatic Neoplasm
GPV0125	Genotype GG	Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Ribavirin	Chronic Hepatitis C
GPV0125	Genotypes AG + GG	Correlated with the increased drug response in patients (compare with genotype AA)	Trifluridine	Colorectal Neoplasm
GPV0126	Genotype CC	Irrelevant to the increased drug response in patients (compare with Genotypes CT + TT)	Gemcitabine	Pancreatic Neoplasm
GPV0126	Genotypes CT + TT	Correlated with the increased drug response in patients (compare with genotype CC)	Trifluridine	Colorectal Neoplasm
GPV0126	Genotypes CT + TT	Correlated with the increased neutropenia risk in patients (compare with genotype CC)	Gemcitabine	Pancreatic Neoplasm
GPV0127	Allele C	Correlated with the increased drug response in patients (compare with Allele T)	Metformin	Diabetes Mellitus
GPV0128	Allele A	Correlated with the decreased aspirin-induced asthma risk in patients (compare with allele G)	Aspirin	Asthma
GPV0132	Genotype AA	Correlated with the increased overall survival in patients (compare with genotypes AG + GG)	Cisplatin	Non-Small-Cell Lung Carcinoma
GPV0132	Genotype AA	Correlated with the increased overall survival in patients (compare with genotypes AG + GG)	Carboplatin	Non-Small-Cell Lung Carcinoma
GPV0134	Allele C	Irrelevant to the drug response in patients (compare with Allele T)	Metformin	Polycystic Ovary Syndrome
GPV0134	Genotype CC	Correlated with the increased drug response in healthy individuals (compare with Genotypes CT + TT)	Metformin	Healthy Individuals
GPV0134	Genotype CC	Correlated with the increased drug response in patients (compare with Genotypes CT + TT)	Metformin	Diabetes Mellitus
GPV0135	Allele A	Irrelevant to the drug response in patients (compare with Allele G)	Metformin	Diabetes Mellitus
GPV0135	Allele A	Irrelevant to the drug response in patients (compare with Allele G)	Metformin	Polycystic Ovary Syndrome
GPV0135	Genotype AA	Correlated with the increased drug response in patients (compare with genotypes AG + GG)	Metformin	Diabetes Mellitus
GPV0135	Genotype GG	Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Metformin	Diabetes Mellitus
GPV0136	Allele A	Irrelevant to the drug response in patients (compare with Allele G)	Metformin	Polycystic Ovary Syndrome
GPV0136	Allele A	Irrelevant to the steady-state concentration of metformin in healthy individuals (compare with Allele G)	Metformin	Healthy Individuals
GPV0136	Genotype AA	Correlated with the decreased drug response in healthy individuals (compare with genotypes AG + GG); Correlated with the increased drug renal clearance and secretion clearance in healthy individuals (compare with genotype GG); Irrelevant to the differences in the plasma metformin concentration versus time curve or the maximum metformin concentration in healthy individuals (compare with genotype GG); Irrelevant to the drug glucose-lowering effect in healthy individuals (compare with genotype GG)	Metformin	Healthy Individuals
GPV0136	Genotype AA	Correlated with the decreased drug response in patients (compare with genotypes AG + GG)	Metformin	Diabetes Mellitus
GPV0136	Genotype GG	Irrelevant to the increased drug clearance in healthy individuals (compare with genotypes AA + AG)	Metformin	Healthy Individuals
GPV0136	Genotypes AA + AG	Correlated with the increased renal and secretory drug clearance in healthy individuals (compare with genotype GG)	Metformin	Healthy Individuals
GPV0137	Genotype AA	Correlated with the increased drug renal clearance and secretion clearance in healthy individuals (compare with genotype GG); Irrelevant to the differences in the plasma metformin concentration versus time curve or the maximum drug concentration in healthy individuals (compare with genotype GG); Irrelevant to the drug glucose-lowering effect in healthy individuals (compare with genotype GG)	Metformin	Healthy Individuals
GPV0138	Allele G	Correlated with the increased likelihood of asthma in patients (compare with Allele A)	Aspirin	Asthma
GPV0143	Allele A	Correlated with the increased drug response in patients (compare with Allele T)	Clozapine	Schizophrenia
GPV0144	Genotype CACATACCATGCAACATACACACTCAGACA/CACATACCATGCAACATACACACTCAGACA	Correlated with the increased drug response in patients (compare with genotypes CACAtACCAtGCAACAtACACACtCAGACA/del + del/del)	Levodopa	Parkinson Disease
GPV0144	Genotype CACATACCATGCAACATACACACTCAGACA/CACATACCATGCAACATACACACTCAGACA	Correlated with the increased drug response in patients (compare with genotypes CACAtACCAtGCAACAtACACACtCAGACA/del + del/del)	Methylphenidate	Parkinson Disease
GPV0147	Allele C	Correlated with the increased likelihood of side effects in patients (compare with Allele T)	Citalopram	Dementia
GPV0147	Allele C	Irrelevant to the drug response in patients (compare with Allele T)	Citalopram	Depression
GPV0147	Allele C	Irrelevant to the increased likelihood of remission in patients (compare with Allele T)	Citalopram	Major Depressive Disorder
GPV0149	Genotype AA	Correlated with the motor side effects in patients (compare with genotypes AG + GG)	Haloperidol	Schizophrenia
GPV0150	Genotype CC	Correlated with the decreased drug clearance in patients (compare with Genotypes CT + TT)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0151	Genotype AC	Correlated with the increased drug clearance in healthy individuals (compare with genotype CC)	Rifampicin	Healthy Individuals
GPV0151	Genotype CC	Correlated with the decreased LDL-C reduction in patients (compare with genotypes AA + AC)	Fluvastatin	Hypercholesterolemia
GPV0152	Allele A	Correlated with the decreased drug clearance in patients (compare with allele G)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0154	Allele C	Correlated with the decreased drug clearance in patients (compare with Allele T)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0154	Allele T	Correlated with the increased drug clearance in patients (compare with allele C); Correlated with the increased gastrointestinal toxicity in patients (compare with allele C)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0154	Allele T	Correlated with the increased gastrointestinal toxicity in patients (compare with allele C)	Mercaptopurine	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0154	Genotypes CC + CT	Correlated with the increased drug concentrations in patients (compare with Genotype TT)	Methotrexate	Osteosarcoma
GPV0154	Genotypes CC + CT	Irrelevant to the drug concentrations in patients (compare with Genotype TT)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0156	Allele A	Correlated with the decreased drug clearance in patients (compare with allele G)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0156	Allele G	Irrelevant to the likelihood of statin-related myopathy in patients (compare with allele A)	Atorvastatin	Coronary Artery Disease
GPV0156	Allele G	Irrelevant to the likelihood of statin-related myopathy in patients (compare with allele A)	Rosuvastatin	Coronary Artery Disease
GPV0156	Allele G	Irrelevant to the likelihood of statin-related myopathy in patients (compare with allele A)	Simvastatin	Coronary Artery Disease
GPV0156	Genotype AA	Correlated with the decreased drug concentrations in patients (compare with genotypes AG + GG)	Mycophenolic acid	Lung Transplantation
GPV0156	Genotype AA	Correlated with the increased drug response in patients (compare with genotypes AG + GG)	Atorvastatin	Hypercholesterolemia
GPV0156	Genotype AA	Irrelevant to the drug response in patients (compare with genotype GG)	Pravastatin	Hypercholesterolemia
GPV0156	Genotype GG	Correlated with the decreased drug clearance in healthy individuals (compare with genotypes AA + AG)	Rifampicin	Healthy Individuals
GPV0156	Genotype GG	Correlated with the decreased the total area under the plasma concentration-time curve (AUC) of drug and Cmax in healthy individuals (compare with genotype AA)	Repaglinide	Healthy Individuals
GPV0156	Genotype GG	Correlated with the increased neutropenia risk in patients (compare with genotype AA)	Irinotecan	Neoplasm
GPV0156	Genotype GG	Correlated with the increased reduction in LDL in patients (compare with genotypes AA + AG); Irrelevant to the increased drug response in patients (compare with genotypes AA + AG)	Atorvastatin	Hypercholesterolemia
GPV0156	Genotype GG	Irrelevant to the increased drug response in patients (compare with genotypes AA + AG)	Simvastatin	Hypercholesterolemia
GPV0156	Genotype GG	Irrelevant to the neutropenia in patients (compare with genotypes AA + AG)	Irinotecan	Non-Small-Cell Lung Carcinoma
GPV0156	Genotypes AA + AG	Correlated with the decreased drug clearance in patients (compare with genotype GG)	Mycophenolic acid	Kidney Transplantation
GPV0156	Genotypes AA + AG	Correlated with the increased drug clearance in patients (compare with genotype GG)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0156	Genotypes AA + AG	Correlated with the increased drug response in patients (compare with genotype GG)	Irinotecan	Colorectal Neoplasm
GPV0156	Genotypes AA + AG	Correlated with the increased drug response in patients (compare with genotype GG)	Fluorouracil	Colorectal Neoplasm
GPV0156	Genotypes AA + AG	Correlated with the increased drug response in patients (compare with genotype GG)	Leucovorin	Colorectal Neoplasm
GPV0156	Genotypes AG + GG	Correlated with the decreased likelihood of diarrhea in patients (compare with genotype AA)	Sorafenib	Diarrhea
GPV0156	Genotypes AG + GG	Correlated with the increased drug response in patients (compare with genotype AA); Irrelevant to the increased myalgia unspecified risk in patients (compare with genotype AA)	Atorvastatin	Hypercholesterolemia
GPV0156	Genotypes AG + GG	Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug and Cmax in healthy individuals (compare with genotype AA)	Pitavastatin calcium	Healthy Individuals
GPV0156	Genotypes AG + GG	Irrelevant to the drug concentrations in patients (compare with genotype AA)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0156	Genotypes AG + GG	Irrelevant to the severity of neutropenia in patients (compare with genotype AA)	Irinotecan	Neoplasm
GPV0158	Genotype AG	Correlated with the decreased drug response (compare with genotype GG)	Pravastatin	Hypercholesterolemia
GPV0158	Genotype AG	Correlated with the increased drug AUC0-12 in healthy individuals (compare with genotype GG)	Pravastatin	Healthy Individuals
GPV0158	Genotypes AA + AG	Correlated with the increased neutropenia in patients (compare with genotype GG); Irrelevant to the diarrhea in patients (compare with genotype GG)	Irinotecan	Non-Small-Cell Lung Carcinoma
GPV0159	Allele T	Correlated with the decreased drug exposure in patients (compare with allele C)	Rifampicin	Tuberculosis
GPV0160	Allele C	Correlated with the all statin-induced myopathy and severe myopathy in patients (compare with Allele T)	Fluvastatin	Muscular Diseases
GPV0160	Allele C	Correlated with the all statin-induced myopathy and severe myopathy in patients (compare with Allele T)	Simvastatin	Muscular Diseases
GPV0160	Allele C	Correlated with the all statin-induced myopathy and severe myopathy in patients (compare with Allele T); Correlated with the increased drug plasma concentrations in patients (compare with Allele T)	Atorvastatin	Muscular Diseases
GPV0160	Allele C	Correlated with the all statin-induced myopathy and severe myopathy in patients (compare with Allele T); Correlated with the increased drug plasma concentrations in patients (compare with Allele T)	Rosuvastatin	Muscular Diseases
GPV0160	Allele C	Correlated with the all statin-induced myopathy and severe myopathy in patients (compare with Allele T); Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug and Cmax in patients (compare with Allele T)	Pravastatin	Muscular Diseases
GPV0160	Allele C	Correlated with the decreased adverse drug reactions risk in patients (compare with Allele T)	Mycophenolate mofetil	Kidney Transplantation
GPV0160	Allele C	Correlated with the decreased drug clearance in patients (compare with Allele T)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0160	Allele C	Correlated with the decreased drug metabolism in healthy individuals (compare with Allele T); Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug in healthy individuals (compare with Allele T)	Pravastatin	Healthy Individuals
GPV0160	Allele C	Correlated with the increased composite adverse events risk in patients (compare with Allele T)	Atorvastatin	Hypercholesterolemia
GPV0160	Allele C	Correlated with the increased composite adverse events risk in patients (compare with Allele T)	Pravastatin	Hypercholesterolemia
GPV0160	Allele C	Correlated with the increased composite adverse events risk in patients (compare with Allele T)	Simvastatin	Hypercholesterolemia
GPV0160	Allele C	Correlated with the increased drug plasma concentrations in patients (compare with Allele T)	Rosuvastatin	Hypercholesterolemia
GPV0160	Allele C	Correlated with the increased likelihood of statin-related myopathy in patients (compare with Allele T)	Rosuvastatin	Coronary Artery Disease
GPV0160	Allele C	Correlated with the increased likelihood of toxic liver disease in patients (compare with Allele T)	Cytarabine	Acute Myeloid Leukemia
GPV0160	Allele C	Irrelevant to the drug pharmacokinetics (compare with Genotype TT)	Nateglinide	Diabetes
GPV0160	Allele C	Irrelevant to the muscular diseases risk in patients (compare with Allele T)	Atorvastatin	Hyperlipidemias
GPV0160	Allele T	Correlated with the increased drug exposure in healthy individuals (compare with allele C)	Rosuvastatin	Healthy Individuals
GPV0160	Allele T	Irrelevant to the increased diarrhea risk in patients (compare with allele C); Irrelevant to the increased leukopenia risk in patients (compare with allele C)	Mycophenolate mofetil	Kidney Transplantation
GPV0160	Allele T	Irrelevant to the LDL-C response in patients (compare with allele C)	Rosuvastatin	Coronary Disease
GPV0160	Allele T	Irrelevant to the LDL-C response in patients (compare with allele C)	Simvastatin	Coronary Disease
GPV0160	Genotype CC	Correlated with the decreased drug response in patients (compare with Genotypes CT + TT)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0160	Genotype CC	Correlated with the increased drug AUC in patients (p=0.002) and Cmax in patients (p=0.003) (compare with Genotype TT)	Rosuvastatin	Hypercholesterolemia
GPV0160	Genotype CC	Correlated with the increased drug mean peak concentration in plasma and area under the plasma concentration in patients (compare with Genotypes CT + TT); Irrelevant to the drug response in patients (compare with Genotype TT)	Pravastatin	Hypercholesterolemia
GPV0160	Genotype CC	Correlated with the increased drug median plasma Cmin and C2-6 (compare with Genotypes CT + TT)	Lopinavir	HIV Infection
GPV0160	Genotype CC	Correlated with the increased drug plasma concentrations in healthy individuals (compare with Genotypes CT + TT)	Simvastatin	Healthy Individuals
GPV0160	Genotype CC	Correlated with the increased likelihood of muscular diseases in patients (compare with Genotype TT)	Simvastatin	Myocardial Infarction
GPV0160	Genotype CC	Correlated with the increased muscular diseases risk in patients (compare with genotype Ct); Irrelevant to the increased drug dose decrease or switch to another cholesterol-lowering drug risk in patients (compare with Genotype TT)	Simvastatin	Muscular Diseases
GPV0160	Genotype CC	Correlated with the increased rhabdomyolysis risk in patients (compare with Genotype TT)	Cerivastatin	Muscular Diseases
GPV0160	Genotype CC	Correlated with the increased rhabdomyolysis risk in patients (compare with Genotype TT)	Cerivastatin	Rhabdomyolysis
GPV0160	Genotype CC	Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug (compare with Genotypes CT + TT)	Repaglinide	Diabetes Mellitus
GPV0160	Genotype CC	Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug in healthy individuals (compare with Genotype TT)	Atorvastatin	Healthy Individuals
GPV0160	Genotype CC	Irrelevant to the increased mean peak concentration in plasma and area under the plasma concentration in patients (compare with Genotypes CT + TT)	Fluvastatin	Muscular Diseases
GPV0160	Genotype CT	Correlated with the decreased drug clearance in patients (compare with Genotype TT); Correlated with the increased muscular diseases risk in patients (compare with Genotype TT)	Simvastatin	Muscular Diseases
GPV0160	Genotype CT	Correlated with the decreased drug response in patients (compare with Genotype TT)	Pravastatin	Coronary Stenosis
GPV0160	Genotype CT	Correlated with the decreased drug response in patients (compare with Genotype TT); Correlated with the increased drug AUC0-12 in patients (compare with Genotype TT); Correlated with the increased drug metabolism in patients (compare with Genotype TT)	Pravastatin	Muscular Diseases
GPV0160	Genotype CT	Correlated with the drug response in patients (compare with Genotype TT)	Pravastatin	Transplantation
GPV0160	Genotype CT	Correlated with the increased drug AUC and Cmax in healthy individuals (compare with Genotype TT); Correlated with the increased drug AUC0-12 in healthy individuals (compare with Genotype TT)	Pravastatin	Healthy Individuals
GPV0160	Genotype CT	Correlated with the increased drug concentrations in healthy individuals (compare with Genotype TT)	Repaglinide	Healthy Individuals
GPV0160	Genotype CT	Correlated with the increased drug exposure in healthy individuals (compare with Genotype TT)	Atorvastatin	Healthy Individuals
GPV0160	Genotype CT	Correlated with the increased drug exposure in healthy individuals (compare with Genotype TT)	Rosuvastatin	Healthy Individuals
GPV0160	Genotype CT	Irrelevant to the increased drug metabolism in patients (compare with Genotype TT)	Pravastatin	Hyperlipoproteinemia
GPV0160	Genotype CT	Irrelevant to the severity of neutropenia in patients (compare with Genotype TT)	Irinotecan	Neoplasm
GPV0160	Genotype TT	Correlated with the a nearly tripled increased percentage of drug  AUC (0 - 48) values in patients (compare with genotype CC)	Atorvastatin	Coronary Artery Disease
GPV0160	Genotype TT	Correlated with the a nearly tripled increased percentage of drug  AUC (0 - 48) values in patients (compare with genotype CC)	Rifampicin	Tuberculosis
GPV0160	Genotype TT	Correlated with the decreased drug concentrations in patients (compare with genotypes CC + CT)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0160	Genotype TT	Correlated with the decreased drug plasma concentrations in patients (compare with genotypes CC + CT); Irrelevant to the percentage change in LDL-cholesterol levels in patients (compare with Genotypes CT + TT)	Rosuvastatin	Hypercholesterolemia
GPV0160	Genotype TT	Correlated with the increased adverse drug reaction risk in patients (compare with genotype CC)	Mycophenolate mofetil	Kidney Transplantation
GPV0160	Genotype TT	Correlated with the increased alcoholism risk in patients (compare with genotype GG)	Fluorouracil	Breast Neoplasm
GPV0160	Genotype TT	Correlated with the increased alcoholism risk in patients (compare with genotype GG)	Epirubicin	Breast Neoplasm
GPV0160	Genotype TT	Correlated with the increased alcoholism risk in patients (compare with genotype GG)	Docetaxel	Breast Neoplasm
GPV0160	Genotype TT	Correlated with the increased alcoholism risk in patients (compare with genotype GG)	Doxorubicin	Breast Neoplasm
GPV0160	Genotype TT	Correlated with the increased alcoholism risk in patients (compare with genotype GG)	Cyclophosphamide	Breast Neoplasm
GPV0160	Genotype TT	Correlated with the increased drug response as in patients (compare with genotypes CC + CT)	Fluvastatin	Muscular Diseases
GPV0160	Genotypes CC + CT	Correlated with the decreased drug clearance in patients (compare with Genotype TT); Correlated with the decreased drug dose in patients (compare with Genotype TT)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0160	Genotypes CC + CT	Correlated with the decreased drug dose in patients (compare with Genotype TT)	Mercaptopurine	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0160	Genotypes CC + CT	Correlated with the decreased drug oral clearance in patients (compare with Genotype TT)	Atorvastatin	Obesity
GPV0160	Genotypes CC + CT	Correlated with the increased drug dose decrease or switch to another cholesterol-lowering drug risk in patients (compare with Genotype TT); Correlated with the increased likelihood of drug toxicity, muscular diseases, rhabdomyolysis and toxic liver disease in patients (compare with Genotype TT); Irrelevant to the increased drug dose decrease or switch to another cholesterol-lowering drug risk in patients (compare with Genotype TT)	Atorvastatin	Muscular Diseases
GPV0160	Genotypes CC + CT	Correlated with the increased drug dose in patients (compare with Genotype TT)	Sn-38	Non-Small-Cell Lung Carcinoma
GPV0160	Genotypes CC + CT	Correlated with the increased likelihood of cough in patients (compare with Genotype TT)	Enalapril	Essential Hypertension
GPV0160	Genotypes CC + CT	Correlated with the increased muscular diseases risk in patients (compare with Genotype TT)	Simvastatin	Hyperlipidemias
GPV0160	Genotypes CC + CT	Correlated with the increased neutropenia risk in patients (compare with Genotype TT)	Irinotecan	Non-Small-Cell Lung Carcinoma
GPV0160	Genotypes CC + CT	Irrelevant to the diarrhea in patients (compare with Genotype TT)	Irinotecan	Neoplasm
GPV0160	Genotypes CC + CT	Irrelevant to the increased myalgia unspecified risk in patients (compare with Genotype TT)	Atorvastatin	Hypercholesterolemia
GPV0160	Genotypes CC + CT	Irrelevant to the increased myalgia unspecified risk in patients (compare with Genotype TT)	Rosuvastatin	Muscular Diseases
GPV0160	Genotypes CT + TT	Correlated with the increased likelihood of disease in patients (compare with genotype CC)	Sorafenib	Thrombocytopenia
GPV0160	Genotypes CT + TT	Irrelevant to the drug concentrations in patients (compare with genotype CC)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0160	Genotypes CT + TT	Irrelevant to the the drug response in patients (compare with genotype CC)	Pravastatin	Hypercholesterolemia
GPV0161	Allele G	Correlated with the drug clearance in patients (compare with allele A); Correlated with the increased gastrointestinal toxicity risk in patients (compare with Allele A)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0161	Genotype AA	Correlated with the increased LDL-C reduction in patients (compare with genotypes AG + GG)	Rosuvastatin	Coronary Disease
GPV0161	Genotype AA	Correlated with the increased LDL-C reduction in patients (compare with genotypes AG + GG)	Simvastatin	Coronary Disease
GPV0161	Genotype AG	Correlated with the increased LDL-C reduction in patients (compare with genotype GG)	Rosuvastatin	Coronary Disease
GPV0161	Genotype AG	Correlated with the increased LDL-C reduction in patients (compare with genotype GG)	Simvastatin	Coronary Disease
GPV0162	Genotype CC	Correlated with the increased likelihood of muscular diseases in patients (compare with Genotype TT)	Simvastatin	Myocardial Infarction
GPV0162	Genotypes CC + CT	Irrelevant to the increased myalgia unspecified risk in patients (compare with Genotype TT)	Rosuvastatin	Muscular Diseases
GPV0163	Allele G	Correlated with the increased leukopenia risk in patients (compare with Allele A)	Docetaxel	Neoplasm
GPV0164	Allele G	Correlated with the decreased dose-normalized Cmax and dose-normalized AUC0to12 h in patients (compare with Allele T); Correlated with the increased adverse drug reactions risk in patients (compare with Allele T); Irrelevant to the drug clearance in patients (compare with Allele T)	Mycophenolate mofetil	Kidney Transplantation
GPV0164	Allele T	Irrelevant to the increased leukopenia risk in patients (compare with allele G)	Mycophenolate mofetil	Kidney Transplantation
GPV0164	Genotype GG	Correlated with the decreased overall survival in patients (compare with Genotypes GT + TT)	Sunitinib	Gastrointestinal Stromal Tumors
GPV0164	Genotype GG	Correlated with the increased anemia risk in patients (compare with Genotypes GT + TT)	Paclitaxel	Non-Small-Cell Lung Carcinoma
GPV0164	Genotype GG	Correlated with the increased anemia risk in patients (compare with Genotypes GT + TT)	Carboplatin	Non-Small-Cell Lung Carcinoma
GPV0164	Genotype GG	Correlated with the increased dose-adjusted area under the curve of mycophenolic acid in patients (AUC6-12) (compare with Genotype TT)	Mycophenolate mofetil	Kidney Transplantation
GPV0164	Genotype TT	Correlated with the increased diarrhea risk in patients (compare with genotype GG); Correlated with the increased diarrhea risk in patients (compare with genotype Gt)	Mycophenolate mofetil	Kidney Transplantation
GPV0164	Genotypes GT + TT	Correlated with the decreased likelihood of thrombocytopenia in patients (compare with genotype GG)	Paclitaxel	Lung Neoplasm; Malignant Tumor Of Peritoneum; Ovarian Neoplasm; Uterine Neoplasm
GPV0164	Genotypes GT + TT	Correlated with the decreased likelihood of thrombocytopenia in patients (compare with genotype GG)	Carboplatin	Lung Neoplasm; Malignant Tumor Of Peritoneum; Ovarian Neoplasm; Uterine Neoplasm
GPV0165	Allele A	Correlated with the decreased drug clearance in patients (compare with allele G); Irrelevant to the drug clearance in patients (compare with allele G)	Mycophenolate mofetil	Kidney Transplantation
GPV0165	Allele A	Correlated with the decreased transport of drug (compare with allele G)	Paclitaxel	Non-Small-Cell Lung Carcinoma
GPV0165	Genotype AA	Correlated with the increased anemia risk in patients (compare with genotypes AG + GG)	Paclitaxel	Non-Small-Cell Lung Carcinoma
GPV0165	Genotype AA	Correlated with the increased anemia risk in patients (compare with genotypes AG + GG)	Carboplatin	Non-Small-Cell Lung Carcinoma
GPV0165	Genotype AA	Correlated with the increased dose-adjusted area under the curve (AUC6-12) of mycophenolic acid in patients (compare with genotype GG)	Mycophenolate mofetil	Kidney Transplantation
GPV0168	Allele A	Irrelevant to the drug clearance in healthy individuals (compare with allele G)	Montelukast	Healthy Individuals
GPV0168	Genotype AG	Correlated with the decreased drug response in patients (compare with genotype GG)	Montelukast	Asthma
GPV0169	Allele T	Correlated with the decreased area under the plasma concentration-time curve (AUC) in healthy individuals (compare with genotype CC)	Fexofenadine	Healthy Individuals
GPV0171	Allele C	Irrelevant to the decreased hemoglobin levels in patients (compare with Allele A)	Glibenclamide	Diabetes Mellitus
GPV0171	Allele C	Irrelevant to the decreased hemoglobin levels in patients (compare with Allele A)	Glimepiride	Diabetes Mellitus
GPV0171	Allele C	Irrelevant to the decreased hemoglobin levels in patients (compare with Allele A)	Glipizide	Diabetes Mellitus
GPV0172	Allele G	Irrelevant to the likelihood of ototoxicity in patients (compare with Allele T)	Cisplatin	Testicular Neoplasm
GPV0172	Genotypes GG + GT	Correlated with the increased severity of ototoxicity in patients (compare with Genotype TT)	Cisplatin	Non-Small-Cell Lung Carcinoma
GPV0174	Allele C	Irrelevant to the drug response in patients (compare with Allele T)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0174	Genotypes CT + TT	Correlated with the decreased drug concentrations in patients (compare with genotype CC); Irrelevant to the mucositis risk in patients (compare with genotype CC)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0175	Allele C	Irrelevant to the drug response in patients (compare with Allele T)	Methotrexate	Rheumatoid Arthritis
GPV0175	Genotype TT	Correlated with the increased drug response in patients (compare with genotypes CC + CT)	Methotrexate	Psoriasis
GPV0176	Allele A	Irrelevant to the drug response in patients (compare with Allele G)	Methylphenidate	Attention Deficit Disorder With Hyperactivity
GPV0176	Genotype GG	Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Methylphenidate	Attention Deficit Disorder With Hyperactivity
GPV0177	Allele C	Irrelevant to the neutropenia and thrombocytopenia risk in patients (compare with Allele T)	Gemcitabine	Non-Small-Cell Lung Carcinoma
GPV0177	Genotypes CT + TT	Correlated with the increased overall survival in patients (compare with genotype CC); Irrelevant to the progression-free survival in patients (compare with genotype CC)	Gemcitabine	Non-Small-Cell Lung Carcinoma
GPV0179	Genotypes AC + CC	Correlated with the increased severity of neutropenia in patients (compare with genotype AA)	Irinotecan	Colorectal Neoplasm
GPV0180	Genotypes CT + TT	Correlated with the decreased drug concentrations in patients (compare with genotype CC)	Dabigatran	Atrial Fibrillation
GPV0183	Genotypes AG + GG	Correlated with the decreased severity of neutropenia in patients (compare with genotype AA)	Irinotecan	Colorectal Neoplasm
GPV0184	Genotypes CC + CT	Correlated with the increased drug resistance in patients (compare with Genotype TT)	Lamivudine	HIV Infection
GPV0184	Genotypes CC + CT	Correlated with the increased drug resistance in patients (compare with Genotype TT)	Lopinavir	HIV Infection
GPV0184	Genotypes CC + CT	Correlated with the increased drug resistance in patients (compare with Genotype TT)	Zidovudine	HIV Infection
GPV0184	Genotypes CC + CT	Correlated with the increased drug resistance in patients (compare with Genotype TT)	Ritonavir	HIV Infection
GPV0185	Genotype GG	Correlated with the increased drug response in patients (compare with allele A); Correlated with the increased toxicity risk in patients (compare with genotypes AA + AG)	Methotrexate	Psoriasis
GPV0186	Genotypes AG + GG	Correlated with the decreased drug response in patients (compare with genotype AA)	Methotrexate	Rheumatoid Arthritis
GPV0186	Genotypes GG + AG	Correlated with the decreased onset of toxicity risk in patients (compare with genotype AA)	Methotrexate	Psoriasis
GPV0187	Genotype GG	Correlated with the increased drug response in patients (compare with allele AG)	Methotrexate	Psoriasis
GPV0188	Genotypes CT + TT	Correlated with the increased drug exposure in patients (compare with genotype CC)	Sn-38	Colorectal Neoplasm
GPV0189	Genotypes CT + TT	Correlated with the decreased severity of neutropenia in patients (compare with genotype CC)	Irinotecan	Colorectal Neoplasm
GPV0190	Genotypes AG + GG	Correlated with the decreased drug response in patients (compare with genotype AA)	Methotrexate	Rheumatoid Arthritis
GPV0191	Genotypes AT + TT	Correlated with the increased drug exposure in patients (compare with genotype AA)	Sn-38	Colorectal Neoplasm
GPV0192	Genotypes GG + GT	Correlated with the increased leukopenia risk in patients (compare with Genotype TT)	Fluorouracil	Neoplasm
GPV0194	Genotypes AA + AG	Correlated with the increased drug clearance in patients (compare with genotype GG)	Carbamazepine	Epilepsy
GPV0195	Genotypes AA + AT	Correlated with the decreased likelihood of thrombocytopenia in patients (compare with Genotype TT); Correlated with the increased drug plasma levels in patients (compare with Genotype TT); Correlated with the increased relapse in the central nervous system risk in patients (compare with Genotype TT)	Methotrexate	Precursor Cell Lymphoblastic Leukemia-Lymphoma
GPV0196	Genotype TT	Correlated with the increased drug renal clearance, and lower the total area under the plasma concentration-time curve (AUC) in patients (compare with genotypes CC + CT)	Tenofovir	HIV Infection
GPV0196	Genotypes CC + CT	Correlated with the increased intracellular tenofovir diphosphate (tFV-DP) concentrations in patients (compare with Genotype TT)	Tenofovir	HIV Infection
GPV0197	Genotypes AC + CC	Correlated with the increased drug concentrations in patients (compare with genotype AA)	Tenofovir	HIV Infection
GPV0198	Genotype TT	Correlated with the increased sensitivity to drug in nA18967 cells (compare with genotype CC)	Mercaptopurine	Inflammatory Bowel Diseases
GPV0198	Genotypes CT + TT	Correlated with the increased likelihood of leukopenia in patients (compare with genotype CC)	Azathioprine	Inflammatory Bowel Diseases
GPV0198	Genotypes CT + TT	Correlated with the increased likelihood of leukopenia in patients (compare with genotype CC)	Mercaptopurine	Inflammatory Bowel Diseases
GPV0199	Genotypes GG + GT	Correlated with the decreased drug plasma level in patients (compare with Genotype TT); Correlated with the decreased toxicity risk in patients (compare with Genotype TT)	Methotrexate	Acute B-Cell Leukemia
GPV0200	Genotypes GG + GT	Correlated with the increased drug response in patients (compare with Genotype TT)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0201	Genotype GG	Correlated with the increased drug response in patients (compare with allele AG)	Methotrexate	Psoriasis
GPV0202	Genotypes CT + TT	Correlated with the increased drug response (compare with genotype CC)	Rosuvastatin	Hypercholesterolemia
GPV0203	Genotypes AC + CC	Correlated with the increased drug response in patients (compare with genotype AA)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0204	Genotypes CC + CT	Correlated with the increased drug concentrations in patients (compare with Genotype TT)	Lamotrigine	Epilepsy
GPV0205	Genotypes AA + AG	Correlated with the increased drug concentrations in patients (compare with genotype GG)	Topotecan	Brain Neoplasm
GPV0207	Genotypes GG + GT	Correlated with the decreased overall survival in patients (compare with Genotype TT)	Pemetrexed	Non-Small-Cell Lung Carcinoma
GPV0208	Genotype TT	Correlated with the decreased overall survival in patients (compare with genotypes CC + CT)	Pemetrexed	Non-Small-Cell Lung Carcinoma
GPV0209	Genotypes AA + AG	Correlated with the increased drug response in patients (compare with genotype GG)	Metformin	Diabetes Mellitus
GPV0217	Genotypes AT + TT	Correlated with the decreased drug response in patients (compare with genotype AA)	Methotrexate	Rheumatoid Arthritis
GPV0218	Genotype TT	Correlated with the increased likelihood of fever in patients (compare with genotypes CC + CT)	Cytarabine	Acute Myeloid Leukemia
GPV0219	Genotype TT	Correlated with the decreased drug response in patients (compare with genotypes CC + CT)	Imatinib	Gastrointestinal Stromal Tumors
GPV0219	Genotype TT	Correlated with the decreased drug response in patients (compare with genotypes CC + CT); Irrelevant to the drug response in patients (compare with genotypes CC + CT)	Imatinib	Bcr-Abl Positive Chronic Myelogenous Leukemia
GPV0220	Genotypes CG + GG	Correlated with the increased drug response in patients (compare with genotype CC)	Imatinib	Gastrointestinal Stromal Tumors
GPV0221	Genotypes CG + GG	Correlated with the increased drug response in patients (compare with genotype CC)	Imatinib	Gastrointestinal Stromal Tumors
GPV0222	Genotypes AA + AG	Correlated with the decreased periorbital edema risk in patients (compare with genotype GG)	Imatinib	Gastrointestinal Stromal Tumors
GPV0225	Genotype TTA/de	Correlated with the increased drug response in patienrs (compare with Genotype TTA/ttA)	Atenolol	Hypertension
GPV0226	Genotypes CC + CT	Correlated with the increased drug response in patients (compare with Genotype TT)	Ivacaftor	Cystic Fibrosis
GPV0227	Genotypes CT + TT	Correlated with the increased drug response in patients (compare with genotype CC)	Repaglinide	Diabetes Mellitus
GPV0233	Genotypes AA + AG	Correlated with the decreased gastrointestinal toxicity risk in patients (compare with genotype GG)	Melphalan	Multiple Myeloma
GPV0235	Genotypes GT + TT	Correlated with the increased drug response (compare with genotype GG)	Lovastatin	Hypercholesterolemia
GPV0236	Genotypes CT + TT	Correlated with the increased event-free survival and overall survival in patients (compare with genotype CC)	Etoposide	Acute Myeloid Leukemia
GPV0236	Genotypes CT + TT	Correlated with the increased event-free survival and overall survival in patients (compare with genotype CC)	Mitoxantrone	Acute Myeloid Leukemia
GPV0236	Genotypes CT + TT	Correlated with the increased event-free survival and overall survival in patients (compare with genotype CC)	Daunorubicin	Acute Myeloid Leukemia
GPV0236	Genotypes CT + TT	Correlated with the increased event-free survival and overall survival in patients (compare with genotype CC)	Cytarabine	Acute Myeloid Leukemia
GPV0237	Genotypes AC + CC	Correlated with the increased drug response in patients (compare with genotype AA)	Atorvastatin	Coronary Artery Disease
GPV0240	Allele G	Correlated with the drug response in patients	Quetiapine	Schizophrenia
GPV0245	Genotype GG	Correlated with the decreased drug response in patients (compare with genotype TT)	Methotrexate	Rheumatoid Arthritis
GPV0253	Genotype TT	Correlated with the increased drug dose in patients (compare with genotypes CC + CT)	Fentanyl	Postoperative Pain
GPV0254	Allele C	Correlated with the increased drug response in patients (compare with allele T)	Lamotrigine	Epilepsy
GPV0254	Allele C	Correlated with the increased drug response in patients (compare with allele T)	Levetiracetam	Epilepsy
GPV0254	Allele C	Correlated with the increased drug response in patients (compare with allele T)	Carbamazepine	Epilepsy
GPV0254	Allele C	Correlated with the increased drug response in patients (compare with allele T)	Valproic acid	Epilepsy
GPV0264	Allele C	Correlated with the aggressive periodontitis (compare with allele G)	Vitamin C	Periodontitis
GPV0265	Allele C	Correlated with the altered the distribution of dietary choline between the CDP-choline and phosphatidylethanolamine N-methyltransferase (PEMT) denovo pathway (compare with allele G)	Choline	Muscle dysfunction
GPV0276	Genotype GG	Correlated with the higher drug concentrations in plasma (compare with genotypes AA + AG)	Vitamin C	Chronic Lymphocytic Leukaemia
GPV0286	Allele G	Correlated with the increased risk muscle damage (compare with allele T)	Choline	Muscle dysfunction
GPV0294	Allele G	Correlated with the neuropsychiatric disorders (compare with C)	Reserpine	Neuropsychiatric Disorder
GPV0295	Allele A	Correlated with the neuropsychiatric disorders (compare with G)	Reserpine	Neuropsychiatric Disorder
GPV0304	Allele G	Correlated with the risk for schizophrenia (compare with T)	Reserpine	Neuropsychiatric Disorder
GPV0160	Allele C	Correlated with the increased drug response in patients (compare with Allele T)	Rosiglitazone	Diabetes Mellitus
GPV0294	Allele G	Correlated with the neuropsychiatric disorders (compare with C)	Tetrabenazine	Neuropsychiatric Disorder
GPV0295	Allele A	Correlated with the neuropsychiatric disorders (compare with G)	Tetrabenazine	Neuropsychiatric Disorder
GPV0304	Allele G	Correlated with the risk for schizophrenia (compare with T)	Tetrabenazine	Neuropsychiatric Disorder
GPV0243	Allele G	Correlated with the decreased response to duloxetine in people with Depressive Disorder, Major (compare with allele A)	Duloxetine	.
GPV0238	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Candesartan	Essential hypertension
GPV0255	Allele T	Correlated with the increased drug response in patients (compare with allele C)	Flecainide	Myotonia
GPV0238	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Irbesartan	Essential hypertension
GPV0003	Allele A	Correlated with the increased suicidal ideation risk in patients (compare with allele C)	Clomipramine	Depression
GPV0227	Genotypes CT + TT	Correlated with the increased drug response in healthy individuals (compare with genotype CC)	Zinc Acetate	Healthy Individuals
GPV0001	Genotype GG	Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Agomelatine	Depressive Disorder
GPV0125	Genotype GG	Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Peginterferon alfa-2A	Chronic Hepatitis C
GPV0004	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele T)	Amitriptyline	Depression
GPV0005	Allele T	Correlated with the increased likelihood of remission in patients (compare with allele C)	Amitriptyline	Depression
GPV0008	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Amitriptyline	Bipolar Disorder
GPV0008	Genotypes AG + GG	Correlated with the increased likelihood of remission in patients (compare with genotype AA)	Amitriptyline	Depression
GPV0010	Allele A	Correlated with the increased likelihood of remission in patients (compare with allele C)	Amitriptyline	Depression
GPV0010	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AA + AC)	Amitriptyline	Depression
GPV0011	Allele T	Correlated with the increased likelihood of remission in patients (compare with allele C)	Amitriptyline	Depression
GPV0013	Allele T	Correlated with the increased likelihood of remission in patients (compare with allele C)	Amitriptyline	Depression
GPV0018	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele T)	Amitriptyline	Depression
GPV0019	Allele G	Correlated with the increased likelihood of remission in patients (compare with Allele A)	Amitriptyline	Depression
GPV0022	Allele A	Correlated with the increased likelihood of remission in patients (compare with allele C)	Amitriptyline	Depression
GPV0027	Allele G	Correlated with the increased likelihood of remission in patients (compare with Allele A)	Amitriptyline	Depression
GPV0030	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele A)	Amitriptyline	Depression
GPV0003	Allele A	Correlated with the increased suicidal ideation risk in patients (compare with allele C)	Nefazodone	Depression
GPV0002	Genotype GG	Correlated with the decreased likelihood of adverse events in patients (compare with genotypes AA + AG); Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Sevoflurane	Tonsillectomy
GPV0055	Allele T	Correlated with the increased likelihood of osteonecrosis in patients (compare with allele C)	Bisphosphonates	Osteonecrosis
GPV0063	Allele C	Correlated with the increased toxicity risk in patients (compare with Allele T)	Thalidomide	Prostatic Neoplasm
GPV0077	Allele A	Correlated with the increased drug toxicity risk in patients (compare with allele G)	Thalidomide	Prostatic Neoplasm
GPV0225	Genotype TTA/de	Correlated with the increased drug response in patienrs (compare with Genotype TTA/ttA)	Hydrochlorothiazide	Hypertension
GPV0003	Allele A	Correlated with the increased drug response in patients (compare with allele C)	Fluoxetine	Depressive Disorder
GPV0003	Allele C	Irrelevant to the increased fluoxetine/in patients (S)-norfluoxetine ratio in patients (compare with Allele A)	Fluoxetine	Depressive Disorder
GPV0014	Allele T	Correlated with the increased drug response in patients (compare with allele C)	Fluoxetine	Major Depressive Disorder
GPV0018	Allele C	Correlated with the increased drug response in patients (compare with Allele T)	Fluoxetine	Major Depressive Disorder
GPV0018	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele T)	Fluoxetine	Depression
GPV0147	Allele C	Irrelevant to the drug response in patients (compare with Allele T)	Fluoxetine	Major Depressive Disorder
GPV0147	Genotypes CC + CT	Correlated with the increased reduced drug response risk in patients (compare with Genotype TT)	Fluoxetine	Major Depressive Disorder
GPV0002	Genotype GG	Correlated with the increased drug response (compare with genotypes AA + AG); Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Remifentanil	Tonsillectomy
GPV0171	Genotypes AA + CC	Correlated with the increased drug response in patients (compare with genotype AC)	Sulfonamides	Diabetes Mellitus
GPV0239	Allele T	Irrelevant to the drug response in patients (compare with allele C)	Sulfonamides	Diabetes Mellitus
GPV0001	Allele A	Correlated with the decreased drug response in patients (compare with allele G)	Oxcarbazepine	Epilepsy
GPV0001	Genotype GG	Correlated with the increased drug concentrations in patients (compare with genotypes AA + AG)	Oxcarbazepine	Epilepsy
GPV0042	Allele A	Irrelevant to the number of seizures per year in patients (compare with Allele G)	Oxcarbazepine	Epilepsy
GPV0042	Allele G	Irrelevant to the increased drug resistance in patients (compare with allele A)	Oxcarbazepine	Epilepsy
GPV0042	Genotype AG	Correlated with the relationship with drug resistance in patients (compare with genotype GG)	Oxcarbazepine	Epilepsy
GPV0044	Genotype TT	Irrelevant to the drug resistance in patients (compare with genotype CC)	Oxcarbazepine	Epilepsy
GPV0254	Allele C	Correlated with the increased drug response in patients (compare with allele T)	Oxcarbazepine	Epilepsy
GPV0166	Allele G	Correlated with the decreased drug response in patients (compare with Allele A)	Infliximab	Rheumatoid Arthritis
GPV0166	Genotypes AG + GG	Correlated with the decreased drug response in patients (compare with genotype AA)	Infliximab	Psoriatic Arthritis
GPV0166	Genotypes AG + GG	Correlated with the increased drug response in patients (compare with genotype AA)	Infliximab	Psoriasis
GPV0245	Genotype GG	Correlated with the decreased drug response in patients (compare with genotype TT)	Infliximab	Rheumatoid Arthritis
GPV0001	Genotype GG	Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Venlafaxine	Depressive Disorder
GPV0001	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Venlafaxine	Narcolepsy
GPV0003	Allele A	Correlated with the increased suicidal ideation risk in patients (compare with allele C)	Venlafaxine	Depression
GPV0004	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele T)	Venlafaxine	Depression
GPV0005	Allele T	Correlated with the increased likelihood of remission in patients (compare with allele C)	Venlafaxine	Depression
GPV0008	Allele G	Correlated with the increased likelihood of adverse effects in patients (compare with Allele A)	Venlafaxine	Major Depressive Disorder
GPV0008	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Venlafaxine	Bipolar Disorder
GPV0008	Genotypes AG + GG	Correlated with the increased likelihood of remission in patients (compare with genotype AA)	Venlafaxine	Depression
GPV0010	Allele A	Correlated with the increased likelihood of remission in patients (compare with allele C)	Venlafaxine	Depression
GPV0010	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AA + AC)	Venlafaxine	Depression
GPV0011	Allele T	Correlated with the increased likelihood of adverse effects in patients (compare with allele C)	Venlafaxine	Major Depressive Disorder
GPV0011	Allele T	Correlated with the increased likelihood of remission in patients (compare with allele C)	Venlafaxine	Depression
GPV0013	Allele T	Correlated with the increased likelihood of remission in patients (compare with allele C)	Venlafaxine	Depression
GPV0018	Allele C	Correlated with the increased drug response in patients (compare with Allele T)	Venlafaxine	Major Depressive Disorder
GPV0018	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele T)	Venlafaxine	Depression
GPV0019	Allele G	Correlated with the increased likelihood of remission in patients (compare with Allele A)	Venlafaxine	Depression
GPV0022	Allele A	Correlated with the increased likelihood of remission in patients (compare with allele C)	Venlafaxine	Depression
GPV0027	Allele G	Correlated with the increased likelihood of remission in patients (compare with Allele A)	Venlafaxine	Depression
GPV0030	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele A)	Venlafaxine	Depression
GPV0140	Genotype CC	Correlated with the increased drug response in patients (compare with Genotypes CT + TT)	Venlafaxine	Major Depressive Disorder
GPV0001	Allele A	Correlated with the decreased toxic liver disease risk in patients (compare with allele G); Correlated with the decreased toxic liver disease risk in patients (compare with allele G)	Nevirapine	HIV Infection
GPV0001	Genotype GG	Irrelevant to the drug metabolism in patients (compare with genotype AA)	Nevirapine	HIV Infection
GPV0003	Genotype AA	Irrelevant to the drug metabolism in patients (compare with genotype CC)	Nevirapine	HIV Infection
GPV0037	Genotype CC	Correlated with the increased likelihood of lower nevirapine plasma concentrations in patients (compare with Genotypes CT + TT)	Nevirapine	HIV Infection
GPV0001	Genotype AA	Correlated with the decreased drug metabolism in healthy individuals (compare with genotype GG)	Voriconazole	Healthy Individuals
GPV0112	Allele T	Correlated with the decreased the drug K(m) (compare with Allele C); Irrelevant to the increased drug toxicity risk in patients (compare with allele C)	Adefovir Dipivoxil	Hepatitis B
GPV0113	Allele T	Correlated with the decreased drug uptake (compare with Allele C)	Adefovir Dipivoxil	HBV Infection
GPV0113	Allele T	Correlated with the decreased drug uptake (compare with Allele C); Irrelevant to the drug clearance in patients (compare with Allele C); Irrelevant to the nephrotoxicity risk in patients (compare with Allele C)	Adefovir Dipivoxil	Hepatitis B
GPV0171	Allele C	Irrelevant to the decreased hemoglobin levels in patients (compare with Allele A)	Gliclazide	Diabetes Mellitus
GPV0241	Allele T	Irrelevant to the drug response in patients (compare with allele C)	Gliclazide	Diabetes Mellitus
GPV0002	Genotype AA	Correlated with the increased drug response in patients (compare with genotypes AG + GG)	Rocuronium	Muscle Relaxant
GPV0156	Genotype AA	Correlated with the decreased drug response in patients (compare with genotypes AG + GG)	Rocuronium	Muscle Relaxant
GPV0234	Genotypes T/del + TT	Correlated with the decreased drug clearance in healthy individuals (compare with genotype del/del)	Rocuronium	Healthy Individuals
GPV0166	Allele G	Irrelevant to the decreased drug response in patients (compare with Allele A)	Adalimumab	Rheumatoid Arthritis
GPV0245	Genotype GG	Correlated with the decreased drug response in patients (compare with genotype TT)	Adalimumab	Rheumatoid Arthritis
GPV0008	Allele G	Correlated with the increased likelihood of adverse effects in patients (compare with Allele A)	Sertraline	Major Depressive Disorder
GPV0008	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Sertraline	Bipolar Disorder
GPV0008	Genotypes AG + GG	Correlated with the increased likelihood of remission in patients (compare with genotype AA)	Sertraline	Depression
GPV0010	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AA + AC)	Sertraline	Depression
GPV0011	Allele T	Correlated with the increased likelihood of adverse effects in patients (compare with allele C)	Sertraline	Major Depressive Disorder
GPV0014	Allele T	Correlated with the increased drug response in patients (compare with allele C)	Sertraline	Major Depressive Disorder
GPV0018	Allele C	Correlated with the increased drug response in patients (compare with Allele T)	Sertraline	Major Depressive Disorder
GPV0018	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele T)	Sertraline	Depression
GPV0148	(AGCCCACCC)12	Irrelevant to the drug response in patients (compare with allele (AGCCCACCC)9)	Sertraline	Major Depressive Disorder
GPV0001	Genotype AA	Correlated with the increased drug response in patients (compare with genotypes AG + GG)	Granisetron	Nausea; Vomiting
GPV0009	Genotype CT	Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC)	Prednisone	Non-Hodgkin Lymphoma
GPV0088	Genotype TT	Correlated with the increased likelihood of remission in patients (compare with genotype CC)	Prednisone	Rheumatoid Arthritis
GPV0166	Allele G	Correlated with the decreased drug response in patients (compare with Allele A)	Etanercept	Psoriatic Arthritis
GPV0166	Genotypes AG + GG	Correlated with the decreased drug response in patients (compare with genotype AA)	Etanercept	Psoriatic Arthritis
GPV0166	Genotypes AG + GG	Correlated with the increased drug response to tumor necrosis factor alpha (tnF-alpha) inhibitors in patients (compare with genotype AA)	Etanercept	Psoriasis
GPV0245	Genotype GG	Correlated with the decreased drug response in patients (compare with genotype TT)	Etanercept	Rheumatoid Arthritis
GPV0225	Genotype TTA/de	Correlated with the increased drug response in patienrs (compare with Genotype TTA/ttA)	Metoprolol	Hypertension
GPV0160	Allele C	Correlated with the increased likelihood of toxic liver disease in patients (compare with Allele T)	Fludarabine	Acute Myeloid Leukemia
GPV0218	Genotype TT	Correlated with the increased likelihood of fever in patients (compare with genotypes CC + CT)	Fludarabine	Acute Myeloid Leukemia
GPV0140	Genotype TT	Correlated with the decreased drug response (compare with genotypes CC + CT)	3,4-Methylenedioxymethamphetamine	Posttraumatic Stress Disorder
GPV0141	Genotype AA	Correlated with the increased drug response in patients (compare with genotypes AG + GG)	3,4-Methylenedioxymethamphetamine	Posttraumatic Stress Disorder
GPV0229	Genotype GG	Correlated with the increased drug response (compare with genotypes AA + AG)	3,4-Methylenedioxymethamphetamine	Posttraumatic Stress Disorder
GPV0114	Allele A	Correlated with the decreased transport of drug (compare with Allele T)	Cefotaxime	Upper Respiratory Tract Infections and Bacterial Meningitis
GPV0114	Genotype AT	Correlated with the decreased drug clearance in healthy individuals (compare with Genotype TT)	Cefotaxime	Healthy Individuals
GPV0002	Genotype GG	Correlated with the increased drug response (compare with genotypes AA + AG)	Propofol	Anesthesia
GPV0257	Genotypes AA + AG	Correlated with the increased drug response (compare with genotype GG)	Propofol	.
GPV0001	Allele A	Irrelevant to the drug-induced liver injury risk in patients (compare with Allele G)	Isoniazid	Tuberculosis
GPV0009	Genotype CT	Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC)	Rituximab	Non-Hodgkin Lymphoma
GPV0008	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Escitalopram	Bipolar Disorder
GPV0010	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AA + AC)	Escitalopram	Depression
GPV0119	Genotype TT	Correlated with the increased anemia risk in patients (compare with genotypes CC + CT)	Peginterferon alfa-2B	Hepatitis C
GPV0125	Genotype GG	Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Peginterferon alfa-2B	Chronic Hepatitis C
GPV0001	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AG + GG)	Dexrazoxane	Acute Myeloid Leukemia
GPV0002	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AG + GG)	Dexrazoxane	Acute Myeloid Leukemia
GPV0003	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AC + CC)	Dexrazoxane	Acute Myeloid Leukemia
GPV0025	Genotype CT	Correlated with the increased drug response in patients (compare with genotype CC)	Fenofibrate	Hypertriglyceridemia
GPV0025	Genotype TT	Correlated with the increased drug response in patients (compare with genotype CC)	Fenofibrate	Hypertriglyceridemia
GPV0026	Genotype CC	Correlated with the increased drug response in patients (compare with Genotype TT)	Fenofibrate	Hypertriglyceridemia
GPV0001	Allele A	Irrelevant to the likelihood of treatment failure in patients (compare with Allele G)	Atazanavir	HIV Infection
GPV0001	Allele G	Irrelevant to the drug concentrations in patients (compare with Allele A); Irrelevant to the hyperbilirubinemia risk in patients (compare with allele A); Irrelevant to the likelihood of hyperbilirubinemia in patients (compare with allele A); Irrelevant to the severity of hyperbilirubinemia in patients (compare with allele A); Irrelevant to the trough concentration of drug in patients (compare with allele A)	Atazanavir	HIV Infection
GPV0001	Genotype GG	Correlated with the increased drug concentrations in patients (compare with genotypes AA + AG); Irrelevant to the drug concentrations in patients (compare with genotypes AA + AG)	Atazanavir	HIV Infection
GPV0001	Genotypes AA + AG	Irrelevant to the increased drug discontinuation in patients (compare with genotype GG)	Atazanavir	HIV Infection
GPV0045	Allele T	Correlated with the increased drug toxicity risk (compare with Genotype CC)	Atazanavir	HIV Infection
GPV0001	Allele A	Correlated with the decreased toxic liver disease risk in patient (compare with allele G); Correlated with the decreased toxic liver disease risk in patients (compare with allele G); Correlated with the increased likelihood of toxicity-related treatment failure in patients (compare with allele G)	Efavirenz	HIV Infection
GPV0001	Allele G	Irrelevant to the neurotoxicity syndromes in patients (compare with allele A)	Efavirenz	HIV Infection
GPV0001	Genotype AA	Correlated with the decreased drug concentrations in patients (compare with genotypes AG + GG); Correlated with the increased CD4 t cell count in patients (compare with genotype AG + GG); Correlated with the increased CD4 t cell count in patients (compare with genotype GG); Correlated with the increased drug clearance in patients (compare with genotype AG); Correlated with the increased likelihood of drug responses in patients (compare with genotypes GG + Gt); Irrelevant to increased likelihood of drug plasma exposure in patients (compare with genotypes AG + GG)	Efavirenz	HIV Infection
GPV0001	Genotype GG	Correlated with the decreased drug clearance in patients (compare with genotype AG); Irrelevant to the drug metabolism in patients (compare with genotype AA)	Efavirenz	HIV Infection
GPV0001	Genotypes AA + AG	Irrelevant to the increased drug minimum plasma or PBMC concentrations in patients (compare with genotype GG)	Efavirenz	HIV Infection
GPV0002	Genotype AA	Correlated with the decreased drug concentrations in patients (compare with genotypes AG + GG)	Efavirenz	HIV Infection
GPV0003	Allele A	Correlated with the decreased likelihood of emerging viral drug resistance in patients (compare with allele C)	Efavirenz	HIV Infection
GPV0003	Genotype AA	Correlated with the decreased drug concentrations in patients (compare with genotypes AC + CC); Irrelevant to the drug metabolism in patients (compare with genotype CC)	Efavirenz	HIV Infection
GPV0003	Genotypes AT + CT	Irrelevant to the increased drug plasma exposure in patients (compare with genotypes CC + CT)	Efavirenz	HIV Infection
GPV0045	Genotype TT	Correlated with the increased drug concentrations in patients (compare with genotypes CC + CT)	Efavirenz	HIV Infection
GPV0070	Genotypes GT + TT	Correlated with the increased abnormal dreams risk in patients (compare with genotype GG)	Efavirenz	HIV Infection
GPV0170	Allele C	Correlated with the drug concentrations in patients (compare with Allele T); Correlated with the drug metabolism in patients (compare with Allele T); Irrelevant to the drug concentrations in patients (compare with Allele T)	Efavirenz	HIV Infection
GPV0170	Genotypes CC + CT	Correlated with the increased drug accumulation in patients (compare with Genotype TT); Correlated with the increased drug trough concentration in patients (compare with Genotype TT)	Efavirenz	HIV Infection
GPV0001	Genotype AG	Correlated with the increased drug response in patients (compare with genotypes AA + GG)	Modafinil	Narcolepsy
GPV0002	Genotype AG	Correlated with the increased drug response in patients (compare with genotypes AA + GG)	Modafinil	Narcolepsy
GPV0003	Genotypes AC + CT	Correlated with the increased drug response in patients (compare with genotype CC)	Modafinil	Narcolepsy
GPV0009	Genotype CT	Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC)	Bleomycin	Non-Hodgkin Lymphoma
GPV0227	Genotypes CT + TT	Correlated with the increased drug response in healthy individuals (compare with genotype CC)	Insulin recombinant	Healthy Individuals
GPV0171	Allele C	Irrelevant to the decreased hemoglobin levels in patients (compare with Allele A)	Gliquidone	Diabetes Mellitus
GPV0003	Allele A	Correlated with the increased suicidal ideation risk in patients (compare with allele C)	Paroxetine	Depression
GPV0004	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele T)	Paroxetine	Depression
GPV0005	Allele T	Correlated with the increased likelihood of remission in patients (compare with allele C)	Paroxetine	Depression
GPV0008	Allele G	Correlated with the increased likelihood of adverse effects in patients (compare with Allele A)	Paroxetine	Major Depressive Disorder
GPV0008	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Paroxetine	Bipolar Disorder
GPV0008	Genotypes AG + GG	Correlated with the increased likelihood of remission in patients (compare with genotype AA)	Paroxetine	Depression
GPV0010	Allele A	Correlated with the increased likelihood of remission in patients (compare with allele C)	Paroxetine	Depression
GPV0010	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AA + AC)	Paroxetine	Depression
GPV0011	Allele T	Correlated with the increased likelihood of adverse effects in patients (compare with allele C)	Paroxetine	Major Depressive Disorder
GPV0011	Allele T	Correlated with the increased likelihood of remission in patients (compare with allele C)	Paroxetine	Depression
GPV0013	Allele T	Correlated with the increased likelihood of remission in patients (compare with allele C)	Paroxetine	Depression
GPV0014	Allele T	Correlated with the increased drug response in patients (compare with allele C)	Paroxetine	Major Depressive Disorder
GPV0018	Allele C	Correlated with the increased drug response in patients (compare with Allele T)	Paroxetine	Major Depressive Disorder
GPV0018	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele T)	Paroxetine	Depression
GPV0019	Allele G	Correlated with the increased likelihood of remission in patients (compare with Allele A)	Paroxetine	Depression
GPV0022	Allele A	Correlated with the increased likelihood of remission in patients (compare with allele C)	Paroxetine	Depression
GPV0027	Allele G	Correlated with the increased likelihood of remission in patients (compare with Allele A)	Paroxetine	Depression
GPV0030	Allele C	Correlated with the increased likelihood of remission in patients (compare with Allele A)	Paroxetine	Depression
GPV0160	Allele C	Correlated with the increased likelihood of toxic liver disease in patients (compare with Allele T)	Gemtuzumab ozogamicin	Acute Myeloid Leukemia
GPV0218	Genotype TT	Correlated with the increased likelihood of fever in patients (compare with genotypes CC + CT)	Gemtuzumab ozogamicin	Acute Myeloid Leukemia
GPV0001	Genotype AA	Correlated with the decreased drug clearance in patients (compare with genotypes AG + GG); Correlated with the increased drug concentrations in patients (compare with genotypes AG + GG)	Daptomycin	Bacterial infections
GPV0001	Genotype AA	Correlated with the increased likelihood of hypotension, orthostatic in patients (compare with genotypes AG + GG)	Nortriptyline	Major Depressive Disorder
GPV0008	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Nortriptyline	Bipolar Disorder
GPV0010	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AA + AC)	Nortriptyline	Depression
GPV0133	Allele C	Correlated with the increased drug response in patients (compare with Allele T)	Nortriptyline	Depression
GPV0009	Genotype CT	Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC)	Vindesine	Non-Hodgkin Lymphoma
GPV0001	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AG + GG)	Palonosetron	Nausea; Vomiting
GPV0139	Allele A	Correlated with the increased drug response in patients (compare with allele C)	Atomoxetine	Attention Deficit Disorder With Hyperactivity
GPV0142	Allele T	Correlated with the decreased drug response in patients (compare with allele C)	Atomoxetine	Attention Deficit Disorder With Hyperactivity
GPV0001	Allele A	Irrelevant to the severity of pain in patients (compare with Allele G)	Oxycodone	Postoperative Pain
GPV0001	Genotype GG	Correlated with the increased drug exposure in healthy individuals (compare with genotype AA)	Silibinin	Healthy Individuals
GPV0001	Genotype AA	Correlated with the decreased likelihood of postoperative nausea and vomiting in patients (compare with genotypes AG + GG); Correlated with the increased drug response in patients (compare with genotypes AG + GG)	Omeprazole	Helicobacter Infections
GPV0001	Genotypes AA + AG	Correlated with the increased drug concentrations in patients (compare with genotype GG)	Omeprazole	Gastroesophageal Reflux
GPV0001	Genotype GG	Correlated with the increased likelihood of 3-year Event Free Survival in patients (compare with genotypes AA + AG); Correlated with the increased likelihood of complete remission in patients (compare with genotypes AA + AG)	Idarubicin	Acute Myeloid Leukemia
GPV0003	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AC + CC)	Idarubicin	Acute Myeloid Leukemia
GPV0160	Allele C	Correlated with the increased likelihood of toxic liver disease in patients (compare with Allele T)	Idarubicin	Acute Myeloid Leukemia
GPV0218	Genotype TT	Correlated with the increased likelihood of fever in patients (compare with genotypes CC + CT)	Idarubicin	Acute Myeloid Leukemia
GPV0001	Allele A	Irrelevant to the overall survival in patients (compare with Allele G)	Diphenhydramine	Breast Neoplasm
GPV0008	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Trimipramine	Bipolar Disorder
GPV0010	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AA + AC)	Trimipramine	Depression
GPV0001	Genotype GG	Correlated with the increased hand-foot syndrome risk in patients (compare with genotype AA)	Capecitabine	Colorectal Neoplasm
GPV0001	Genotypes AG + GG	Irrelevant to the decreased clinical outcome in patients (compare with genotype AA)	Capecitabine	Neoplasm
GPV0002	Genotype AA	Correlated with the decreased hand-foot syndrome and neutropenia  risk in patients (compare with genotype GG)	Capecitabine	Colorectal Neoplasm
GPV0003	Genotype CC	Correlated with the increased hand-foot syndrome risk in patients (compare with genotype AA)	Capecitabine	Colorectal Neoplasm
GPV0006	Allele T	Correlated with the increased drug response in patients (compare with allele G)	Capecitabine	Neoplasm
GPV0070	Genotype GG	Correlated with the decreased drug response in patients (compare with Genotypes GT + TT)	Capecitabine	Colorectal Neoplasm
GPV0088	Genotype CC	Correlated with the increased drug response in patients (compare with Genotypes CT + TT)	Capecitabine	Colorectal Neoplasm
GPV0156	Genotypes AA + AG	Correlated with the increased drug response in patients (compare with genotype GG)	Capecitabine	Colorectal Neoplasm
GPV0223	Genotype TT	Correlated with the increased likelihood of drug toxicity in patients (compare with genotypes CC + CT)	Capecitabine	Colorectal Neoplasm
GPV0224	Genotypes AG + GG	Correlated with the decreased likelihood of diarrhea in patients (compare with genotype AA)	Capecitabine	Colorectal Neoplasm
GPV0160	Genotype TT	Correlated with the increased alcoholism risk in patients (compare with genotype GG)	Goserelin	Breast Neoplasm
GPV0145	Genotype AG	Correlated with the increased alcoholism risk in patients (compare with genotype GG)	Ethanol	Intractable Chronic Pain; Cystitis
GPV0001	Allele G	Irrelevant to the drug resistance in patients (compare with allele A); Irrelevant to the drug response in patients (compare with allele A)	Antiepileptics	Epilepsy
GPV0001	Genotype AA	Correlated with the decreased drug dose in patients (compare with genotypes AG + GG)	Opioids	Neoplasm
GPV0001	Genotype AA	Correlated with the decreased drug dose in patients (compare with genotypes AG + GG)	Opioids	Postoperative Pain
GPV0001	Genotype AA	Correlated with the increased drug resistance in patients (compare with genotype GG)	Antiepileptics	Epilepsy
GPV0001	Genotype AA	Correlated with the increased drug-induced liver injury risk in patieants (compare with genotype GG)	Antivirals combinations drugs for treatment of tuberculosis	HIV Infection; Tuberculosis Co-Infection
GPV0001	Genotype AA	Correlated with the increased likelihood of complete response in patients (compare with genotypes GG + AG)	Anthracyclines	Breast Neoplasm
GPV0001	Genotype AA	Correlated with the increased likelihood of complete response in patients (compare with genotypes GG + AG)	Taxanes	Breast Neoplasm
GPV0001	Genotype AG	Correlated with the increased drug resistance in patients (compare with genotype GG)	Antiepileptics	Epilepsy
GPV0001	Genotype AG	Correlated with the increased severity of nausea in patients (compare with genotypes AA + GG)	Antineoplastic agents	Neoplasm
GPV0001	Genotype GG	Correlated with the decreased opioid-related disorders risk in patients (compare with genotype AG)	Opioids	Opioid-Related Disorders
GPV0001	Genotype GG	Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Melatonin receptor agonists	Depressive Disorder
GPV0001	Genotype GG	Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Platinum compounds	Non-Small-Cell Lung Carcinoma
GPV0001	Genotype GG	Correlated with the increased drug response in patients (compare with genotypes AA + AG)	Selective serotonin reuptake inhibitors	Depressive Disorder
GPV0001	Genotype GG	Correlated with the increased likelihood of drug-resistance in patients (compare with genotype AA)	Antiepileptics	Epilepsy
GPV0002	Allele A	Irrelevant to the drug resistance in patients (compare with allele G); Irrelevant to the drug response in patients (compare with Allele G); Irrelevant to the likelihood of drug resistance in patients (compare with Allele G)	Antiepileptics	Epilepsy
GPV0002	Allele G	Irrelevant to the drug response in patients (compare with allele A)	Antiepileptics	Epilepsy
GPV0002	Genotype AA	Correlated with the decreased drug metabolism in patients (compare with genotypes AG + GG)	Tipifarnib	Neoplasm
GPV0002	Genotype AA	Correlated with the increased drug toxicity risk in patients (compare with genotype GG); Correlated with the increased drug toxicity risk in patients (compare with genotypes AG + GG)	Platinum compounds	Non-Small-Cell Lung Carcinoma
GPV0003	Allele A	Correlated with the increased suicidal ideation risk in patients (compare with allele C)	Lithium	Depression
GPV0003	Allele A	Irrelevant to the likelihood of drug resistance in patients (compare with Allele C)	Antiepileptics	Epilepsy
GPV0003	Allele C	Irrelevant to the drug response in patients (compare with Allele A)	Antiepileptics	Epilepsy
GPV0003	Genotype AA	Correlated with the increased likelihood of drug resistance in patients (compare with genotype CC)	Antiepileptics	Epilepsy
GPV0003	Genotype CC	Correlated with the increased drug resistance risk in patients (compare with genotype AC)	Anthracyclines	Breast Neoplasm
GPV0008	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Selective serotonin reuptake inhibitors	Bipolar Disorder
GPV0008	Genotypes AG + GG	Correlated with the increased likelihood of remission in patients (compare with genotype AA)	Antidepressants	Depression
GPV0010	Genotype AA	Irrelevant to the drug response in patients (compare with genotypes AA + AC)	Selective serotonin reuptake inhibitors	Depression
GPV0012	Allele C	Correlated with the increased likelihood of cardiotoxicity in patients (compare with Allele A)	Anthracyclines	Neoplasm
GPV0016	Allele A	Irrelevant to the likelihood of drug resistance in patients (compare with Allele G)	Antiepileptics	Epilepsy
GPV0031	Allele G	Correlated with the increased likelihood of cardiotoxicity in patients (compare with Allele T)	Anthracyclines	Neoplasm
GPV0032	Allele T	Correlated with the increased likelihood of cardiotoxicity in patients (compare with allele C)	Anthracyclines	Neoplasm
GPV0035	Allele T	Correlated with the increased likelihood of cardiotoxicity in patients (compare with allele G)	Anthracyclines	Neoplasm
GPV0042	Allele A	Correlated with the increased probability of drug response in patients (compare with allele G); Irrelevant to the drug resistance in patients (compare with Allele G); Irrelevant to the drug resistance in patients (compare with Allele G); Irrelevant to the number of seizures per year in patients (compare with Allele G)	Antiepileptics	Epilepsy
GPV0042	Allele G	Irrelevant to the increased drug resistance in patients (compare with allele A)	Antiepileptics	Epilepsy
GPV0042	Genotype AG	Correlated with the increased drug concentrations in patients (compare with genotype GG)	Exjade	Beta-Thalassemia
GPV0042	Genotypes AA + AG	Irrelevant to the increased drug resistance in patients (compare with genotype GG)	Antiepileptics	Epilepsy
GPV0044	Allele C	Irrelevant to the drug resistance in patients (compare with Allele T)	Antiepileptics	Epilepsy
GPV0044	Allele T	Irrelevant to the number of seizures per year in patients (compare with allele C)	Antiepileptics	Epilepsy
GPV0044	Genotypes CT + TT	Correlated with the increased drug resistance in patients (compare with genotype CC); Irrelevant to the increased drug resistance in patients (compare with genotype CC)	Antiepileptics	Epilepsy
GPV0045	Allele C	Irrelevant to the drug resistance in patients (compare with Allele T)	Antiepileptics	Epilepsy
GPV0045	Allele T	Irrelevant to the number of seizures per year in patients (compare with allele C)	Antiepileptics	Epilepsy
GPV0045	Genotypes CT + TT	Correlated with the increased drug resistance in patients (compare with genotype CC); Irrelevant to the increased drug resistance in patients (compare with genotype CC)	Antiepileptics	Epilepsy
GPV0067	Genotype CC	Correlated with the increased drug concentrations in patients (compare with Genotypes CT + TT)	Exjade	Beta-Thalassemia
GPV0067	Genotypes CT + TT	Correlated with the increased drug exposure in patients (compare with genotype CC)	Exjade	Beta-Thalassemia
GPV0070	Genotype TT	Correlated with the increased drug response (compare with genotypes GG + Gt)	Opioids	Neoplasm
GPV0078	Allele A	Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C)	Anthracyclines	Neoplasm
GPV0079	Allele A	Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C)	Anthracyclines	Neoplasm
GPV0080	Genotype CC	Correlated with the increased reduction in mean blood pressure in patients (compare with Genotypes CT + TT)	Thiazides	Essential Hypertension
GPV0082	Genotype AA	Correlated with the decreased psoriasis risk in patients (compare with genotypes AG + GG)	Tumor necrosis factor alpha (Tnf-Alpha) inhibitors	Psoriasis
GPV0088	Genotype TT	Correlated with the decreased progression-free survival in patients (compare with genotypes CC + CT)	Platinum compounds	Non-Small-Cell Lung Carcinoma
GPV0089	Allele G	Correlated with the increased progression-free survival in patients (compare with Allele A)	Bevacizumab	Lung Neoplasm
GPV0093	Allele T	Correlated with the increased severity of pharmacological resistance in patients (compare with allele C)	Selective serotonin reuptake inhibitors	Obsessive-Compulsive Disorder
GPV0094	Allele C	Correlated with the increased severity of pharmacological resistance in patients (compare with Allele T)	Selective serotonin reuptake inhibitors	Obsessive-Compulsive Disorder
GPV0095	Allele C	Correlated with the increased severity of pharmacological resistance in patients (compare with Allele G)	Selective serotonin reuptake inhibitors	Obsessive-Compulsive Disorder
GPV0107	Genotype CC	Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug in patients (compare with genotypes tt + Ct)	Doxorubicinol	Breast Neoplasm
GPV0109	Allele A	Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C)	Anthracyclines	Neoplasm
GPV0109	Genotypes AA + AC	Correlated with the increased severity of drug toxicity in patients (compare with genotype CC); Correlated with the increased severity of toxic liver disease in patients (compare with genotype CC)	Platinum compounds	Non-Small-Cell Lung Carcinoma
GPV0111	Allele T	Correlated with the decreased drug metabolism (compare with allele C)	Catecholamines	.
GPV0112	Allele T	Irrelevant to the the drug uptake (compare wuth Allele C)	Aminohippurate	Cancer
GPV0116	Allele C	Correlated with the decreased likelihood of cardiotoxicity in patients (compare with Allele A)	Anthracyclines	Neoplasm
GPV0117	Allele T	Correlated with the increased likelihood of cardiotoxicity in patients (compare with allele C)	Anthracyclines	Neoplasm
GPV0119	Genotype TT	Correlated with the increased anemia risk in patients (compare with genotypes CC + CT)	Protease Inhibitors	Hepatitis C
GPV0120	Allele A	Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C)	Anthracyclines	Neoplasm
GPV0123	Allele A	Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C)	Anthracyclines	Neoplasm
GPV0125	Genotypes AG + GG	Correlated with the increased drug response in patients (compare with genotype AA)	Tipiracil hydrochloride	Colorectal Neoplasm
GPV0126	Genotypes CT + TT	Correlated with the increased drug response in patients (compare with genotype CC)	Tipiracil hydrochloride	Colorectal Neoplasm
GPV0129	Genotype AC	Correlated with the decreased likelihood of overall survival in patients (compare with genotypes AA + CC)	Platinum compounds	Non-Small-Cell Lung Carcinoma
GPV0129	Genotype AC	Correlated with the increased severity of thrombocytopenia in patients (compare with genotypes AA + CC)	Platinum compounds	Thrombocytopenia
GPV0130	Genotype AA	Correlated with the decreased severity of drug toxicity in patients (compare with Genotypes AG + GG); Correlated with the increased likelihood of overall survival in patients (compare with genotypes AG + GG)	Platinum compounds	Non-Small-Cell Lung Carcinoma
GPV0131	Genotype AC	Correlated with the decreased likelihood of overall survival in patients (compare with genotypes AA + CC)	Platinum compounds	Non-Small-Cell Lung Carcinoma
GPV0131	Genotype AC	Correlated with the increased severity of thrombocytopenia in patients (compare with genotypes AA + CC)	Platinum compounds	Thrombocytopenia
GPV0155	Allele C	Correlated with the increased drug concentrations in patients (compare with Allele T)	Ticagrelor	Acute Coronary Syndrome
GPV0156	Allele G	Correlated with the decreased drug-Induced abnormalities risk in patients (compare with Allele A)	Hmg coa reductase inhibitors	Diabetes Mellitus
GPV0156	Genotype AA	Correlated with the increased creatine kinase in patients (compare with genotype AG)	Hmg coa reductase inhibitors	Coronary Artery Disease
GPV0157	Allele A	Correlated with the decreased drug response in patients (compare with Allele T)	Hmg coa reductase inhibitors	Coronary Artery Disease
GPV0160	Allele C	Correlated with the all statin-induced myopathy and severe myopathy in patients (compare with Allele T)	Hmg coa reductase inhibitors	Muscular Diseases
GPV0160	Allele C	Correlated with the increased drug concentrations (compare with Genotype TT); Correlated with the increased drug concentrations in patients (compare with Allele T)	Simvastatin acid	Hypercholesterolemia
GPV0160	Allele C	Correlated with the increased drug-Induced abnormalities risk in patients (compare with Allele T)	Hmg coa reductase inhibitors	Diabetes Mellitus
GPV0160	Allele T	Correlated with the decreased drug concentrations in patients (compare with allele C)	Ticagrelor	Acute Coronary Syndrome
GPV0160	Genotype CC	Correlated with the increased creatine kinase in patients (compare with Genotypes CT + TT); Correlated with the increased drug dose decrease or switch to another cholesterol-lowering drug risk in patients (compare with Genotype TT)	Hmg coa reductase inhibitors	Muscular Diseases
GPV0160	Genotype CC	Correlated with the increased drug concentrations in healthy individuals (compare with Genotype TT)	Simvastatin acid	Healthy Individuals
GPV0160	Genotype CT	Correlated with the increased drug exposure in patients (compare with Genotype TT)	Simvastatin acid	Hypercholesterolemia
GPV0160	Genotypes CC + CT	Correlated with the increased drug concentrations (compare with Genotype TT)	Simvastatin acid	Hypercholesterolemia
GPV0166	Allele G	Correlated with the decreased drug response in patients (compare with Allele A)	Tumor necrosis factor alpha (Tnf-Alpha) inhibitors	Rheumatoid Arthritis
GPV0166	Genotypes AG + GG	Correlated with the decreased drug response in patients (compare with genotype AA)	Tumor necrosis factor alpha (Tnf-Alpha) inhibitors	Psoriatic Arthritis
GPV0166	Genotypes AG + GG	Correlated with the increased drug response in patients (compare with genotype AA)	Tumor necrosis factor alpha (Tnf-Alpha) inhibitors	Psoriasis
GPV0167	Allele T	Correlated with the increased likelihood of hyponatremia in patients (compare with allele C)	Thiazides	Hypertension
GPV0171	Genotypes AA + CC	Correlated with the increased drug response in patients (compare with genotype AC)	Urea derivatives	Diabetes Mellitus
GPV0173	Allele T	Irrelevant to the likelihood of overall survival and progression-free survival in patients (compare with allele C)	Platinum compounds	Non-Small-Cell Lung Carcinoma
GPV0173	Genotypes CC + CT	Correlated with the increased severity of drug toxicity, hematologic diseases, leukopenia and thrombocytopenia in patients (compare with Genotype TT)	Platinum compounds	Non-Small-Cell Lung Carcinoma
GPV0206	Genotype TT	Correlated with the increased drug toxicity risk in patients (compare with genotypes CC + CT)	Antipsychotics	Psychotic Disorders
GPV0228	Genotypes AG + GG	Correlated with the increased severity of thrombocytopenia in patients (compare with genotype AA)	Platinum compounds	Non-Small-Cell Lung Carcinoma
GPV0238	Genotype GG	Irrelevant to the drug response in patients (compare with genotypes AA + AG)	Imidapril	Essential hypertension
GPV0242	Genotype AA	Correlated with the increased drug response in patients (compare with genotypes AG + GG)	Bevacizumab	Colorectal Neoplasms
GPV0244	Genotypes CT + TT	Correlated with the increased drug resistance in patients (compare with genotype CC)	Antihypertensives	Coronary Artery Disease; Hypertension
GPV0245	Genotype GG	Correlated with the decreased drug response in patients (compare with genotype TT)	Certolizumab pegol	Rheumatoid Arthritis
GPV0245	Genotype GG	Correlated with the decreased drug response in patients (compare with genotype TT)	Glucocorticoids	Rheumatoid Arthritis
GPV0246	Allele A	Correlated with the increased drug response in patients (compare with allele G)	Antidepressants	Major Depressive Disorder
GPV0247	Genotype CC	Correlated with the increased drug response in patients (compare with genotype TT)	Antipsychotics	Schizophrenia
GPV0248	Genotype TT	Correlated with the increased drug response in patients (compare with genotype GG)	Antipsychotics	Schizophrenia
GPV0249	Genotype CC	Correlated with the increased drug response in patients (compare with genotype TT)	Antipsychotics	Schizophrenia
GPV0250	Genotypes AA + AC	Correlated with the increased drug response in patients (compare with genotype CC)	Antipsychotics	Schizophrenia
GPV0251	Genotype TT	Correlated with the decreased drug response in patients (compare with genotypes CC + CT)	Lithium	Bipolar Disorder
GPV0252	Genotype TT	Correlated with the increased drug response in patients (compare with genotype CC)	Antipsychotics	Schizophrenia
GPV0254	Allele C	Correlated with the increased drug response in patients (compare with allele T)	Clobazam	Epilepsy
GPV0254	Allele C	Correlated with the increased drug response in patients (compare with allele T)	Ethosuximide	Epilepsy
GPV0256	Genotype TT	Irrelevant to the increased drug response in patients (compare with genotype CC)	Lithium	Bipolar Disorder
GPV0258	Allele A	Irrelevant to the drug resistance in patients (compare with allele G)	Antiepileptics	Epilepsy
GPV0259	Genotype CC	Irrelevant to the drug response in patients (compare with genotype TT)	Ustekinumab	Psoriasis
GPV0260	Allele A	Irrelevant to the drug response in patients (compare with allele T)	Antiepileptics	Epilepsy
GPV0261	Allele A	Correlated with the increased drug response in patients (compare with allele G)	Platinum compounds	Lung Neoplasms
GPV0262	Genotype CC	Correlated with the increased drug response in patients (compare with genotype TT)	Antipsychotics	Schizophrenia
GPV0263	Genotype CC	Correlated with the increased drug response in patients (compare with genotype CT)	Antipsychotics	Schizophrenia
GPV0266	Allele G	Correlated with the anthracycline-induced cardiotoxicity (compare with allele A)	Anthracyclines	Cardiotoxicity
GPV0267	Allele A	Correlated with the blue eyes and blond hair (compare with allele G)	.	Pigmentation
GPV0268	Allele A	Correlated with the decreased risk for acute myeloid leukemia (compare with allele G)	.	Acute myeloid leukemia
GPV0269	Haplotype T-A-G-G	Correlated with the decreased risk for sever ulcerative colitis (compare with other haplotype)	.	Ulcerative colitis
GPV0270	Allele T	Correlated with the decteased risk for autism spectrum disorder (compare with allele C)	.	Autism Spectrum Disorder
GPV0271	Allele T	Correlated with the decteased risk for autism spectrum disorder (compare with allele C)	.	Autism Spectrum Disorder
GPV0272	Genotype AA	Correlated with the depression status in patients (compare with GG + AG)	Cornu ammonis	Parkinson's disease
GPV0273	Genotype CC	Correlated with the development of intrahepatic cholestasis of pregnancy (compare with genotypes TT + TC)	Bile acid	Intrahepatic cholestasis of pregnancy
GPV0274	Allele T	Correlated with the expression of transport in visceral adipose tissue (compare with allele G)	.	Type 2 diabetes
GPV0275	Allele C	Correlated with the expression of transporter (compare with A)	.	Suicide and Psychiatric Disorders
GPV0277	Allele A	Correlated with the higher rates of coronary artery abnormalities (compare with C)	Calcium	Kawasaki disease
GPV0278	Genotype TT	Correlated with the higher risk for angiographically significant in-stent restenosis (comare with genotypes AA + AT)	.	In-stent Restenosis
GPV0279	Genotype CT	Correlated with the higher risk for hyperuricemia (compare with genotypes CC + TT)	.	Hyperuricemia
GPV0280	Genotype TC	Correlated with the higher risk for hyperuricemia (compare with genotypes TT + CC)	.	Hyperuricemia
GPV0281	Genotype AA	Correlated with the human longevity (compare with allele C)	.	Human Longevity
GPV0282	Genotype AA	Correlated with the human longevity (compare with genotypes AG + GG )	.	Human Longevity
GPV0283	Allele C	Correlated with the increased gallstone risk in patients (compare with allele G)	Biliary cholesterol	Gallstone
GPV0284	Allele C	Correlated with the increased gout susceptibility (compare with allele T)	.	Gout
GPV0273	Genotype CC	Correlated with the increased plasma bile acid levels (compare with genotype TT + TC)	Bile acid	Chronic hepatitis C
GPV0285	Allele A	Correlated with the increased risk for Type 2 diabetes (compare with allele G)	.	Type 2 diabetes
GPV0287	Allele C	Correlated with the increased risk of alzheimer's disease (compare with allele G)	.	Alzheimer's disease
GPV0269	Haplotype T-G-G-A	Correlated with the increased risk of sever ulcerative colitis (compare with other haplotype)	.	Ulcerative colitis
GPV0288	Allele T	Correlated with the increased risk of systemic lupus erythematosus in Han Chinese patients (compare with allele A)	.	Systemic Lupus Erythematosus
GPV0289	Allele T	Correlated with the increased risk of systemic lupus erythematosus in Han Chinese patients (compare with allele C)	.	Systemic Lupus Erythematosus
GPV0290	Genotype AG	Correlated with the increased risk of systemic lupus erythematosus in Han Chinese patients (compare with genotypes AA +GG)	.	Systemic Lupus Erythematosus
GPV0291	Genotype AT	Correlated with the increased risk of systemic lupus erythematosus in Han Chinese patients (compare with genotypes AA +TT)	.	Systemic Lupus Erythematosus
GPV0292	Genotypes TT+CT	Correlated with the increased the risk of systemic lupus erythematosus in Han Chinese patients (compare with genotype CC)	.	Systemic Lupus Erythematosus
GPV0293	Allele G	Correlated with the modest increased risk of alzheimer's disease (compare with allele T)	.	Alzheimer's disease
GPV0296	Allele C	Correlated with the periodontitis susceptibility (comare with wide type)	.	Periodontitis
GPV0297	Allele G	Correlated with the periodontitis susceptibility (comare with wide type)	.	Periodontitis
GPV0298	Allele T	Correlated with the periodontitis susceptibility (comare with wide type)	.	Periodontitis
GPV0299	Allele G	Correlated with the predisposition to systemic lupus erythematosus (compare with allele A)	Anti-Ro/SSA production	Systemic Lupus Erythematosus
GPV0300	Allele T	Correlated with the progression-free and overall survival in patients (compare with allele A)	.	Multiple myeloma
GPV0301	Allele C	Correlated with the protected against the development of gout (compare with allele T)	.	Gout
GPV0302	Allele T	Correlated with the risk for gout (compare with allele C)	.	Gout
GPV0303	Allele C	Correlated with the risk for gout (compare with allele T)	.	Gout
GPV0305	Allele G	Correlated with the risk locus for major depressive disorder in the Han Chinese population (compare with wide type)	.	Major depressive disorder
GPV0306	Allele T	Correlated with the risk of attention-deficit/hyperactivity disorder (compare with C)	.	Attention-deficit/hyperactivity disorder (ADHD)
GPV0307	Allele G	Correlated with the risk of schizophrenia (compare with T)	.	Schizophrenia
GPV0308	Allele C	Correlated with the risk of sever ulcerative colitis (compare with allele G)	.	Ulcerative colitis
GPV0309	Allele C	Correlated with the risk of sever ulcerative colitis (compare with allele T)	.	Ulcerative colitis
GPV0310	Genotypes AG+GG	Correlated with the risk of sever ulcerative colitis (compare with genotype AA)	.	Ulcerative colitis
GPV0308	Genotypes GC+CC	Correlated with the risk of sever ulcerative colitis (compare with genotype GG)	.	Ulcerative colitis
GPV0309	Genotypes TC+CC	Correlated with the risk of sever ulcerative colitis (compare with genotype TT)	.	Ulcerative colitis
GPV0310	Allele G	Correlated with the risk of sever ulcerative colitis(compare with allele A)	.	Ulcerative colitis
GPV0311	Allele A	Correlated with the schizophrenia susceptibility (compare with wide type)	.	Schizophrenia
GPV0312	Allele G	Correlated with the schizophrenia susceptibility (compare with wide type)	.	Schizophrenia
GPV0313	Allele A	Correlated with the schizophrenia susceptibility (compare with wide type)	.	Schizophrenia
GPV0293	Allele G	Correlated with the significantly decreased the expression of transport (compare with allele T)	.	Alzheimer's disease
GPV0314	Allele C	Correlated with the significantly increased mRNA exoression of transporter (compare with allele A)	.	Autoimmune thyroid diseases
GPV0315	Allele C	Correlated with the skin aging trait (compare with allele T)	Melanin	Skin cancers
GPV0316	Allele C	Correlated with the small vessel disease subtype of ischemic stroke in Chinese population (compare with allele G)	Antihypertensive Drug	Small Vessel Disease Subtype of Ischemic Stroke
GPV0275	Allele C	Correlated with the suicide and other psychiatric disorders (compare with A)	.	Suicide and Psychiatric Disorders
GPV0317	Allele G	Correlated with the transcripts increased 7 fold (compare with allele T)	.	Autoimmune thyroid diseases
GPV0318	Genotype CG	Correlated with the vesicular glutamate transporter 1 coding (compare with genotypes CC + GG)	Selective Serotonin Reuptake Inhibitors (SSRIs)	Major Depressive Disorder (MDD)
GPV0319	Genotype CT	Correlated with the vesicular glutamate transporter 1 coding (compare with genotypes CC + TT)	Selective Serotonin Reuptake Inhibitors (SSRIs)	Major Depressive Disorder (MDD)
GPV0320	Allele T	Irrelevant to the alcohol dependence syndrome (compare with allele C)	.	Alcohol Dependence Syndrome
GPV0321	Allele G	Irrelevant to the compromised function or abnormal regulation (compare with allele A)	Electroneutral sodium	Diarrheal diseases
GPV0322	Allele G	Irrelevant to the risk for migraine (compare with wide type)	.	Migraine
GPV0323	Allele C	Irrelevant to the risk of schizophrenia (compare with wide type)	.	Schizophrenia
GPV0287	Allele C	Irrelevant to the significantly decreased the expression of transport (compare with allele G)	.	Alzheimer's disease
GPV0324	Haplotype A-G-T-C	Correlated with the type 2 diabetes susceptibility (compare with wide type)	.	Type 2 diabetes
GPV0325	Allele T	Correlated with the chronic lung disease in very premature infants (compare with allele C)	.	Respiratory Distress Syndrome
GPV0326	Allele G	Correlated with the increased weight gain (compare with allele A)	.	Weight gain
GPV0327	Allele T	Irrelevant to the Human T-lymphotropic virus 1 infection (compare with allele G)	.	Human T-lymphotropic virus 1 infection
GPV0327	Allele T	Irrelevant to the genetic susceptibility of tropical spastic paraparesis in BrazilianHuman T-lymphotropic virus 1 infected individuals (compare with allele G)	.	Human T-lymphotropic virus 1 infection
GPV0328	Allele C	Irrelevant to the Human T-lymphotropic virus 1 infection (compare with allele T)	.	Human T-lymphotropic virus 1 infection
GPV0328	Allele C	Irrelevant to the genetic susceptibility of tropical spastic paraparesis in BrazilianHuman T-lymphotropic virus 1 infected individuals (compare with allele T)	.	Human T-lymphotropic virus 1 infection
GPV0329	Allele T	Irrelevant to the Human T-lymphotropic virus 1 infection (compare with allele A)	.	Human T-lymphotropic virus 1 infection
GPV0329	Allele T	Irrelevant to the genetic susceptibility of tropical spastic paraparesis in BrazilianHuman T-lymphotropic virus 1 infected individuals (compare with allele A)	.	Human T-lymphotropic virus 1 infection
GPV0330	Allele C	Correlated with increased the risk for type 2 diabetes (compare with wide type)	Triacylglycerol meta	Type 2 diabetes
GPV0331	Genotypes AA + AG	Correlated with the drug sensitivity in patients (compare with genotype GG)	Salazosulfamide	Ankylosing spondylitis
GPV0332	Insertion	Correlated with the risk of predicting or preventing alcoholism	.	Alcoholism
GPV0333	Allele C	Correlated with the kidney stones disease (compare with allele G)	.	Kidney Stone
GPV0334	Allele T	Correlated with the risk for chronic lymphocytic leukaemia (compare with allele A)	.	Chronic Lymphocytic Leukaemia
GPV0335	Allele G	Correlated with the significantly regulated transporter expression only in occipital cortex, intralobular white matter, and substantia nigra (compare with wide type)	Interferon-beta	Multiple sclerosis
GPV0336	Allele G	Correlated with the risk for celiac disease risk (compare with allele A)	.	Celiac disease