VARIDT - Variability of Drug Transporter Database Title - Genetic polymorphism data (allele / minor allele frequency / correlation with phenotype) Version 1.8.1 (2019.08.20) Provided by IDRB Lab of Innovative Drug Reasearch and Bioinformatics College of Pharmaceutical Sciences Zhejiang University https://idrblab.org/ Any question about data provided here, please contact with: Dr. Yin (yinjiayi@zju.edu.cn) and Dr. Li (lifengcheng@zju.edu.cn) -------------------------------------------------------------------------------------------------------- Abbreviations: TRANSPID VARIDT Drug Transporter (DT) ID GENENAME DT Gene Name PROTNAME DT Protein Name GENEDBID DT Gene ID UNIPROID UniProt ID GENEPOLY Genetic Polymorphism ID SITEOFGP Site of Genetic Polymorphism GPD_TYPE Genetic Polymorphism Type (SNP, deletion mutation, insertion mutation, etc.) ALLDBSNP Allele(s) in dbSNP MAFDBSNP Minor Allele Frequency -------------------------------------------------------------------------------------------------------- DTD0001 TRANSPID DTD0001 DTD0001 GENENAME ABCC1 DTD0001 PROTNAME Multidrug resistance-associated protein 1 DTD0001 GENEDBID 4363 DTD0001 UNIPROID P33527 DTD0001 GENEPOLY rs119774 SITEOFGP chr16:15992976 (GRCh38.p12) DTD0001 GENEPOLY rs119774 GPD_TYPE SNP DTD0001 GENEPOLY rs119774 ALLDBSNP C>T DTD0001 GENEPOLY rs119774 MAFDBSNP T=0.0391/196 DTD0001 GENEPOLY rs119774 Genotype CT Montelukast Asthma Correlated with the increased changes in FEV1 in patients (compare with genotype CC) aa DTD0001 GENEPOLY rs17501331 SITEOFGP chr16:15995584 (GRCh38.p12) DTD0001 GENEPOLY rs17501331 GPD_TYPE SNP DTD0001 GENEPOLY rs17501331 ALLDBSNP A>G DTD0001 GENEPOLY rs17501331 MAFDBSNP G=0.0383/192 DTD0001 GENEPOLY rs17501331 Genotypes AG + GG Irinotecan Colorectal Neoplasm Correlated with the decreased severity of neutropenia in patients (compare with genotype AA) aa DTD0001 GENEPOLY rs212091 SITEOFGP chr16:16142793 (GRCh38.p12) DTD0001 GENEPOLY rs212091 GPD_TYPE SNP DTD0001 GENEPOLY rs212091 ALLDBSNP T>A / T>C DTD0001 GENEPOLY rs212091 MAFDBSNP C=0.1360/681 DTD0001 GENEPOLY rs212091 Genotypes CC + CT Lamivudine HIV Infection Correlated with the increased drug resistance in patients (compare with Genotype TT) aa DTD0001 GENEPOLY rs212091 Genotypes CC + CT Lopinavir HIV Infection Correlated with the increased drug resistance in patients (compare with Genotype TT) aa DTD0001 GENEPOLY rs212091 Genotypes CC + CT Zidovudine HIV Infection Correlated with the increased drug resistance in patients (compare with Genotype TT) aa DTD0001 GENEPOLY rs212091 Genotypes CC + CT Ritonavir HIV Infection Correlated with the increased drug resistance in patients (compare with Genotype TT) aa DTD0001 GENEPOLY rs2238476 SITEOFGP chr16:16120015 (GRCh38.p12) DTD0001 GENEPOLY rs2238476 GPD_TYPE SNP DTD0001 GENEPOLY rs2238476 ALLDBSNP G>A DTD0001 GENEPOLY rs2238476 MAFDBSNP A=0.0691/346 DTD0001 GENEPOLY rs2238476 Genotype GG Methotrexate Psoriasis Correlated with the increased drug response in patients (compare with allele A); Correlated with the increased toxicity risk in patients (compare with genotypes AA + AG) aa DTD0001 GENEPOLY rs246240 SITEOFGP chr16:16025167 (GRCh38.p12) DTD0001 GENEPOLY rs246240 GPD_TYPE SNP DTD0001 GENEPOLY rs246240 ALLDBSNP A>G DTD0001 GENEPOLY rs246240 MAFDBSNP G=0.1827/915 DTD0001 GENEPOLY rs246240 Genotypes AG + GG Methotrexate Rheumatoid Arthritis Correlated with the decreased drug response in patients (compare with genotype AA) aa DTD0001 GENEPOLY rs246240 Genotypes GG + AG Methotrexate Psoriasis Correlated with the decreased onset of toxicity risk in patients (compare with genotype AA) aa DTD0001 GENEPOLY rs28364006 SITEOFGP chr16:16134392 (GRCh38.p12) DTD0001 GENEPOLY rs28364006 GPD_TYPE SNP DTD0001 GENEPOLY rs28364006 ALLDBSNP A>G DTD0001 GENEPOLY rs28364006 MAFDBSNP N.A. DTD0001 GENEPOLY rs28364006 Genotype GG Methotrexate Psoriasis Correlated with the increased drug response in patients (compare with allele AG) aa DTD0001 GENEPOLY rs35592 SITEOFGP chr16:16047966 (GRCh38.p12) DTD0001 GENEPOLY rs35592 GPD_TYPE SNP DTD0001 GENEPOLY rs35592 ALLDBSNP T>C DTD0001 GENEPOLY rs35592 MAFDBSNP C=0.3704/1855 DTD0001 GENEPOLY rs35592 Allele C Methotrexate Rheumatoid Arthritis Irrelevant to the drug response in patients (compare with Allele T) aa DTD0001 GENEPOLY rs35592 Genotype TT Methotrexate Psoriasis Correlated with the increased drug response in patients (compare with genotypes CC + CT) aa DTD0001 GENEPOLY rs35621 SITEOFGP chr16:16074751 (GRCh38.p12) DTD0001 GENEPOLY rs35621 GPD_TYPE SNP DTD0001 GENEPOLY rs35621 ALLDBSNP C>T DTD0001 GENEPOLY rs35621 MAFDBSNP T=0.1248/625 DTD0001 GENEPOLY rs35621 Genotypes CT + TT Sn-38 Colorectal Neoplasm Correlated with the increased drug exposure in patients (compare with genotype CC) aa DTD0001 GENEPOLY rs3743527 SITEOFGP chr16:16141824 (GRCh38.p12) DTD0001 GENEPOLY rs3743527 GPD_TYPE SNP DTD0001 GENEPOLY rs3743527 ALLDBSNP C>T DTD0001 GENEPOLY rs3743527 MAFDBSNP T=0.2943/1474 DTD0001 GENEPOLY rs3743527 Genotypes CT + TT Irinotecan Colorectal Neoplasm Correlated with the decreased severity of neutropenia in patients (compare with genotype CC) aa DTD0001 GENEPOLY rs3784864 SITEOFGP chr16:16031468 (GRCh38.p12) DTD0001 GENEPOLY rs3784864 GPD_TYPE SNP DTD0001 GENEPOLY rs3784864 ALLDBSNP G>A DTD0001 GENEPOLY rs3784864 MAFDBSNP A=0.3271/1638 DTD0001 GENEPOLY rs3784864 Genotypes AG + GG Methotrexate Rheumatoid Arthritis Correlated with the decreased drug response in patients (compare with genotype AA) aa DTD0001 GENEPOLY rs4148350 SITEOFGP chr16:16076620 (GRCh38.p12) DTD0001 GENEPOLY rs4148350 GPD_TYPE SNP DTD0001 GENEPOLY rs4148350 ALLDBSNP G>T DTD0001 GENEPOLY rs4148350 MAFDBSNP T=0.0681/341 DTD0001 GENEPOLY rs4148350 Allele T Daunorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with allele G) aa DTD0001 GENEPOLY rs4148350 Allele T Doxorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with allele G) aa DTD0001 GENEPOLY rs4148350 Allele T Anthracyclines Neoplasm Correlated with the increased likelihood of cardiotoxicity in patients (compare with allele G) ac DTD0001 GENEPOLY rs45511401 SITEOFGP chr16:16079375 (GRCh38.p12) DTD0001 GENEPOLY rs45511401 GPD_TYPE SNP DTD0001 GENEPOLY rs45511401 ALLDBSNP G>T DTD0001 GENEPOLY rs45511401 MAFDBSNP T=0.0154/77 DTD0001 GENEPOLY rs45511401 Allele T Doxorubicin Non-Hodgkin Lymphoma Correlated with the increased cardiotoxicity risk in patients (compare with allele G) aa DTD0001 GENEPOLY rs6498588 SITEOFGP chr16:15938949 (GRCh38.p12) DTD0001 GENEPOLY rs6498588 GPD_TYPE SNP DTD0001 GENEPOLY rs6498588 ALLDBSNP A>T DTD0001 GENEPOLY rs6498588 MAFDBSNP A=0.3770/1888 DTD0001 GENEPOLY rs6498588 Genotypes AT + TT Sn-38 Colorectal Neoplasm Correlated with the increased drug exposure in patients (compare with genotype AA) aa DTD0002 TRANSPID DTD0002 DTD0002 GENENAME ABCC2 DTD0002 PROTNAME Multidrug resistance-associated protein 2 DTD0002 GENEDBID 1244 DTD0002 UNIPROID Q92887 DTD0002 GENEPOLY rs113646094 SITEOFGP chr10:99804255 (GRCh38.p12) DTD0002 GENEPOLY rs113646094 GPD_TYPE SNP DTD0002 GENEPOLY rs113646094 ALLDBSNP C>G / C>T DTD0002 GENEPOLY rs113646094 MAFDBSNP G=0.0032/16 DTD0002 GENEPOLY rs113646094 Genotype CG Pravastatin Healthy Individuals Correlated with the increased drug clearance in healthy individuals (compare with genotype CC) aa DTD0002 GENEPOLY rs113646094 Genotype CG Pravastatin Hypercholesterolemia Correlated with the increased expression of ABCC2 mRnA in human liver samples (compare with genotype CC) aa DTD0002 GENEPOLY rs12762549 SITEOFGP chr10:99861014 (GRCh38.p12) DTD0002 GENEPOLY rs12762549 GPD_TYPE SNP DTD0002 GENEPOLY rs12762549 ALLDBSNP C>G / C>T DTD0002 GENEPOLY rs12762549 MAFDBSNP G=0.4806/2407 DTD0002 GENEPOLY rs12762549 Genotype CC Docetaxel Neoplasm Irrelevant to the neutropenia in patients (compare with genotypes CG + GG) aa DTD0002 GENEPOLY rs12762549 Genotypes CG + GG Docetaxel Breast Neoplasm Correlated with the decreased drug clearance (compare with genotype CC) aa DTD0002 GENEPOLY rs17222723 SITEOFGP chr10:99836239 (GRCh38.p12) DTD0002 GENEPOLY rs17222723 GPD_TYPE SNP DTD0002 GENEPOLY rs17222723 ALLDBSNP T>A DTD0002 GENEPOLY rs17222723 MAFDBSNP A=0.0373/187 DTD0002 GENEPOLY rs17222723 Allele A Tenofovir HIV Infection Correlated with the decreased renal proximal tubulopathy risk in patients (compare with Allele T); Irrelevant to the increased kidney tubular dysfunction risk in patients (compare with Allele T) aa DTD0002 GENEPOLY rs17222723 Allele A Doxorubicin Non-Hodgkin Lymphoma Correlated with the increased cardiotoxicity risk in patients (compare with Allele T) aa DTD0002 GENEPOLY rs2273697 SITEOFGP chr10:99804058 (GRCh38.p12) DTD0002 GENEPOLY rs2273697 GPD_TYPE SNP DTD0002 GENEPOLY rs2273697 ALLDBSNP G>A DTD0002 GENEPOLY rs2273697 MAFDBSNP A=0.1865/934 DTD0002 GENEPOLY rs2273697 Allele A Mycophenolic acid Kidney Transplantation Correlated with the decreased drug exposure in patients (compare with allele G) aa DTD0002 GENEPOLY rs2273697 Allele A Tenofovir HIV Infection Correlated with the increased renal proximal tubulopathy risk in patients (compare with allele G); Irrelevant to the increased fanconi syndrome risk in patients (compare with Allele G); Irrelevant to the increased kidney tubular dysfunction risk in patients (compare with Allele G); Irrelevant to the likelihood of kidney diseases in patients (compare with Allele G) aa DTD0002 GENEPOLY rs2273697 Allele A Methotrexate Rheumatoid Arthritis Irrelevant to the drug discontinuation in patients (compare with allele G) aa DTD0002 GENEPOLY rs2273697 Allele A Carbamazepine Epilepsy Irrelevant to the number of seizures per year in patients (compare with Allele G) aa DTD0002 GENEPOLY rs2273697 Allele G Mycophenolic acid Kidney Transplantation Irrelevant to the drug metabolism in patients (compare with allele A) aa DTD0002 GENEPOLY rs2273697 Allele G Carbamazepine Epilepsy Irrelevant to the increased drug resistance in patients (compare with allele A) aa DTD0002 GENEPOLY rs2273697 Genotype AA Methotrexate Rheumatoid Arthritis Correlated with the increased likelihood of drug toxicity in patients (compare with genotypes AG + GG) aa DTD0002 GENEPOLY rs2273697 Genotype AG Mycophenolic acid Lung Transplantation Correlated with the increased drug concentrations in patients (compare with genotype GG) aa DTD0002 GENEPOLY rs2273697 Genotype AG Carbamazepine Epilepsy Correlated with the relationship with drug resistance in patients (compare with genotype GG) aa DTD0002 GENEPOLY rs2273697 Genotype GG Fluorouracil Breast Neoplasm Correlated with the increased anemia risk in patients (compare with genotypes AA + AG) aa DTD0002 GENEPOLY rs2273697 Genotype GG Doxorubicin Breast Neoplasm Correlated with the increased anemia risk in patients (compare with genotypes AA + AG) aa DTD0002 GENEPOLY rs2273697 Genotype GG Cyclophosphamide Breast Neoplasm Correlated with the increased anemia risk in patients (compare with genotypes AA + AG) aa DTD0002 GENEPOLY rs2273697 Genotype GG Mycophenolic acid Kidney Transplantation Irrelevant to the any pharmacokinetic parameters measured in the study in patients (compare with genotype AA) aa DTD0002 GENEPOLY rs2273697 Genotypes AA + AG Irinotecan Colorectal Neoplasm Correlated with the increased drug metabolism in patients (compare with genotype GG) aa DTD0002 GENEPOLY rs2273697 Genotypes AA + AG Carbamazepine Epilepsy Correlated with the increased neurological ADR risk in patients (compare with genotype GG); Irrelevant to the drug response in patients (compare with genotype GG) aa DTD0002 GENEPOLY rs2273697 Genotypes AA + AG Cisplatin Mesothelioma Correlated with the increased overall survival and progression-free survival in patients (compare with genotype GG) aa DTD0002 GENEPOLY rs2273697 Genotypes AA + AG Pemetrexed Mesothelioma Correlated with the increased overall survival and progression-free survival in patients (compare with genotype GG) aa DTD0002 GENEPOLY rs2273697 Genotypes AA + AG Tenofovir HIV Infection Irrelevant to the glomerular disease in patients (compare with genotype GG) aa DTD0002 GENEPOLY rs2273697 Allele A Oxcarbazepine Epilepsy Irrelevant to the number of seizures per year in patients (compare with Allele G) aa DTD0002 GENEPOLY rs2273697 Allele G Oxcarbazepine Epilepsy Irrelevant to the increased drug resistance in patients (compare with allele A) aa DTD0002 GENEPOLY rs2273697 Genotype AG Oxcarbazepine Epilepsy Correlated with the relationship with drug resistance in patients (compare with genotype GG) aa DTD0002 GENEPOLY rs2273697 Allele A Antiepileptics Epilepsy Correlated with the increased probability of drug response in patients (compare with allele G); Irrelevant to the drug resistance in patients (compare with Allele G); Irrelevant to the drug resistance in patients (compare with Allele G); Irrelevant to the number of seizures per year in patients (compare with Allele G) ac DTD0002 GENEPOLY rs2273697 Allele G Antiepileptics Epilepsy Irrelevant to the increased drug resistance in patients (compare with allele A) ac DTD0002 GENEPOLY rs2273697 Genotype AG Exjade Beta-Thalassemia Correlated with the increased drug concentrations in patients (compare with genotype GG) ac DTD0002 GENEPOLY rs2273697 Genotypes AA + AG Antiepileptics Epilepsy Irrelevant to the increased drug resistance in patients (compare with genotype GG) ac DTD0002 GENEPOLY rs3740065 SITEOFGP chr10:99845936 (GRCh38.p12) DTD0002 GENEPOLY rs3740065 GPD_TYPE SNP DTD0002 GENEPOLY rs3740065 ALLDBSNP A>G DTD0002 GENEPOLY rs3740065 MAFDBSNP G=0.2011/1007 DTD0002 GENEPOLY rs3740065 Genotype AA Tamoxifen Breast Neoplasm Correlated with the increased recurrence of breast cancer risk in patients (compare with genotype GG) aa DTD0002 GENEPOLY rs3740065 Genotype AG Tamoxifen Breast Neoplasm Irrelevant to the disease recurrence risk in patients (compare with genotype AA) aa DTD0002 GENEPOLY rs3740065 Genotypes AG + GG Methotrexate Acute B-Cell Leukemia Correlated with the increased drug plasma level in patients (compare with genotype AA); Correlated with the increased toxicity risk in patients (compare with genotype AA) aa DTD0002 GENEPOLY rs3740066 SITEOFGP chr10:99844450 (GRCh38.p12) DTD0002 GENEPOLY rs3740066 GPD_TYPE SNP DTD0002 GENEPOLY rs3740066 ALLDBSNP C>G / C>T DTD0002 GENEPOLY rs3740066 MAFDBSNP T=0.2881/1443 DTD0002 GENEPOLY rs3740066 Allele C Mycophenolic acid Kidney Transplantation Irrelevant to the drug metabolism in patients (compare with Allele T) aa DTD0002 GENEPOLY rs3740066 Allele T Tacrolimus Kidney Transplantation Irrelevant to the drug trough concentration in patients (compare with allele C) aa DTD0002 GENEPOLY rs3740066 Genotype CC Irinotecan Non-Small-Cell Lung Carcinoma Correlated with the increased diarrhea risk in patients (compare with Genotypes CT + TT); Irrelevant to the neutropenia in patients (compare with Genotypes CT + TT) aa DTD0002 GENEPOLY rs3740066 Genotype CC Mycophenolic acid Organ Transplantation Irrelevant to the any pharmacokinetic parameters measured in the study (compare with Genotype TT) aa DTD0002 GENEPOLY rs3740066 Genotype CT Mycophenolic acid Lung Transplantation Correlated with the decreased drug concentrations in patients (compare with genotypes CC + tt) aa DTD0002 GENEPOLY rs3740066 Genotype TT Fluorouracil Breast Neoplasm Correlated with the increased neutropenia risk in patients (compare with genotypes CC + CT) aa DTD0002 GENEPOLY rs3740066 Genotype TT Doxorubicin Breast Neoplasm Correlated with the increased neutropenia risk in patients (compare with genotypes CC + CT) aa DTD0002 GENEPOLY rs3740066 Genotype TT Cyclophosphamide Breast Neoplasm Correlated with the increased neutropenia risk in patients (compare with genotypes CC + CT) aa DTD0002 GENEPOLY rs3740066 Genotype TT Carbamazepine Epilepsy Irrelevant to the drug resistance in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs3740066 Genotypes CT + TT Tacrolimus Kidney Transplantation Correlated with the decreased drug dose in patients (compare with genotype CC); Correlated with the increased drug dose-adjusted trough concentrations in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs3740066 Genotypes CT + TT Carbamazepine Epilepsy Correlated with the decreased drug metabolism in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs3740066 Genotypes CT + TT Fluorouracil Breast Neoplasm Correlated with the increased nausea risk in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs3740066 Genotypes CT + TT Doxorubicin Breast Neoplasm Correlated with the increased nausea risk in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs3740066 Genotypes CT + TT Cyclophosphamide Breast Neoplasm Correlated with the increased nausea risk in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs3740066 Genotype TT Oxcarbazepine Epilepsy Irrelevant to the drug resistance in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs3740066 Allele C Antiepileptics Epilepsy Irrelevant to the drug resistance in patients (compare with Allele T) ac DTD0002 GENEPOLY rs3740066 Allele T Antiepileptics Epilepsy Irrelevant to the number of seizures per year in patients (compare with allele C) ac DTD0002 GENEPOLY rs3740066 Genotypes CT + TT Antiepileptics Epilepsy Correlated with the increased drug resistance in patients (compare with genotype CC); Irrelevant to the increased drug resistance in patients (compare with genotype CC) ac DTD0002 GENEPOLY rs4148386 SITEOFGP chr10:99788711 (GRCh38.p12) DTD0002 GENEPOLY rs4148386 GPD_TYPE SNP DTD0002 GENEPOLY rs4148386 ALLDBSNP G>A DTD0002 GENEPOLY rs4148386 MAFDBSNP G=0.3886/1946 DTD0002 GENEPOLY rs4148386 Genotypes AA + AG Carbamazepine Epilepsy Correlated with the increased drug clearance in patients (compare with genotype GG) aa DTD0002 GENEPOLY rs717620 SITEOFGP chr10:99782821 (GRCh38.p12) DTD0002 GENEPOLY rs717620 GPD_TYPE SNP DTD0002 GENEPOLY rs717620 ALLDBSNP C>T DTD0002 GENEPOLY rs717620 MAFDBSNP T=0.1350/676 DTD0002 GENEPOLY rs717620 Allele C Methotrexate Leukemia Irrelevant to the nephrotoxicity risk in patients (compare with Allele T); Irrelevant to the prolonged high drug concentrations risk patients (compare with Allele T) aa DTD0002 GENEPOLY rs717620 Allele T Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased drug clearance in patients (compare with Allele C); Correlated with the increased drug toxicity risk in patients (compare with Allele C ) aa DTD0002 GENEPOLY rs717620 Allele T Mycophenolic acid Kidney Transplantation Correlated with the drug exposure in patients (compare with allele C) aa DTD0002 GENEPOLY rs717620 Allele T Lopinavir HIV Infection Correlated with the increased drug toxicity risk (compare with Genotype CC) aa DTD0002 GENEPOLY rs717620 Allele T Ritonavir HIV Infection Correlated with the increased drug toxicity risk (compare with Genotype CC) aa DTD0002 GENEPOLY rs717620 Allele T Tenofovir HIV Infection Correlated with the increased drug toxicity risk (compare with Genotype CC); Irrelevant to the likelihood of kidney diseases in patients (compare with allele C) aa DTD0002 GENEPOLY rs717620 Genotype CC Fluorouracil Colonic Neoplasm Correlated with the increased drug toxicity risk in patients (compare with Genotypes CT + TT) aa DTD0002 GENEPOLY rs717620 Genotype CC Leucovorin Colonic Neoplasm Correlated with the increased drug toxicity risk in patients (compare with Genotypes CT + TT) aa DTD0002 GENEPOLY rs717620 Genotype CC Oxaliplatin Colonic Neoplasm Correlated with the increased drug toxicity risk in patients (compare with Genotypes CT + TT) aa DTD0002 GENEPOLY rs717620 Genotype CC Sorafenib Renal Cell Carcinoma Correlated with the increased exanthema risk in patients (compare with genotype Ct) aa DTD0002 GENEPOLY rs717620 Genotype CC Tenofovir HIV Infection Correlated with the increased kidney tubular dysfunction risk in patients (compare with Genotypes CT + TT); Irrelevant to the increased renal proximal tubulopathy risk in patients (compare with Genotypes CT + TT) aa DTD0002 GENEPOLY rs717620 Genotype CT Tamoxifen Breast Neoplasm Correlated with the increased drug response in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs717620 Genotype TT Erythromycin Bacterial Infections Correlated with the increased drug metabolism (compare with genotypes CC + CT) aa DTD0002 GENEPOLY rs717620 Genotype TT Fluorouracil Colorectal Neoplasm Correlated with the increased severity of neurotoxicity syndromes in patients (compare with genotypes CC + CT) aa DTD0002 GENEPOLY rs717620 Genotype TT Leucovorin Colorectal Neoplasm Correlated with the increased severity of neurotoxicity syndromes in patients (compare with genotypes CC + CT) aa DTD0002 GENEPOLY rs717620 Genotype TT Oxaliplatin Colorectal Neoplasm Correlated with the increased severity of neurotoxicity syndromes in patients (compare with genotypes CC + CT) aa DTD0002 GENEPOLY rs717620 Genotypes CT + TT Atorvastatin Hypercholesterolemia Correlated with the decreased drug response in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs717620 Genotypes CT + TT Methotrexate Lymphoid Correlated with the increased drug clearance in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs717620 Genotypes CT + TT Leucovorin Leukemia Correlated with the increased drug distribution volume in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs717620 Genotypes CT + TT Carbamazepine Epilepsy Irrelevant to the drug response in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs717620 Genotypes CT + TT Tenofovir HIV Infection Irrelevant to the glomerular disease in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs717620 Allele T Atazanavir HIV Infection Correlated with the increased drug toxicity risk (compare with Genotype CC) aa DTD0002 GENEPOLY rs717620 Genotype TT Efavirenz HIV Infection Correlated with the increased drug concentrations in patients (compare with genotypes CC + CT) aa DTD0002 GENEPOLY rs717620 Allele C Antiepileptics Epilepsy Irrelevant to the drug resistance in patients (compare with Allele T) ac DTD0002 GENEPOLY rs717620 Allele T Antiepileptics Epilepsy Irrelevant to the number of seizures per year in patients (compare with allele C) ac DTD0002 GENEPOLY rs717620 Genotypes CT + TT Antiepileptics Epilepsy Correlated with the increased drug resistance in patients (compare with genotype CC); Irrelevant to the increased drug resistance in patients (compare with genotype CC) ac DTD0002 GENEPOLY rs7917432 SITEOFGP chr10:68399112 (GRCh38.p12) DTD0002 GENEPOLY rs7917432 GPD_TYPE SNP DTD0002 GENEPOLY rs7917432 ALLDBSNP T>C DTD0002 GENEPOLY rs7917432 MAFDBSNP C=0.3087/1546 DTD0002 GENEPOLY rs7917432 Genotype CT Tenofovir HIV Infection Correlated with the decreased drug clearance in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs8187707 SITEOFGP chr10:99850776 (GRCh38.p12) DTD0002 GENEPOLY rs8187707 GPD_TYPE SNP DTD0002 GENEPOLY rs8187707 ALLDBSNP C>T DTD0002 GENEPOLY rs8187707 MAFDBSNP T=0.0310/155 DTD0002 GENEPOLY rs8187707 Allele T Tenofovir HIV Infection Correlated with the decreased drug clearance in patients (compare with genotype CC) aa DTD0002 GENEPOLY rs8187710 SITEOFGP chr10:99851537 (GRCh38.p12) DTD0002 GENEPOLY rs8187710 GPD_TYPE SNP DTD0002 GENEPOLY rs8187710 ALLDBSNP G>A DTD0002 GENEPOLY rs8187710 MAFDBSNP A=0.0679/340 DTD0002 GENEPOLY rs8187710 Allele A Lopinavir HIV Infection Correlated with the higher drug accumulation in patients (compare with genotype GG) aa DTD0002 GENEPOLY rs8187710 Allele A Doxorubicin Non-Hodgkin Lymphoma Correlated with the increased cardiotoxicity risk in patients (compare with allele G) aa DTD0003 TRANSPID DTD0003 DTD0003 GENENAME ABCB1 DTD0003 PROTNAME P-glycoprotein 1 DTD0003 GENEDBID 5243 DTD0003 UNIPROID P08183 DTD0003 GENEPOLY rs10248420 SITEOFGP chr7:87535670 (GRCh38.p12) DTD0003 GENEPOLY rs10248420 GPD_TYPE SNP DTD0003 GENEPOLY rs10248420 ALLDBSNP A>G / A>T DTD0003 GENEPOLY rs10248420 MAFDBSNP G=0.3474/1740 DTD0003 GENEPOLY rs10248420 Allele A Clozapine Schizophrenia Correlated with the decreased drug response in patients (compare with allele G) aa DTD0003 GENEPOLY rs10248420 Allele G Citalopram Depression Correlated with the increased likelihood of remission in patients (compare with Allele A) aa DTD0003 GENEPOLY rs10248420 Allele G Amitriptyline Depression Correlated with the increased likelihood of remission in patients (compare with Allele A) aa DTD0003 GENEPOLY rs10248420 Allele G Venlafaxine Depression Correlated with the increased likelihood of remission in patients (compare with Allele A) aa DTD0003 GENEPOLY rs10248420 Allele G Paroxetine Depression Correlated with the increased likelihood of remission in patients (compare with Allele A) aa DTD0003 GENEPOLY rs10267099 SITEOFGP chr7:87649444 (GRCh38.p12) DTD0003 GENEPOLY rs10267099 GPD_TYPE SNP DTD0003 GENEPOLY rs10267099 ALLDBSNP G>A DTD0003 GENEPOLY rs10267099 MAFDBSNP G=0.1434/718 DTD0003 GENEPOLY rs10267099 Allele G Atenolol Hypertension Correlated with the increased hypercholesterolemia risk in patients (compare with Allele A) aa DTD0003 GENEPOLY rs10276036 SITEOFGP chr7:87550882 (GRCh38.p12) DTD0003 GENEPOLY rs10276036 GPD_TYPE SNP DTD0003 GENEPOLY rs10276036 ALLDBSNP C>A / C>T DTD0003 GENEPOLY rs10276036 MAFDBSNP C=0.4323/2165 DTD0003 GENEPOLY rs10276036 Allele A Doxorubicin Breast Neoplasm Irrelevant to the drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs10276036 Allele A Cyclophosphamide Breast Neoplasm Irrelevant to the drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs10276036 Allele C Methotrexate Osteosarcoma Correlated with the increased death risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs10276036 Allele C Vincristine Osteosarcoma Correlated with the increased death risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs10276036 Allele C Cisplatin Osteosarcoma Correlated with the increased death risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs10276036 Allele C Doxorubicin Osteosarcoma Correlated with the increased death risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs10276036 Allele C Cyclophosphamide Osteosarcoma Correlated with the increased death risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs10280101 SITEOFGP chr7:87524269 (GRCh38.p12) DTD0003 GENEPOLY rs10280101 GPD_TYPE SNP DTD0003 GENEPOLY rs10280101 ALLDBSNP A>C / A>G DTD0003 GENEPOLY rs10280101 MAFDBSNP C=0.1446/724 DTD0003 GENEPOLY rs10280101 Allele C Citalopram Depression Correlated with the increased likelihood of remission in patients (compare with Allele A) aa DTD0003 GENEPOLY rs10280101 Allele C Amitriptyline Depression Correlated with the increased likelihood of remission in patients (compare with Allele A) aa DTD0003 GENEPOLY rs10280101 Allele C Venlafaxine Depression Correlated with the increased likelihood of remission in patients (compare with Allele A) aa DTD0003 GENEPOLY rs10280101 Allele C Paroxetine Depression Correlated with the increased likelihood of remission in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1045642 SITEOFGP chr7:87509329 (GRCh38.p12) DTD0003 GENEPOLY rs1045642 GPD_TYPE SNP DTD0003 GENEPOLY rs1045642 ALLDBSNP A>G / A>T DTD0003 GENEPOLY rs1045642 MAFDBSNP A=0.3952/1979 DTD0003 GENEPOLY rs1045642 Allele A Methadone Opioid-Related Disorders Correlated with the decreased drug concentrations in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Vincristine Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased likelihood of event-free survival in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Simvastatin Hypercholesterolemia Correlated with the decreased myalgia risk in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Nelfinavir HIV Infection Correlated with the decreased toxic liver disease risk in patient (compare with allele G); Correlated with the increased likelihood of toxicity-related treatment failure in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Methotrexate Rheumatoid Arthritis Correlated with the increased adverse drug event risk in patients (compare with allele G); Irrelevant to the drug discontinuation in patients (compare with allele G); Irrelevant to the drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Clopidogrel Hemorrhage Correlated with the increased disease risk in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Clopidogrel Acute Coronary Syndrome Correlated with the increased disease risk in patients (compare with allele G); Irrelevant to the drug exposure in patients (compare with allele G); Irrelevant to the the drug antiplatelet effect or clinical outcomes in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Digoxin Congestive Cardiac Insufficiency; Arrhythmias; Heart Failure Correlated with the increased drug serum concentrations in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Codeine CNS Depression Correlated with the increased likelihood of disease in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Carbamazepine Epilepsy Correlated with the increased likelihood of drug resistance in patients (compare with allele G); Irrelevant to the drug concentrations in patients (compare with allele G); Irrelevant to the drug metabolism in patients (compare with Allele G); Irrelevant to the increased drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Everolimus Breast Neoplasm Correlated with the increased likelihood of mucositis in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Atorvastatin Coronary Artery Disease Correlated with the increased likelihood of myalgia in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Phenytoin Healthy Individuals Correlated with the increased plasma drug levels in healthy individuals (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Allele A Olanzapine Psychotic Disorders Correlated with the positive relationship between drug plasma levels and positive symptom reduction in patients (compare genotype GG) aa DTD0003 GENEPOLY rs1045642 Allele A Tacrolimus Kidney Transplantation Irrelevant to the acute cellular rejection in patients (compare with allele G); Irrelevant to the dose-adjusted trough concentrations in patients (compare with allele G); Irrelevant to the drug bioavailability in patients (compare with allele G); Irrelevant to the drug clearance in patients (compare with Allele G); Irrelevant to the drug clearance in patients (compare with allele G); Irrelevant to the drug metabolism in patients (compare with Allele G); Irrelevant to the drug trough concentrations in patients (compare with Allele G); Irrelevant to the likelihood of achieving target concentrations of drug in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Paliperidone Bipolar Disorder Irrelevant to the drug clearance in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1045642 Allele A Paliperidone Psychotic Disorders Irrelevant to the drug clearance in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1045642 Allele A Risperidone Bipolar Disorder Irrelevant to the drug clearance in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1045642 Allele A Risperidone Psychotic Disorders Irrelevant to the drug clearance in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1045642 Allele A Tacrolimus Hemopoietic Stem Cell Transplant Irrelevant to the drug clearance in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Tacrolimus Liver Transplantation Irrelevant to the drug clearance in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Cyclosporine Kidney Transplantation Irrelevant to the drug clearance in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Sirolimus Kidney Transplantation Irrelevant to the drug metabolism in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Irrelevant to the drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Irrelevant to the drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Clopidogrel Angina Pectoris Irrelevant to the drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Clopidogrel Platelet Reactivity Irrelevant to the drug response in patients (compare with Allele G); Irrelevant to the the antiplatelet effect or drug clinical outcomes in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Sunitinib Renal Cell Carcinoma Irrelevant to the drug toxicity in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Clopidogrel St-Segment Elevation Myocardial Infarction Irrelevant to the increased disease risk in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Valproic acid Epilepsy Irrelevant to the increased drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Phenytoin Epilepsy Irrelevant to the increased drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Phenobarbital Epilepsy Irrelevant to the increased drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Clopidogrel Coronary Artery Disease Irrelevant to the increased high on-treatment platelet reactivity risk in patients (compare with Allele G); Irrelevant to the increased myocardial infarction (mI) or composite outcome of non-fatal mI, all cause death and stent thrombosis risk in patients (compare with Allele G); Irrelevant to the major adverse cardiac risk in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Clopidogrel Percutaneous Coronary Intervention Irrelevant to the increased high post-treatment platelet reactivity risk in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Clopidogrel Myocardial Infarction Irrelevant to the increased mortality risk in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Clopidogrel Coronary Disease Irrelevant to the increased on-treatment platelet activity risk in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Ritonavir HIV Infection Irrelevant to the likelihood of treatment failure in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Ranitidine Breast Neoplasm Irrelevant to the overall survival in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Dexamethasone Breast Neoplasm Irrelevant to the overall survival in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele A Paclitaxel Breast Neoplasm Irrelevant to the overall survival in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele G Phenytoin Epilepsy Correlated with the increased likelihood of drug resistance in patients (compare with Allele A); Irrelevant to the drug response in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Atorvastatin Coronary Artery Disease Irrelevant to the dose decrease or drug switching risk (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Atorvastatin Hypercholesterolemia Irrelevant to the dose decrease or drug switching risk (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Simvastatin Coronary Artery Disease Irrelevant to the dose decrease or drug switching risk (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Simvastatin Hypercholesterolemia Irrelevant to the dose decrease or drug switching risk (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Tacrolimus Organ Transplantation Irrelevant to the drug concentrations in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Tacrolimus Kidney Transplantation Irrelevant to the drug metabolism in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Methotrexate Rheumatoid Arthritis Irrelevant to the drug response in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Fluorouracil Esophageal Neoplasm Irrelevant to the drug response in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Clopidogrel Acute Coronary Syndrome Irrelevant to the drug response in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Clopidogrel Myocardial Infarction Irrelevant to the drug response in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Cisplatin Esophageal Neoplasm Irrelevant to the drug response in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Carbamazepine Epilepsy Irrelevant to the drug response in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Valproic acid Epilepsy Irrelevant to the drug response in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Phenobarbital Epilepsy Irrelevant to the drug response in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Ritonavir HIV Infection Irrelevant to the hyperbilirubinemia risk in patients (compare with allele A); Irrelevant to the severity of hyperbilirubinemia in patients (compare with allele A); Irrelevant to the trough concentration of drug in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Paliperidone Schizophrenia Irrelevant to the increased drug metabolism in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Risperidone Schizophrenia Irrelevant to the increased drug metabolism in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Fluorouracil Breast Neoplasm Irrelevant to the likelihood of drug toxicity in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Allele G Cyclophosphamide Breast Neoplasm Irrelevant to the likelihood of drug toxicity in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Genotype AA Clopidogrel Coronary Artery Disease Correlated with the decreased bleeding events in patients (compare with genotype GG); Correlated with the decreased drug exposure in patients (compare with genotypes AG + GG); Correlated with the decreased drug peak plasma concentration (Cmax) and the total area under the plasma concentration-time curve (AUC) in patients (compare with genotypes GG + AG); Correlated with the decreased drug response in patients (compare with genotypes AG + GG); Correlated with the increase early major adverse cardiovascular events (mACE) risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Tacrolimus Kidney Transplantation Correlated with the decreased drug clearance in patients (compare with genotypes AG + GG); Correlated with the decreased drug metabolism in patients (compare with genotype GG); Correlated with the increased drug dose in patients (compare with genotype AG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Digoxin Congestive Cardiac Insufficiency; Arrhythmias; Heart Failure Correlated with the decreased drug metabolism (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Fexofenadine Healthy Individuals Correlated with the decreased drug plasma concentration in healthy individuals (compare with genotypes GG + AG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Fentanyl Neoplasm Correlated with the decreased drug response in patients (compare with Genotype AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Methotrexate Rheumatoid Arthritis Correlated with the decreased drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Anastrozole Breast Neoplasm Correlated with the decreased likelihood of Arthralgia in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Pantoprazole Helicobacter Infections Correlated with the decreased likelihood of Postoperative nausea and Vomiting in patients (compare with genotypes AG + GG); Correlated with the increased drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Sunitinib Renal Cell Carcinoma Correlated with the decreased neutropenia risk in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Methylprednisolone Kidney Transplantation Correlated with the decreased osteonecrosis risk in patients (compare with genotypes GG + AG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Prednisolone Kidney Transplantation Correlated with the decreased osteonecrosis risk in patients (compare with genotypes GG + AG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Clozapine Schizophrenia Correlated with the increased agranulocytosis and neutropenia risk in patients (compare with genotypes AG + GG); Correlated with the increased drug plasma concentrations in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Vincristine Lymphoma Correlated with the increased anemia and thrombocytopenia risk in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Doxorubicin Lymphoma Correlated with the increased anemia and thrombocytopenia risk in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Prednisolone Lymphoma Correlated with the increased anemia and thrombocytopenia risk in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Methotrexate Lymphoma Correlated with the increased anemia and thrombocytopenia risk in patients (compare with genotypes AG + GG); Correlated with the increased drug concentrations in patients (compare with genotype GG); Correlated with the increased toxic liver disease risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Clopidogrel Acute Coronary Syndrome Correlated with the increased cardiovascular death, myocardial infarction, or stroke risk in patients (compare with genotypes GG + AG); Correlated with the increased thrombosis risk in pstients(compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Clopidogrel Myocardial Infarction Correlated with the increased cardiovascular events risk in patients (compare with genotype GG); Correlated with the increased platelet reactivity in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Nelfinavir HIV Infection Correlated with the increased CD4 t cell count in patients (compare with genotype AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Tacrolimus Rheumatoid Arthritis Correlated with the increased dose-adjusted trough concentrations in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Talinolol Healthy Individuals Correlated with the increased drug clearance in healthy individuals (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Methadone Opioid-Related Disorders Correlated with the increased drug clearance in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Methadone Heroin Dependence Correlated with the increased drug dose in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Tramadol Pain Correlated with the increased drug exposure (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Morphine Pain Correlated with the increased drug metabolism in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the increased drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Fentanyl Postoperative Pain Correlated with the increased likelihood of respiratory insufficiency in patients (compare with Genotype AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Morphine Neoplasm Correlated with the increased reduction in pain in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Simvastatin Coronary Artery Disease Correlated with the increased reduction in total cholesterol in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Tacrolimus Liver Transplantation Irrelevant to the drug concentrations in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Daunorubicin Acute Myeloid Leukemia Irrelevant to the drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Cytarabine Acute Myeloid Leukemia Irrelevant to the drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Methotrexate Hematologic Neoplasm Irrelevant to the neurotoxicity syndromes risk in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AG Paclitaxel Breast Neoplasm Correlated with the decreased disease control rate and lower overall survival rate in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AG Methotrexate Rheumatoid Arthritis Correlated with the decreased drug toxicity risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AG Tamoxifen Breast Neoplasm Correlated with the increased disease recurrence risk in patients (compare with genotype GG); Correlated with the increased disease recurrence risk in patients (compare with genotypes AA + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AG Methadone Opioid-Related Disorders Correlated with the increased drug concentrations in patients (compare with genotypes AA + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AG Tacrolimus Kidney Transplantation Correlated with the increased hypokalemia risk in patients (compare with genotypes AA + GG); Correlated with the increased transplant rejection risk in patients (compare with genotypes AA + GG); Irrelevant to the drug concentrations in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AG Oxaliplatin Colorectal Neoplasm Correlated with the increased recurrence-free survival in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotype AG Carbamazepine Epilepsy Irrelevant to the drug metabolism in patients (compare with genotypes AA + GG) aa DTD0003 GENEPOLY rs1045642 Genotype GA Methotrexate Rheumatoid Arthritis Correlated with the increased nonresponse risk in patients aa DTD0003 GENEPOLY rs1045642 Genotype GG Fluorouracil Colorectal Neoplasm Correlated with the decreased diarrhea risk in patients (compare with genotype AA); Irrelevant to the drug response in patients (compare with genotypes AA + AG); Irrelevant to the drug toxicity in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Cyclosporine Transplantation Correlated with the decreased drug concentrations in patients (compare with genotype AA); Correlated with the decreased drug intracellular and blood concentration in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Verapamil Healthy Individuals Correlated with the decreased drug metabolism in healthy individuals (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Atorvastatin Coronary Artery Disease Correlated with the decreased drug response in patients (compare with genotypes AA + AG); Irrelevant to the drug response in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotype GG Vincristine Multiple Myeloma Correlated with the decreased survival in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotype GG Dexamethasone Multiple Myeloma Correlated with the decreased survival in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotype GG Doxorubicin Multiple Myeloma Correlated with the decreased survival in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotype GG Fluorouracil Esophageal Neoplasm Correlated with the decreased survival rate in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Cisplatin Esophageal Neoplasm Correlated with the decreased survival rate in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Fluorouracil Breast Neoplasm Correlated with the increased anemia risk in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Doxorubicin Breast Neoplasm Correlated with the increased anemia risk in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Cyclophosphamide Breast Neoplasm Correlated with the increased anemia risk in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Probenecid Gout; Hyperuricemia Correlated with the increased drug clearance (compare with genotype AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Dicloxacillin Cystic Fibrosis Correlated with the increased drug clearance (compare with genotype AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Carbamazepine Epilepsy Correlated with the increased drug concentrations in patients (compare with genotype AG); Irrelevant to the drug resistance in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Paliperidone Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with Genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Risperidone Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with Genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Digoxin Congestive Cardiac Insufficiency; Arrhythmias; Heart Failure Correlated with the increased drug metabolism (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotype GG Etoposide Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased drug metabolism in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Tacrolimus Liver Transplantation Correlated with the increased drug metabolism in patients (compare with genotypes AA + AG); Irrelevant to the drug dose-adjusted trough concentrations in patients (compare with genotypes AA + AG); Irrelevant to the drug metabolism in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Clopidogrel Hypertension Correlated with the increased drug resistance in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotype GG Phenobarbital Epilepsy Correlated with the increased drug resistance in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotype GG Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the increased drug response in patients (compare with genotypes AA + AG); Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Methotrexate Rheumatoid Arthritis Correlated with the increased drug toxicity risk in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Sunitinib Renal Cell Carcinoma Correlated with the increased exanthema and mucositis risk in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Clopidogrel Acute Coronary Syndrome Correlated with the increased ischaemic events risk in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Cytarabine Acute Myeloid Leukemia Correlated with the increased likelihood of 3-year Event Free Survival in patients (compare with genotypes AA + AG); Correlated with the increased likelihood of complete remission in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Cytarabine Acute Multiple Myeloma Irrelevant to the decreased survival in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotype GG Tacrolimus Kidney Transplantation Irrelevant to the drug clearance in patients (compare with genotypes AA + AG); Irrelevant to the drug dose-adjusted trough concentrations in patients (compare with Allele T); Irrelevant to the drug dose-adjusted trough concentrations in patients (compare with genotypes AA + AG); Irrelevant to the drug metabolism in patients (compare with genotypes AA + AG); Irrelevant to the glomerular filtration rate in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Bilirubin HIV Infection Irrelevant to the drug concentrations in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Tacrolimus Organ Transplantation Irrelevant to the drug concentrations in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Tacrolimus Rheumatoid Arthritis Irrelevant to the drug dose-adjusted trough concentrations in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Simvastatin Hypercholesterolemia Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Irinotecan Colorectal Neoplasm Irrelevant to the drug response in patients (compare with genotypes AA + AG); Irrelevant to the drug toxicity in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Oxaliplatin Colorectal Neoplasm Irrelevant to the drug response in patients (compare with genotypes AA + AG); Irrelevant to the drug toxicity in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Clopidogrel Acute Coronary Syndrome Correlated with the decreased drug metabolism in patients (compare with genotype GG); Correlated with the decreased drug response in patients (compare with genotype GG); Correlated with the increased early major adverse cardiovascular events (mACE) risk in patients (compare with genotype GG); Irrelevant to the drug response in patients (compare with genotype GG); Irrelevant to the increased high on-treatment platelet reactivity risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Clopidogrel Platelet Reactivity Correlated with the decreased drug response in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the decreased drug response in patients (compare with genotype GG); Correlated with the decreased drug trough concentration in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Tacrolimus Kidney Transplantation Correlated with the decreased glomerular filtration rate in patients (compare with genotype GG); Irrelevant to the drug dose-adjusted trough concentrations in patients (compare with genotype GG); Irrelevant to the renal transplant failure risk in patients (compare with genotype GG); Irrelevant to the transplant rejection risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Fluorouracil Esophageal Neoplasm Correlated with the decreased lymph node metastases risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Cisplatin Esophageal Neoplasm Correlated with the decreased lymph node metastases risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Tacrolimus Lung Transplantation Correlated with the increased drug concentrations in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Rivaroxaban Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Dabigatran Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Losartan Hypertension Correlated with the increased drug response in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased drug toxicity risk in patients (compare with genotype GG); Irrelevant to the drug concentrations in patients (compare with genotype GG); Irrelevant to the mucositis risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Sorafenib Renal Cell Carcinoma Correlated with the increased hypertension risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Sirolimus Kidney Transplantation Correlated with the increased low-density lipoprotein cholesterol in patients (compare with genotype GG); Correlated with the increased total cholesterol in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Clopidogrel Coronary Artery Disease Correlated with the increased major adverse cardiovascular events (mACE) risk in patients (compare with genotype GG); Irrelevant to the all-cause mortality in patients (compare with genotype GG); Irrelevant to the increased high on-treatment platelet reactivity risk in patients (compare with genotype GG); Irrelevant to the increased ischemic stroke risk in patients (compare with genotype GG); Irrelevant to the increased major adverse cardiovascular events (MACE) risk in patients (compare with genotype GG); Irrelevant to the increased myocardial Infarction risk in patients (compare with genotype GG); Irrelevant to the stent thrombosis in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Clopidogrel Myocardial Infarction Correlated with the increased major cardiovascular events (mACE) risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Cytarabine Acute Multiple Myeloma Correlated with the increased overall survival in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Ritonavir HIV Infection Irrelevant to the drug concentrations in patients (compare with genotype GG); Irrelevant to the increased drug discontinuation in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Paclitaxel Breast Neoplasm Irrelevant to the increased drug response in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Tacrolimus Liver Transplantation Correlated with the increased drug clearance in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Tacrolimus Kidney Transplantation Correlated with the increased drug clearance in patients (compare with genotype AA); Correlated with the increased drug dose-adjusted trough concentrations in patients (compare with genotype AA); Irrelevant to the drug metabolism in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Lamivudine HIV Infection Correlated with the increased drug resistance in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Lopinavir HIV Infection Correlated with the increased drug resistance in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Zidovudine HIV Infection Correlated with the increased drug resistance in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Ritonavir HIV Infection Correlated with the increased drug resistance in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Gemcitabine Neoplasm Irrelevant to the decreased clinical outcome in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Epirubicin Neoplasm Irrelevant to the decreased clinical outcome in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Docetaxel Neoplasm Irrelevant to the decreased clinical outcome in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Cisplatin Neoplasm Irrelevant to the decreased clinical outcome in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Tacrolimus Ulcerative Colitis Irrelevant to the drug metabolism in patients (compare with genotype AA); Irrelevant to the drug response in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Fluorouracil Colorectal Neoplasm Irrelevant to the prognosis in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Leucovorin Colorectal Neoplasm Irrelevant to the prognosis in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Cisplatin Colorectal Neoplasm Irrelevant to the prognosis in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotype GG Agomelatine Depressive Disorder Correlated with the increased drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Allele A Oxcarbazepine Epilepsy Correlated with the decreased drug response in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Genotype GG Oxcarbazepine Epilepsy Correlated with the increased drug concentrations in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Venlafaxine Depressive Disorder Correlated with the increased drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Venlafaxine Narcolepsy Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Allele A Nevirapine HIV Infection Correlated with the decreased toxic liver disease risk in patients (compare with allele G); Correlated with the decreased toxic liver disease risk in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Genotype GG Nevirapine HIV Infection Irrelevant to the drug metabolism in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotype AA Voriconazole Healthy Individuals Correlated with the decreased drug metabolism in healthy individuals (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Granisetron Nausea; Vomiting Correlated with the increased drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Allele A Isoniazid Tuberculosis Irrelevant to the drug-induced liver injury risk in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Genotype AA Dexrazoxane Acute Myeloid Leukemia Irrelevant to the drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Allele A Atazanavir HIV Infection Irrelevant to the likelihood of treatment failure in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Allele G Atazanavir HIV Infection Irrelevant to the drug concentrations in patients (compare with Allele A); Irrelevant to the hyperbilirubinemia risk in patients (compare with allele A); Irrelevant to the likelihood of hyperbilirubinemia in patients (compare with allele A); Irrelevant to the severity of hyperbilirubinemia in patients (compare with allele A); Irrelevant to the trough concentration of drug in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Genotype GG Atazanavir HIV Infection Correlated with the increased drug concentrations in patients (compare with genotypes AA + AG); Irrelevant to the drug concentrations in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Atazanavir HIV Infection Irrelevant to the increased drug discontinuation in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Allele A Efavirenz HIV Infection Correlated with the decreased toxic liver disease risk in patient (compare with allele G); Correlated with the decreased toxic liver disease risk in patients (compare with allele G); Correlated with the increased likelihood of toxicity-related treatment failure in patients (compare with allele G) aa DTD0003 GENEPOLY rs1045642 Allele G Efavirenz HIV Infection Irrelevant to the neurotoxicity syndromes in patients (compare with allele A) aa DTD0003 GENEPOLY rs1045642 Genotype AA Efavirenz HIV Infection Correlated with the decreased drug concentrations in patients (compare with genotypes AG + GG); Correlated with the increased CD4 t cell count in patients (compare with genotype AG + GG); Correlated with the increased CD4 t cell count in patients (compare with genotype GG); Correlated with the increased drug clearance in patients (compare with genotype AG); Correlated with the increased likelihood of drug responses in patients (compare with genotypes GG + Gt); Irrelevant to increased likelihood of drug plasma exposure in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Efavirenz HIV Infection Correlated with the decreased drug clearance in patients (compare with genotype AG); Irrelevant to the drug metabolism in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Efavirenz HIV Infection Irrelevant to the increased drug minimum plasma or PBMC concentrations in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype AG Modafinil Narcolepsy Correlated with the increased drug response in patients (compare with genotypes AA + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Daptomycin Bacterial infections Correlated with the decreased drug clearance in patients (compare with genotypes AG + GG); Correlated with the increased drug concentrations in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Nortriptyline Major Depressive Disorder Correlated with the increased likelihood of hypotension, orthostatic in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotype AA Palonosetron Nausea; Vomiting Irrelevant to the drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Allele A Oxycodone Postoperative Pain Irrelevant to the severity of pain in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Genotype GG Silibinin Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotype AA Omeprazole Helicobacter Infections Correlated with the decreased likelihood of postoperative nausea and vomiting in patients (compare with genotypes AG + GG); Correlated with the increased drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1045642 Genotypes AA + AG Omeprazole Gastroesophageal Reflux Correlated with the increased drug concentrations in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1045642 Genotype GG Idarubicin Acute Myeloid Leukemia Correlated with the increased likelihood of 3-year Event Free Survival in patients (compare with genotypes AA + AG); Correlated with the increased likelihood of complete remission in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1045642 Allele A Diphenhydramine Breast Neoplasm Irrelevant to the overall survival in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1045642 Genotype GG Capecitabine Colorectal Neoplasm Correlated with the increased hand-foot syndrome risk in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Genotypes AG + GG Capecitabine Neoplasm Irrelevant to the decreased clinical outcome in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1045642 Allele G Antiepileptics Epilepsy Irrelevant to the drug resistance in patients (compare with allele A); Irrelevant to the drug response in patients (compare with allele A) ac DTD0003 GENEPOLY rs1045642 Genotype AA Opioids Neoplasm Correlated with the decreased drug dose in patients (compare with genotypes AG + GG) ac DTD0003 GENEPOLY rs1045642 Genotype AA Opioids Postoperative Pain Correlated with the decreased drug dose in patients (compare with genotypes AG + GG) ac DTD0003 GENEPOLY rs1045642 Genotype AA Antiepileptics Epilepsy Correlated with the increased drug resistance in patients (compare with genotype GG) ac DTD0003 GENEPOLY rs1045642 Genotype AA Antivirals combinations drugs for treatment of tuberculosis HIV Infection; Tuberculosis Co-Infection Correlated with the increased drug-induced liver injury risk in patieants (compare with genotype GG) ac DTD0003 GENEPOLY rs1045642 Genotype AA Anthracyclines Breast Neoplasm Correlated with the increased likelihood of complete response in patients (compare with genotypes GG + AG) ac DTD0003 GENEPOLY rs1045642 Genotype AA Taxanes Breast Neoplasm Correlated with the increased likelihood of complete response in patients (compare with genotypes GG + AG) ac DTD0003 GENEPOLY rs1045642 Genotype AG Antiepileptics Epilepsy Correlated with the increased drug resistance in patients (compare with genotype GG) ac DTD0003 GENEPOLY rs1045642 Genotype AG Antineoplastic agents Neoplasm Correlated with the increased severity of nausea in patients (compare with genotypes AA + GG) ac DTD0003 GENEPOLY rs1045642 Genotype GG Opioids Opioid-Related Disorders Correlated with the decreased opioid-related disorders risk in patients (compare with genotype AG) ac DTD0003 GENEPOLY rs1045642 Genotype GG Melatonin receptor agonists Depressive Disorder Correlated with the increased drug response in patients (compare with genotypes AA + AG) ac DTD0003 GENEPOLY rs1045642 Genotype GG Platinum compounds Non-Small-Cell Lung Carcinoma Correlated with the increased drug response in patients (compare with genotypes AA + AG) ac DTD0003 GENEPOLY rs1045642 Genotype GG Selective serotonin reuptake inhibitors Depressive Disorder Correlated with the increased drug response in patients (compare with genotypes AA + AG) ac DTD0003 GENEPOLY rs1045642 Genotype GG Antiepileptics Epilepsy Correlated with the increased likelihood of drug-resistance in patients (compare with genotype AA) ac DTD0003 GENEPOLY rs1128503 SITEOFGP chr7:87550285 (GRCh38.p12) DTD0003 GENEPOLY rs1128503 GPD_TYPE SNP DTD0003 GENEPOLY rs1128503 ALLDBSNP A>G DTD0003 GENEPOLY rs1128503 MAFDBSNP A=0.4161/2084 DTD0003 GENEPOLY rs1128503 Allele A Simvastatin Hypercholesterolemia Correlated with the decreased myalgia risk in patients (compare with allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Digoxin Congestive Cardiac Insufficiency; Arrhythmias; Heart Failure Correlated with the increased drug serum concentrations in patients (compare with allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Codeine Pain Correlated with the increased likelihood of CnS depression when used drug (compare with allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Phenytoin Healthy Individuals Correlated with the increased plasma drug levels in healthy individual (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Allele A Tacrolimus Kidney Transplantation Irrelevant to the dose-adjusted trough concentrations in patients (compare with allele G); Irrelevant to the drug clearance in patients (compare with Allele G); Irrelevant to the drug metabolism in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Cyclosporine Kidney Transplantation Irrelevant to the drug clearance in patients (compare with allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Tacrolimus Liver Transplantation Irrelevant to the drug clearance in patients (compare with Allele G); Irrelevant to the drug metabolism in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Carbamazepine Epilepsy Irrelevant to the drug concentrations in patients (compare with allele G); Irrelevant to the drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Methotrexate Rheumatoid Arthritis Irrelevant to the drug discontinuation in patients (compare with allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Sirolimus Kidney Transplantation Irrelevant to the drug metabolism in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Irrelevant to the drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Valproic acid Epilepsy Irrelevant to the drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Phenytoin Epilepsy Irrelevant to the drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Phenobarbital Epilepsy Irrelevant to the drug response in patients (compare with Allele G) aa DTD0003 GENEPOLY rs1128503 Allele A Sunitinib Renal Cell Carcinoma Irrelevant to the drug toxicity in patients (compare with allele G) aa DTD0003 GENEPOLY rs1128503 Allele G Methotrexate Osteosarcoma Correlated with the increased death risk in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1128503 Allele G Vincristine Osteosarcoma Correlated with the increased death risk in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1128503 Allele G Cisplatin Osteosarcoma Correlated with the increased death risk in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1128503 Allele G Doxorubicin Osteosarcoma Correlated with the increased death risk in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1128503 Allele G Cyclophosphamide Osteosarcoma Correlated with the increased death risk in patients (compare with Allele A) aa DTD0003 GENEPOLY rs1128503 Allele G Carbamazepine Epilepsy Irrelevant to the drug metabolism in patients (compare with allele A) aa DTD0003 GENEPOLY rs1128503 Allele G Doxorubicin Breast Neoplasm Irrelevant to the drug response in patients (compare with allele A) aa DTD0003 GENEPOLY rs1128503 Allele G Cyclophosphamide Breast Neoplasm Irrelevant to the drug response in patients (compare with allele A) aa DTD0003 GENEPOLY rs1128503 Genotype AA Tacrolimus Kidney Transplantation Correlated with the decreased drug clearance in patients (compare with genotypes AG + GG); Irrelevant to the drug clearance in patients (compare with genotypes AG + GG); Irrelevant to the drug concentrations in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Fentanyl Neoplasm Correlated with the decreased drug response in patients (compare with Genotype AG + GG ) aa DTD0003 GENEPOLY rs1128503 Genotype AA Sunitinib Renal Cell Carcinoma Correlated with the decreased neutropenia risk in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Gefitinib Non-Small-Cell Lung Carcinoma Correlated with the increased diarrhea and exanthema risk in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Tramadol Pain Correlated with the increased drug exposure (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Fentanyl Postoperative Pain Correlated with the increased likelihood of respiratory insufficiency in patients (compare with Genotype AG + GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Cyclosporine Kidney Transplantation Correlated with the increased nephrotoxicity risk in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Oxaliplatin Colorectal Neoplasm Correlated with the increased overall survival in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Simvastatin Hypercholesterolemia Correlated with the increased reduction in total cholesterol in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Sirolimus Kidney Transplantation Correlated with the increased triglycerides in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Cyclosporine Myasthenia Gravis Correlated with the increased trough blood concentration in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Daunorubicin Acute Myeloid Leukemia Irrelevant to the drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Cytarabine Acute Myeloid Leukemia Irrelevant to the drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Tacrolimus Ulcerative Colitis Irrelevant to the increased success rate in achieving short-term remission in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1128503 Genotype AG Tacrolimus Kidney Transplantation Correlated with the increased drug trough concentrations in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotype AG Methotrexate Rheumatoid Arthritis; Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased likelihood of drug toxicity in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotype AG Oxaliplatin Colorectal Neoplasm Correlated with the increased overall survival in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotype GG Tacrolimus Liver Transplantation Correlated with the decreased drug concentrations in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1128503 Genotype GG Sirolimus Urinary Bladder Neoplasm Correlated with the decreased drug exposure in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1128503 Genotype GG Temsirolimus Urinary Bladder Neoplasm Correlated with the decreased drug exposure in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1128503 Genotype GG Simvastatin Hypercholesterolemia Correlated with the decreased drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1128503 Genotype GG Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the decreased drug response in patients (compare with genotypes AA + AG); Correlated with the increased drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1128503 Genotype GG Cytarabine Acute Myeloid Leukemia Correlated with the decreased survival in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1128503 Genotype GG Gefitinib Non-Small-Cell Lung Carcinoma Irrelevant to the drug toxicity risk in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1128503 Genotypes AA + AG Sunitinib Renal Cell Carcinoma Correlated with the decreased diarrhea risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotypes AA + AG Carbamazepine Epilepsy Correlated with the increased drug clearance in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotypes AA + AG Clopidogrel Acute Coronary Syndrome Correlated with the increased drug resistance (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotypes AA + AG Risperidone Autistic Disorder Correlated with the increased drug response in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotypes AA + AG Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased drug toxicity risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotypes AA + AG Tacrolimus Heart Transplantation Correlated with the increased infection risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotypes AA + AG Cyclosporine Heart Transplantation Correlated with the increased infection risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotypes AA + AG Cytarabine Acute Multiple Myeloma Correlated with the increased overall survival in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Genotypes AG + GG Tacrolimus Ulcerative Colitis Correlated with the increased drug response in patients (compare with genotype AA); Irrelevant to the drug metabolism in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1128503 Genotypes AG + GG Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Irrelevant to the mucositis risk in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs1128503 Genotype GG Sevoflurane Tonsillectomy Correlated with the decreased likelihood of adverse events in patients (compare with genotypes AA + AG); Correlated with the increased drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1128503 Genotype GG Remifentanil Tonsillectomy Correlated with the increased drug response (compare with genotypes AA + AG); Correlated with the increased drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Rocuronium Muscle Relaxant Correlated with the increased drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1128503 Genotype GG Propofol Anesthesia Correlated with the increased drug response (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Dexrazoxane Acute Myeloid Leukemia Irrelevant to the drug response in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Efavirenz HIV Infection Correlated with the decreased drug concentrations in patients (compare with genotypes AG + GG) aa DTD0003 GENEPOLY rs1128503 Genotype AG Modafinil Narcolepsy Correlated with the increased drug response in patients (compare with genotypes AA + GG) aa DTD0003 GENEPOLY rs1128503 Genotype AA Capecitabine Colorectal Neoplasm Correlated with the decreased hand-foot syndrome and neutropenia risk in patients (compare with genotype GG) aa DTD0003 GENEPOLY rs1128503 Allele A Antiepileptics Epilepsy Irrelevant to the drug resistance in patients (compare with allele G); Irrelevant to the drug response in patients (compare with Allele G); Irrelevant to the likelihood of drug resistance in patients (compare with Allele G) ac DTD0003 GENEPOLY rs1128503 Allele G Antiepileptics Epilepsy Irrelevant to the drug response in patients (compare with allele A) ac DTD0003 GENEPOLY rs1128503 Genotype AA Tipifarnib Neoplasm Correlated with the decreased drug metabolism in patients (compare with genotypes AG + GG) ac DTD0003 GENEPOLY rs1128503 Genotype AA Platinum compounds Non-Small-Cell Lung Carcinoma Correlated with the increased drug toxicity risk in patients (compare with genotype GG); Correlated with the increased drug toxicity risk in patients (compare with genotypes AG + GG) ac DTD0003 GENEPOLY rs11983225 SITEOFGP chr7:87532204 (GRCh38.p12) DTD0003 GENEPOLY rs11983225 GPD_TYPE SNP DTD0003 GENEPOLY rs11983225 ALLDBSNP T>C DTD0003 GENEPOLY rs11983225 MAFDBSNP C=0.1456/729 DTD0003 GENEPOLY rs11983225 Allele C Citalopram Depression Correlated with the increased likelihood of remission in patients (compare with Allele T) aa DTD0003 GENEPOLY rs11983225 Allele C Amitriptyline Depression Correlated with the increased likelihood of remission in patients (compare with Allele T) aa DTD0003 GENEPOLY rs11983225 Allele C Venlafaxine Depression Correlated with the increased likelihood of remission in patients (compare with Allele T) aa DTD0003 GENEPOLY rs11983225 Allele C Paroxetine Depression Correlated with the increased likelihood of remission in patients (compare with Allele T) aa DTD0003 GENEPOLY rs12720066 SITEOFGP chr7:87540386 (GRCh38.p12) DTD0003 GENEPOLY rs12720066 GPD_TYPE SNP DTD0003 GENEPOLY rs12720066 ALLDBSNP A>C DTD0003 GENEPOLY rs12720066 MAFDBSNP C=0.0212/106 DTD0003 GENEPOLY rs12720066 Genotypes AC + CC Irinotecan Colorectal Neoplasm Correlated with the increased severity of neutropenia in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs12720067 SITEOFGP chr7:87540040 (GRCh38.p12) DTD0003 GENEPOLY rs12720067 GPD_TYPE SNP DTD0003 GENEPOLY rs12720067 ALLDBSNP C>T DTD0003 GENEPOLY rs12720067 MAFDBSNP T=0.0899/450 DTD0003 GENEPOLY rs12720067 Allele T Citalopram Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs12720067 Allele T Amitriptyline Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs12720067 Allele T Venlafaxine Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs12720067 Allele T Paroxetine Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs17160359 SITEOFGP chr7:87717503 (GRCh38.p12) DTD0003 GENEPOLY rs17160359 GPD_TYPE SNP DTD0003 GENEPOLY rs17160359 ALLDBSNP G>A / G>T DTD0003 GENEPOLY rs17160359 MAFDBSNP T=0.0092/46 DTD0003 GENEPOLY rs17160359 Allele T Fluorouracil Neoplasm Correlated with the increased drug response in patients (compare with allele G) aa DTD0003 GENEPOLY rs17160359 Allele T Capecitabine Neoplasm Correlated with the increased drug response in patients (compare with allele G) aa DTD0003 GENEPOLY rs1922242 SITEOFGP chr7:87544351 (GRCh38.p12) DTD0003 GENEPOLY rs1922242 GPD_TYPE SNP DTD0003 GENEPOLY rs1922242 ALLDBSNP A>T DTD0003 GENEPOLY rs1922242 MAFDBSNP T=0.3790/1898 DTD0003 GENEPOLY rs1922242 Genotype AA Fluvastatin Hypercholesterolemia Correlated with the increased drug response in patients (compare with genotype At) aa DTD0003 GENEPOLY rs2032582 SITEOFGP chr7:87531302 (GRCh38.p12) DTD0003 GENEPOLY rs2032582 GPD_TYPE SNP DTD0003 GENEPOLY rs2032582 ALLDBSNP A>C / A>T DTD0003 GENEPOLY rs2032582 MAFDBSNP A=0.3343/1674 DTD0003 GENEPOLY rs2032582 Allele A Digoxin Congestive Cardiac Insufficiency; Arrhythmias; Heart Failure Correlated with the increased drug serum concentrations in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Allele A Everolimus Breast Neoplasm Correlated with the increased likelihood of lymphopenia in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Allele A Mycophenolate mofetil Kidney Transplantation Correlated with the increased transplant rejection risk in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Allele A Cyclosporine Kidney Transplantation Correlated with the increased transplant rejection risk in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Allele A Atorvastatin Hypercholesterolemia Irrelevant to the dose decrease or drug switching risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs2032582 Allele A Simvastatin Hypercholesterolemia Irrelevant to the dose decrease or drug switching risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs2032582 Allele A Tacrolimus Kidney Transplantation Irrelevant to the dose-adjusted trough concentrations in patients (compare with allele C); Irrelevant to the drug trough concentrations in patients (compare with Allele C) aa DTD0003 GENEPOLY rs2032582 Allele A Tacrolimus Hemopoietic Stem Cell Transplant Irrelevant to the drug clearance in patients (compare with Allele C) aa DTD0003 GENEPOLY rs2032582 Allele A Tacrolimus Liver Transplantation Irrelevant to the drug metabolism in patients (compare with Allele C) aa DTD0003 GENEPOLY rs2032582 Allele C Atorvastatin Coronary Artery Disease Correlated with the increased drug-induced liver injury risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs2032582 Allele C Sirolimus Kidney Transplantation Irrelevant to the drug metabolism in patients (compare with Allele A) aa DTD0003 GENEPOLY rs2032582 Allele C Tacrolimus Kidney Transplantation Irrelevant to the drug metabolism in patients (compare with Allele A) aa DTD0003 GENEPOLY rs2032582 Allele C Carbamazepine Epilepsy Irrelevant to the drug metabolism in patients (compare with Allele A); Irrelevant to the increased drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs2032582 Allele C Pravastatin Hyperlipoproteinemia Irrelevant to the drug response in patients (compare with allele A) aa DTD0003 GENEPOLY rs2032582 Allele C Valproic acid Epilepsy Irrelevant to the increased drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs2032582 Allele C Phenytoin Epilepsy Irrelevant to the increased drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs2032582 Allele C Phenobarbital Epilepsy Irrelevant to the increased drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs2032582 Allele T Carbamazepine Epilepsy Correlated with the drug-resistant phenotype in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Allele T Valproic acid Epilepsy Correlated with the drug-resistant phenotype in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Allele T Phenytoin Epilepsy Correlated with the drug-resistant phenotype in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Allele T Atorvastatin Hypercholesterolemia Correlated with the increased drug response in patients (compare with allele A); Correlated with the increased drug response in patients(compare with allele C) aa DTD0003 GENEPOLY rs2032582 Allele T Clopidogrel Coronary Artery Disease Correlated with the increased Hemorrhage risk in patients (compare with allele A) aa DTD0003 GENEPOLY rs2032582 Genotype AA Doxorubicin Breast Neoplasm Correlated with the decreased drug metabolism in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Genotype AA Doxorubicin Leukemia Correlated with the decreased drug metabolism in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Genotype AA Anastrozole Breast Neoplasm Correlated with the increased drug concentrations in patients (compare with genotypes AC + CC) aa DTD0003 GENEPOLY rs2032582 Genotype AA Tramadol Pain Correlated with the increased drug exposure (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Genotype AA Cyclosporine Ulcerative Colitis Correlated with the increased drug resistance risk in patients (compare with genotypes CC + AC) aa DTD0003 GENEPOLY rs2032582 Genotype AA Cyclosporine Myasthenia Gravis Correlated with the increased drug trough blood concentration in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Genotype AA Carbamazepine Epilepsy Correlated with the increased likelihood of drug resistance in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Genotype AA Fentanyl Postoperative Pain Correlated with the increased likelihood of respiratory insufficiency in patients (compare with Genotype AA) aa DTD0003 GENEPOLY rs2032582 Genotype AA Simvastatin Hypercholesterolemia Correlated with the increased reduction in total cholesterol in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Genotype AA Mitoxantrone Breast Neoplasm Correlated with the increased sensitivity to drug in vitro (compare with genotypes CC + AC) aa DTD0003 GENEPOLY rs2032582 Genotype AA Daunorubicin Acute Myeloid Leukemia Irrelevant to the drug response in patients (compare with genotypes AC + CC) aa DTD0003 GENEPOLY rs2032582 Genotype AA Cytarabine Acute Myeloid Leukemia Irrelevant to the drug response in patients (compare with genotypes AC + CC) aa DTD0003 GENEPOLY rs2032582 Genotype AC Methadone Opioid-Related Disorders Correlated with the increased drug concentrations in patients (compare with genotypes AA + CC) aa DTD0003 GENEPOLY rs2032582 Genotype AC Simvastatin Hypercholesterolemia Correlated with the increased reduction in total cholesterol in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Genotype AT Tacrolimus Kidney Transplantation Irrelevant to the drug clearance in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Genotype AT Cyclosporine Kidney Transplantation Irrelevant to the drug clearance in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Genotype CC Methadone Opioid-Related Disorders Correlated with the decreased drug clearance in patients (compare with genotypes AC + Ct) aa DTD0003 GENEPOLY rs2032582 Genotype CC Rivaroxaban Healthy Individuals Correlated with the decreased drug exposure in healthy individuals (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2032582 Genotype CC Dabigatran Healthy Individuals Correlated with the decreased drug exposure in healthy individuals (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2032582 Genotype CC Verapamil Healthy Individuals Correlated with the decreased drug metabolism in healthy individuals (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2032582 Genotype CC Cytarabine Acute Multiple Myeloma Correlated with the decreased survival in patients (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2032582 Genotype CC Cyclosporine Cystic Fibrosis Correlated with the increased drug clearance in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032582 Genotype CC Dicloxacillin Cystic Fibrosis Correlated with the increased drug clearance in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032582 Genotype CC Digoxin Congestive Cardiac Insufficiency; Arrhythmias; Heart Failure Correlated with the increased drug metabolism (compare with genotype AA) aa DTD0003 GENEPOLY rs2032582 Genotype CC Temsirolimus Urinary Bladder Neoplasm Correlated with the increased drug metabolism in patients (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2032582 Genotype CC Atorvastatin Hypercholesterolemia Correlated with the increased drug response in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032582 Genotype CC Pravastatin Acute Coronary Syndrome Correlated with the increased percent reduction in LDL-cholesterol in patients aa DTD0003 GENEPOLY rs2032582 Genotypes AA + AC Atorvastatin Hypercholesterolemia Correlated with the increased drug response in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Genotypes AA + AC Cytarabine Acute Myeloid Leukemia Irrelevant to the increased overall survival in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Genotypes AA + AT Sunitinib Renal Cell Carcinoma Correlated with the decreased overall survival in patients (compare with genotypes AC + CC) aa DTD0003 GENEPOLY rs2032582 Genotypes AA + AT Paclitaxel Ovarian Neoplasm Correlated with the increased drug response in patients (compare with genotypes AC + CC) aa DTD0003 GENEPOLY rs2032582 Genotypes AA + TT Tacrolimus Nephrotic Syndrome Correlated with the increased drug response in patients (compare with genotypes CC + CT) aa DTD0003 GENEPOLY rs2032582 Genotypes AC + CC Cyclosporine Kidney Transplantation Correlated with the decreased drug dose-adjusted trough concentrations as in patients (compare with genotypes AA + Ct); Correlated with the increased drug dose in patients (compare with genotypes AA + Ct) aa DTD0003 GENEPOLY rs2032582 Genotypes AC + CC Ritonavir HIV Infection Correlated with the drug concentrations in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032582 Genotypes AC + CC Tacrolimus Kidney Transplantation Correlated with the increased drug dose-adjusted trough concentrations in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032582 Genotypes AC + CC Fentanyl Neoplasm Correlated with the increased likelihood of constipation in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032582 Genotypes AC + CT Tacrolimus Kidney Transplantation Correlated with the increased drug trough concentrations in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Genotypes CC + CT Fentanyl Neoplasm Correlated with the increased likelihood of constipation in patients (compare with Genotype TT) aa DTD0003 GENEPOLY rs2032582 Genotypes CC + CT Tacrolimus Kidney Transplantation Irrelevant to the drug metabolism in patients (compare with genotypes AC + At) aa DTD0003 GENEPOLY rs2032582 Genotypes CT + TT Doxorubicin Breast Neoplasm Correlated with the decreased survival in patients(compare with Genotypes AC + CC) aa DTD0003 GENEPOLY rs2032582 Genotypes CT + TT Cyclophosphamide Breast Neoplasm Correlated with the decreased survival in patients(compare with Genotypes AC + CC) aa DTD0003 GENEPOLY rs2032582 Allele A Clomipramine Depression Correlated with the increased suicidal ideation risk in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Allele A Nefazodone Depression Correlated with the increased suicidal ideation risk in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Allele A Fluoxetine Depressive Disorder Correlated with the increased drug response in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Allele C Fluoxetine Depressive Disorder Irrelevant to the increased fluoxetine/in patients (S)-norfluoxetine ratio in patients (compare with Allele A) aa DTD0003 GENEPOLY rs2032582 Allele A Venlafaxine Depression Correlated with the increased suicidal ideation risk in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Genotype AA Nevirapine HIV Infection Irrelevant to the drug metabolism in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Genotype AA Dexrazoxane Acute Myeloid Leukemia Irrelevant to the drug response in patients (compare with genotypes AC + CC) aa DTD0003 GENEPOLY rs2032582 Allele A Efavirenz HIV Infection Correlated with the decreased likelihood of emerging viral drug resistance in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Genotype AA Efavirenz HIV Infection Correlated with the decreased drug concentrations in patients (compare with genotypes AC + CC); Irrelevant to the drug metabolism in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Genotypes AT + CT Efavirenz HIV Infection Irrelevant to the increased drug plasma exposure in patients (compare with genotypes CC + CT) aa DTD0003 GENEPOLY rs2032582 Genotypes AC + CT Modafinil Narcolepsy Correlated with the increased drug response in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2032582 Allele A Paroxetine Depression Correlated with the increased suicidal ideation risk in patients (compare with allele C) aa DTD0003 GENEPOLY rs2032582 Genotype AA Idarubicin Acute Myeloid Leukemia Irrelevant to the drug response in patients (compare with genotypes AC + CC) aa DTD0003 GENEPOLY rs2032582 Genotype CC Capecitabine Colorectal Neoplasm Correlated with the increased hand-foot syndrome risk in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032582 Allele A Lithium Depression Correlated with the increased suicidal ideation risk in patients (compare with allele C) ac DTD0003 GENEPOLY rs2032582 Allele A Antiepileptics Epilepsy Irrelevant to the likelihood of drug resistance in patients (compare with Allele C) ac DTD0003 GENEPOLY rs2032582 Allele C Antiepileptics Epilepsy Irrelevant to the drug response in patients (compare with Allele A) ac DTD0003 GENEPOLY rs2032582 Genotype AA Antiepileptics Epilepsy Correlated with the increased likelihood of drug resistance in patients (compare with genotype CC) ac DTD0003 GENEPOLY rs2032582 Genotype CC Anthracyclines Breast Neoplasm Correlated with the increased drug resistance risk in patients (compare with genotype AC) ac DTD0003 GENEPOLY rs2032583 SITEOFGP chr7:87531245 (GRCh38.p12) DTD0003 GENEPOLY rs2032583 GPD_TYPE SNP DTD0003 GENEPOLY rs2032583 ALLDBSNP A>G DTD0003 GENEPOLY rs2032583 MAFDBSNP G=0.1454/728 DTD0003 GENEPOLY rs2032583 Allele G Citalopram Major Depressive Disorder Correlated with the increased likelihood of adverse effects in patients (compare with Allele A) aa DTD0003 GENEPOLY rs2032583 Allele G Fluvoxamine Major Depressive Disorder Correlated with the increased likelihood of adverse effects in patients (compare with Allele A) aa DTD0003 GENEPOLY rs2032583 Genotype GG Citalopram Bipolar Disorder Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs2032583 Genotypes AG + GG Citalopram Depression Correlated with the increased likelihood of remission in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032583 Genotypes AG + GG Fluvoxamine Depression Correlated with the increased likelihood of remission in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032583 Genotype GG Amitriptyline Bipolar Disorder Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs2032583 Genotypes AG + GG Amitriptyline Depression Correlated with the increased likelihood of remission in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032583 Allele G Venlafaxine Major Depressive Disorder Correlated with the increased likelihood of adverse effects in patients (compare with Allele A) aa DTD0003 GENEPOLY rs2032583 Genotype GG Venlafaxine Bipolar Disorder Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs2032583 Genotypes AG + GG Venlafaxine Depression Correlated with the increased likelihood of remission in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032583 Allele G Sertraline Major Depressive Disorder Correlated with the increased likelihood of adverse effects in patients (compare with Allele A) aa DTD0003 GENEPOLY rs2032583 Genotype GG Sertraline Bipolar Disorder Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs2032583 Genotypes AG + GG Sertraline Depression Correlated with the increased likelihood of remission in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032583 Genotype GG Escitalopram Bipolar Disorder Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs2032583 Allele G Paroxetine Major Depressive Disorder Correlated with the increased likelihood of adverse effects in patients (compare with Allele A) aa DTD0003 GENEPOLY rs2032583 Genotype GG Paroxetine Bipolar Disorder Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs2032583 Genotypes AG + GG Paroxetine Depression Correlated with the increased likelihood of remission in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs2032583 Genotype GG Nortriptyline Bipolar Disorder Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs2032583 Genotype GG Trimipramine Bipolar Disorder Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0003 GENEPOLY rs2032583 Genotype GG Selective serotonin reuptake inhibitors Bipolar Disorder Irrelevant to the drug response in patients (compare with genotypes AA + AG) ac DTD0003 GENEPOLY rs2032583 Genotypes AG + GG Antidepressants Depression Correlated with the increased likelihood of remission in patients (compare with genotype AA) ac DTD0003 GENEPOLY rs2229109 SITEOFGP chr7:87550493 (GRCh38.p12) DTD0003 GENEPOLY rs2229109 GPD_TYPE SNP DTD0003 GENEPOLY rs2229109 ALLDBSNP C>A / C>T DTD0003 GENEPOLY rs2229109 MAFDBSNP T=0.0126/63 DTD0003 GENEPOLY rs2229109 Allele C Dexamethasone Multiple Myeloma Irrelevant to the anemia, neutropenia or thrombocytopenia risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs2229109 Allele C Lenalidomide Multiple Myeloma Irrelevant to the anemia, neutropenia or thrombocytopenia risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs2229109 Genotype CT Vincristine Non-Hodgkin Lymphoma Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Doxorubicin Non-Hodgkin Lymphoma Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Cyclophosphamide Non-Hodgkin Lymphoma Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased drug resistance in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Vincristine Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased drug resistance in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Doxorubicin Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased drug resistance in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Prednisolone Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased drug resistance in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Dexamethasone Multiple Myeloma Correlated with the increased likelihood of progression-free survival in patients (compare with genotype CC); Irrelevant to the likelihood of overall survival in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Lenalidomide Multiple Myeloma Correlated with the increased likelihood of progression-free survival in patients (compare with genotype CC); Irrelevant to the likelihood of overall survival in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Valganciclovir Kidney Transplantation Correlated with the increased neutropenia risk in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotypes CT + TT Tacrolimus Kidney Transplantation Correlated with the increased renal transplant failure risk in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Prednisone Non-Hodgkin Lymphoma Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Rituximab Non-Hodgkin Lymphoma Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Bleomycin Non-Hodgkin Lymphoma Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2229109 Genotype CT Vindesine Non-Hodgkin Lymphoma Correlated with the increased diarrhea and vomiting risk in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2235015 SITEOFGP chr7:87570248 (GRCh38.p12) DTD0003 GENEPOLY rs2235015 GPD_TYPE SNP DTD0003 GENEPOLY rs2235015 ALLDBSNP C>A / C>T DTD0003 GENEPOLY rs2235015 MAFDBSNP A=0.2157/1080 DTD0003 GENEPOLY rs2235015 Allele A Citalopram Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235015 Genotype AA Citalopram Depression Irrelevant to the drug response in patients (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2235015 Allele A Amitriptyline Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235015 Genotype AA Amitriptyline Depression Irrelevant to the drug response in patients (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2235015 Allele A Venlafaxine Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235015 Genotype AA Venlafaxine Depression Irrelevant to the drug response in patients (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2235015 Genotype AA Sertraline Depression Irrelevant to the drug response in patients (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2235015 Genotype AA Escitalopram Depression Irrelevant to the drug response in patients (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2235015 Allele A Paroxetine Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235015 Genotype AA Paroxetine Depression Irrelevant to the drug response in patients (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2235015 Genotype AA Nortriptyline Depression Irrelevant to the drug response in patients (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2235015 Genotype AA Trimipramine Depression Irrelevant to the drug response in patients (compare with genotypes AA + AC) aa DTD0003 GENEPOLY rs2235015 Genotype AA Selective serotonin reuptake inhibitors Depression Irrelevant to the drug response in patients (compare with genotypes AA + AC) ac DTD0003 GENEPOLY rs2235040 SITEOFGP chr7:87536434 (GRCh38.p12) DTD0003 GENEPOLY rs2235040 GPD_TYPE SNP DTD0003 GENEPOLY rs2235040 ALLDBSNP C>A / C>G / C>T DTD0003 GENEPOLY rs2235040 MAFDBSNP T=0.1396/699 DTD0003 GENEPOLY rs2235040 Allele T Citalopram Major Depressive Disorder Correlated with the increased likelihood of adverse effects in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235040 Allele T Fluvoxamine Major Depressive Disorder Correlated with the increased likelihood of adverse effects in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235040 Allele T Citalopram Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235040 Genotype CT Imatinib Gastrointestinal Stromal Tumors Correlated with the decreased periorbital edema risk in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs2235040 Allele T Amitriptyline Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235040 Allele T Venlafaxine Major Depressive Disorder Correlated with the increased likelihood of adverse effects in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235040 Allele T Venlafaxine Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235040 Allele T Sertraline Major Depressive Disorder Correlated with the increased likelihood of adverse effects in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235040 Allele T Paroxetine Major Depressive Disorder Correlated with the increased likelihood of adverse effects in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235040 Allele T Paroxetine Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235047 SITEOFGP chr7:87509216 (GRCh38.p12) DTD0003 GENEPOLY rs2235047 GPD_TYPE SNP DTD0003 GENEPOLY rs2235047 ALLDBSNP A>C / A>G DTD0003 GENEPOLY rs2235047 MAFDBSNP C=0.1745/874 DTD0003 GENEPOLY rs2235047 Allele C Daunorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele A) aa DTD0003 GENEPOLY rs2235047 Allele C Doxorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele A) aa DTD0003 GENEPOLY rs2235047 Allele C Anthracyclines Neoplasm Correlated with the increased likelihood of cardiotoxicity in patients (compare with Allele A) ac DTD0003 GENEPOLY rs2235067 SITEOFGP chr7:87520606 (GRCh38.p12) DTD0003 GENEPOLY rs2235067 GPD_TYPE SNP DTD0003 GENEPOLY rs2235067 ALLDBSNP C>T DTD0003 GENEPOLY rs2235067 MAFDBSNP T=0.1338/670 DTD0003 GENEPOLY rs2235067 Allele T Citalopram Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235067 Allele T Amitriptyline Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235067 Allele T Venlafaxine Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs2235067 Allele T Paroxetine Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs28401781 SITEOFGP chr7:87519012 (GRCh38.p12) DTD0003 GENEPOLY rs28401781 GPD_TYPE SNP DTD0003 GENEPOLY rs28401781 ALLDBSNP C>T DTD0003 GENEPOLY rs28401781 MAFDBSNP T=0.1474/738 DTD0003 GENEPOLY rs28401781 Allele T Citalopram Major Depressive Disorder Correlated with the increased drug response in patients (compare with allele C) aa DTD0003 GENEPOLY rs28401781 Allele T Fluoxetine Major Depressive Disorder Correlated with the increased drug response in patients (compare with allele C) aa DTD0003 GENEPOLY rs28401781 Allele T Sertraline Major Depressive Disorder Correlated with the increased drug response in patients (compare with allele C) aa DTD0003 GENEPOLY rs28401781 Allele T Paroxetine Major Depressive Disorder Correlated with the increased drug response in patients (compare with allele C) aa DTD0003 GENEPOLY rs3213619 SITEOFGP chr7:87600877 (GRCh38.p12) DTD0003 GENEPOLY rs3213619 GPD_TYPE SNP DTD0003 GENEPOLY rs3213619 ALLDBSNP A>G DTD0003 GENEPOLY rs3213619 MAFDBSNP G=0.0543/272 DTD0003 GENEPOLY rs3213619 Allele G Atenolol Hypertension Correlated with the increased hypercholesterolemia risk in patients (compare with Allele A) aa DTD0003 GENEPOLY rs3789243 SITEOFGP chr7:87591570 (GRCh38.p12) DTD0003 GENEPOLY rs3789243 GPD_TYPE SNP DTD0003 GENEPOLY rs3789243 ALLDBSNP A>G DTD0003 GENEPOLY rs3789243 MAFDBSNP A=0.4635/2321 DTD0003 GENEPOLY rs3789243 Allele A Antiepileptics Epilepsy Irrelevant to the likelihood of drug resistance in patients (compare with Allele G) ac DTD0003 GENEPOLY rs3842 SITEOFGP chr7:87504050 (GRCh38.p12) DTD0003 GENEPOLY rs3842 GPD_TYPE SNP DTD0003 GENEPOLY rs3842 ALLDBSNP T>C DTD0003 GENEPOLY rs3842 MAFDBSNP C=0.1879/941 DTD0003 GENEPOLY rs3842 Allele C Efavirenz HIV Infection Correlated with the drug concentrations in patients (compare with Allele T); Correlated with the drug metabolism in patients (compare with Allele T); Irrelevant to the drug concentrations in patients (compare with Allele T) aa DTD0003 GENEPOLY rs3842 Genotypes CC + CT Efavirenz HIV Infection Correlated with the increased drug accumulation in patients (compare with Genotype TT); Correlated with the increased drug trough concentration in patients (compare with Genotype TT) aa DTD0003 GENEPOLY rs4148737 SITEOFGP chr7:87541836 (GRCh38.p12) DTD0003 GENEPOLY rs4148737 GPD_TYPE SNP DTD0003 GENEPOLY rs4148737 ALLDBSNP T>C DTD0003 GENEPOLY rs4148737 MAFDBSNP C=0.3790/1898 DTD0003 GENEPOLY rs4148737 Allele C Methotrexate Osteosarcoma Correlated with the increased death risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148737 Allele C Vincristine Osteosarcoma Correlated with the increased death risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148737 Allele C Cisplatin Osteosarcoma Correlated with the increased death risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148737 Allele C Doxorubicin Osteosarcoma Correlated with the increased death risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148737 Allele C Cyclophosphamide Osteosarcoma Correlated with the increased death risk in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148737 Allele C Doxorubicin Breast Neoplasm Irrelevant to the drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148737 Allele C Cyclophosphamide Breast Neoplasm Irrelevant to the drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148738 SITEOFGP chr7:87533733 (GRCh38.p12) DTD0003 GENEPOLY rs4148738 GPD_TYPE SNP DTD0003 GENEPOLY rs4148738 ALLDBSNP C>T DTD0003 GENEPOLY rs4148738 MAFDBSNP C=0.3814/1910 DTD0003 GENEPOLY rs4148738 Genotypes CT + TT Dabigatran Atrial Fibrillation Correlated with the decreased drug concentrations in patients (compare with genotype CC) aa DTD0003 GENEPOLY rs4148739 SITEOFGP chr7:87531733 (GRCh38.p12) DTD0003 GENEPOLY rs4148739 GPD_TYPE SNP DTD0003 GENEPOLY rs4148739 ALLDBSNP T>C DTD0003 GENEPOLY rs4148739 MAFDBSNP C=0.1454/728 DTD0003 GENEPOLY rs4148739 Allele C Citalopram Major Depressive Disorder Correlated with the increased drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148739 Allele C Citalopram Depression Correlated with the increased likelihood of remission in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148739 Genotype TT Carbamazepine Epilepsy Correlated with the decreased drug metabolism in patients (compare with genotype Ct) aa DTD0003 GENEPOLY rs4148739 Allele C Amitriptyline Depression Correlated with the increased likelihood of remission in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148739 Allele C Fluoxetine Major Depressive Disorder Correlated with the increased drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148739 Allele C Fluoxetine Depression Correlated with the increased likelihood of remission in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148739 Allele C Venlafaxine Major Depressive Disorder Correlated with the increased drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148739 Allele C Venlafaxine Depression Correlated with the increased likelihood of remission in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148739 Allele C Sertraline Major Depressive Disorder Correlated with the increased drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148739 Allele C Sertraline Depression Correlated with the increased likelihood of remission in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148739 Allele C Paroxetine Major Depressive Disorder Correlated with the increased drug response in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148739 Allele C Paroxetine Depression Correlated with the increased likelihood of remission in patients (compare with Allele T) aa DTD0003 GENEPOLY rs4148740 SITEOFGP chr7:87522787 (GRCh38.p12) DTD0003 GENEPOLY rs4148740 GPD_TYPE SNP DTD0003 GENEPOLY rs4148740 ALLDBSNP A>G DTD0003 GENEPOLY rs4148740 MAFDBSNP G=0.1446/724 DTD0003 GENEPOLY rs4148740 Allele G Citalopram Depression Correlated with the increased likelihood of remission in patients (compare with Allele A) aa DTD0003 GENEPOLY rs4148740 Genotype AG Carbamazepine Epilepsy Correlated with the increased drug metabolism in patients (compare with genotype AA) aa DTD0003 GENEPOLY rs4148740 Allele G Amitriptyline Depression Correlated with the increased likelihood of remission in patients (compare with Allele A) aa DTD0003 GENEPOLY rs4148740 Allele G Venlafaxine Depression Correlated with the increased likelihood of remission in patients (compare with Allele A) aa DTD0003 GENEPOLY rs4148740 Allele G Paroxetine Depression Correlated with the increased likelihood of remission in patients (compare with Allele A) aa DTD0003 GENEPOLY rs4728709 SITEOFGP chr7:87604286 (GRCh38.p12) DTD0003 GENEPOLY rs4728709 GPD_TYPE SNP DTD0003 GENEPOLY rs4728709 ALLDBSNP G>A DTD0003 GENEPOLY rs4728709 MAFDBSNP A=0.1769/886 DTD0003 GENEPOLY rs4728709 Allele A Vincristine Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased neurotoxicity syndromes risk in patients (compare with allele G) aa DTD0003 GENEPOLY rs7787082 SITEOFGP chr7:87527735 (GRCh38.p12) DTD0003 GENEPOLY rs7787082 GPD_TYPE SNP DTD0003 GENEPOLY rs7787082 ALLDBSNP G>A DTD0003 GENEPOLY rs7787082 MAFDBSNP A=0.3778/1892 DTD0003 GENEPOLY rs7787082 Allele A Citalopram Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs7787082 Allele G Clozapine Schizophrenia Correlated with the decreased drug response in patients (compare with Allele A) aa DTD0003 GENEPOLY rs7787082 Allele A Amitriptyline Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs7787082 Allele A Venlafaxine Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs7787082 Allele A Paroxetine Depression Correlated with the increased likelihood of remission in patients (compare with allele C) aa DTD0003 GENEPOLY rs9282564 SITEOFGP chr7:87600124 (GRCh38.p12) DTD0003 GENEPOLY rs9282564 GPD_TYPE SNP DTD0003 GENEPOLY rs9282564 ALLDBSNP T>A / T>C / T>G DTD0003 GENEPOLY rs9282564 MAFDBSNP C=0.0260/130 DTD0003 GENEPOLY rs9282564 Allele C Methadone Opioid-Related Disorders Correlated with the decreased drug clearance in patients (compare with Allele T) aa DTD0003 GENEPOLY rs9282564 Allele T Tacrolimus Kidney Transplantation Irrelevant to the drug trough concentration in patients (compare with allele C) aa DTD0003 GENEPOLY rs9282564 Genotype CT Tacrolimus Lung Transplantation Correlated with the increased drug concentrations in patients (compare with Genotype TT) aa DTD0003 GENEPOLY rs9282564 Genotypes CC + CT Tacrolimus Kidney Transplantation Correlated with the decreased drug dose-adjusted trough concentrations in patients (compare with Genotype TT) aa DTD0003 GENEPOLY rs9282564 Genotypes CC + CT Morphine Neoplasm Correlated with the increased respiratory insufficiency risk (compare with Genotype TT) aa DTD0004 TRANSPID DTD0004 DTD0004 GENENAME ABCG2 DTD0004 PROTNAME Breast cancer resistance protein DTD0004 GENEDBID 9429 DTD0004 UNIPROID Q9UNQ0 DTD0004 GENEPOLY rs1061018 SITEOFGP chr4:88121701 (GRCh38.p12) DTD0004 GENEPOLY rs1061018 GPD_TYPE SNP DTD0004 GENEPOLY rs1061018 ALLDBSNP A>G DTD0004 GENEPOLY rs1061018 MAFDBSNP N.A. DTD0004 GENEPOLY rs1061018 Allele G Nilotinib Chronic myelogenous leukaemia Correlated with the increased sensitivity of drug in K562 cells (compare with Allele A) aa DTD0004 GENEPOLY rs1061018 Allele G Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the increased sensitivity of drug in K562 cells (compare with Allele A) aa DTD0004 GENEPOLY rs1061018 Allele G Dasatinib Bacterial infections Correlated with the increased sensitivity of drug in K562 cells (compare with Allele A) aa DTD0004 GENEPOLY rs12505410 SITEOFGP chr4:88109689 (GRCh38.p12) DTD0004 GENEPOLY rs12505410 GPD_TYPE SNP DTD0004 GENEPOLY rs12505410 ALLDBSNP T>C / T>G DTD0004 GENEPOLY rs12505410 MAFDBSNP G=0.2794/1399 DTD0004 GENEPOLY rs12505410 Genotypes GG + GT Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the increased drug response in patients (compare with Genotype TT) aa DTD0004 GENEPOLY rs13120400 SITEOFGP chr4:88112375 (GRCh38.p12) DTD0004 GENEPOLY rs13120400 GPD_TYPE SNP DTD0004 GENEPOLY rs13120400 ALLDBSNP T>C DTD0004 GENEPOLY rs13120400 MAFDBSNP C=0.1052/527 DTD0004 GENEPOLY rs13120400 Genotype CC Methotrexate Psoriasis Correlated with the increased drug response in patients (compare with genotypes tt + Ct) aa DTD0004 GENEPOLY rs13120400 Genotypes CC + CT Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the increased drug response in patients (compare with Genotype TT) aa DTD0004 GENEPOLY rs13120400 Genotype CC Exjade Beta-Thalassemia Correlated with the increased drug concentrations in patients (compare with Genotypes CT + TT) ac DTD0004 GENEPOLY rs13120400 Genotypes CT + TT Exjade Beta-Thalassemia Correlated with the increased drug exposure in patients (compare with genotype CC) ac DTD0004 GENEPOLY rs17731538 SITEOFGP chr4:88134227 (GRCh38.p12) DTD0004 GENEPOLY rs17731538 GPD_TYPE SNP DTD0004 GENEPOLY rs17731538 ALLDBSNP G>A DTD0004 GENEPOLY rs17731538 MAFDBSNP A=0.0960/481 DTD0004 GENEPOLY rs17731538 Genotype GG Methotrexate Psoriasis Correlated with the increased drug response in patients (compare with allele AG) aa DTD0004 GENEPOLY rs2199939 SITEOFGP chr8:40053975 (GRCh38.p12) DTD0004 GENEPOLY rs2199939 GPD_TYPE SNP DTD0004 GENEPOLY rs2199939 ALLDBSNP C>T DTD0004 GENEPOLY rs2199939 MAFDBSNP T=0.0946/474 DTD0004 GENEPOLY rs2199939 Genotypes CT + TT Rosuvastatin Hypercholesterolemia Correlated with the increased drug response (compare with genotype CC) aa DTD0004 GENEPOLY rs2231135 SITEOFGP chr4:88158842 (GRCh38.p12) DTD0004 GENEPOLY rs2231135 GPD_TYPE SNP DTD0004 GENEPOLY rs2231135 ALLDBSNP A>G DTD0004 GENEPOLY rs2231135 MAFDBSNP G=0.0333/167 DTD0004 GENEPOLY rs2231135 Genotype AG Methotrexate Osteosarcoma Correlated with the increased mucositis risk in patients (compare with genotype AA) aa DTD0004 GENEPOLY rs2231137 SITEOFGP chr4:88139962 (GRCh38.p12) DTD0004 GENEPOLY rs2231137 GPD_TYPE SNP DTD0004 GENEPOLY rs2231137 ALLDBSNP C>T DTD0004 GENEPOLY rs2231137 MAFDBSNP T=0.1575/789 DTD0004 GENEPOLY rs2231137 Allele T Nilotinib Chronic myelogenous leukaemia Correlated with the increased sensitivity to drug in K562 cells (compare with allele C) aa DTD0004 GENEPOLY rs2231137 Allele T Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the increased sensitivity to drug in K562 cells (compare with allele C) aa DTD0004 GENEPOLY rs2231137 Allele T Dasatinib Bacterial infections Correlated with the increased sensitivity to drug in K562 cells (compare with allele C) aa DTD0004 GENEPOLY rs2231137 Genotypes CT + TT Irinotecan Non-Small-Cell Lung Carcinoma Correlated with the increased diarrhea risk in patients (compare with genotype CC); Irrelevant to the neutropenia in patients (compare with genotype CC) aa DTD0004 GENEPOLY rs2231142 SITEOFGP chr4:88131171 (GRCh38.p12) DTD0004 GENEPOLY rs2231142 GPD_TYPE SNP DTD0004 GENEPOLY rs2231142 ALLDBSNP G>C / G>T DTD0004 GENEPOLY rs2231142 MAFDBSNP T=0.1194/598 DTD0004 GENEPOLY rs2231142 Allele G Lamotrigine Epilepsy Irrelevant to the drug concentrations in patients (compare with Allele T); Irrelevant to the drug response in patients (compare with Allele T) aa DTD0004 GENEPOLY rs2231142 Allele G Methotrexate Rheumatoid Arthritis Irrelevant to the drug discontinuation in patients (compare with Allele T) aa DTD0004 GENEPOLY rs2231142 Allele G Gemcitabine Non-Small-Cell Lung Carcinoma Irrelevant to the severity of neutropenia in patients (compare with Allele T) aa DTD0004 GENEPOLY rs2231142 Allele T Allopurinol Gout Correlated with the decreased drug response in patients (compare with allele G); Correlated with the increased drug dose in patients (compare with allele G) aa DTD0004 GENEPOLY rs2231142 Allele T Rosuvastatin Hypercholesterolemia Correlated with the decreased LDL-C in patients (compare with allele G); Correlated with the increased drug plasma concentrations in patients (compare with allele G); Correlated with the increased drug response in patients (compare with allele G); Correlated with the increased reduction in low-density lipoprotein cholesterol (LDL-C) level in patients (compare with allele G) aa DTD0004 GENEPOLY rs2231142 Allele T Lamotrigine Epilepsy Correlated with the increased drug concentrations in patients (compare with allele G) aa DTD0004 GENEPOLY rs2231142 Allele T Rosuvastatin Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with allele G) aa DTD0004 GENEPOLY rs2231142 Allele T Nilotinib Chronic myelogenous leukaemia Correlated with the increased sensitivity to drug in K562 cells (compare with allele G) aa DTD0004 GENEPOLY rs2231142 Allele T Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the increased sensitivity to drug in K562 cells (compare with allele G) aa DTD0004 GENEPOLY rs2231142 Allele T Dasatinib Bacterial infections Correlated with the increased sensitivity to drug in K562 cells (compare with allele G) aa DTD0004 GENEPOLY rs2231142 Allele T Gefitinib Lung Neoplasm Irrelevant to the increased drug toxicity risk in patients (compare with allele G) aa DTD0004 GENEPOLY rs2231142 Genotype GG Leucovorin Colorectal Neoplasm Correlated with the decreased drug response in patients (compare with Genotypes GT + TT) aa DTD0004 GENEPOLY rs2231142 Genotype GG Fluorouracil Colorectal Neoplasm Correlated with the decreased drug response in patients (compare with Genotypes GT + TT); Irrelevant to the drug response in patients (compare with Genotypes GT + TT) aa DTD0004 GENEPOLY rs2231142 Genotype GG Oxaliplatin Colorectal Neoplasm Correlated with the decreased drug response in patients (compare with Genotypes GT + TT); Irrelevant to the drug response in patients (compare with Genotypes GT + TT) aa DTD0004 GENEPOLY rs2231142 Genotype GG Rosuvastatin Hypercholesterolemia Correlated with the decreased percentage change in LDL-cholesterol levels in patients (compare with Genotype TT) aa DTD0004 GENEPOLY rs2231142 Genotype GG Rosuvastatin Healthy Individuals Correlated with the decreased the total area under the plasma concentration-time curve (AUC) of drug in healthy individuals (compare with genotypes tt + Gt) aa DTD0004 GENEPOLY rs2231142 Genotype GG Irinotecan Colorectal Neoplasm Irrelevant to the drug response in patients (compare with Genotypes GT + TT) aa DTD0004 GENEPOLY rs2231142 Genotype GG Gefitinib Non-Small-Cell Lung Carcinoma Irrelevant to the drug toxicity risk in patients (compare with Genotypes GT + TT); Irrelevant to the increased likelihood of drug toxicity in patients (compare with Genotypes GT + TT) aa DTD0004 GENEPOLY rs2231142 Genotype GT Imatinib Neoplasm Correlated with the decreased drug metabolism in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotype GT Fluorouracil Breast Neoplasm Correlated with the increased anemia risk in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotype GT Doxorubicin Breast Neoplasm Correlated with the increased anemia risk in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotype GT Cyclophosphamide Breast Neoplasm Correlated with the increased anemia risk in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotype GT Sulfasalazine Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotype GT Rosuvastatin Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotype GT Gefitinib Lung Neoplasm Correlated with the increased likelihood of diarrhea in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotype TT Sulfasalazine Healthy Individuals Correlated with the decreased drug clearance in healthy individuals (compare with genotypes GG + Gt) aa DTD0004 GENEPOLY rs2231142 Genotype TT Methotrexate Rheumatoid Arthritis Correlated with the decreased likelihood of adverse events in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotype TT Sunitinib Renal Cell Carcinoma Correlated with the decreased neutropenia risk in patients (compare with genotypes GG + Gt); Correlated with the increased drug toxicity risk in patients (compare with genotypes GG + Gt); Correlated with the increased hand-foot syndrome risk in patients (compare with genotypes GG + Gt); Correlated with the increased neutropenia risk in patients (compare with genotypes GG + Gt); Correlated with the increased thrombocytopenia risk in patients (compare with genotypes GG + Gt); Irrelevant to the anemia risk in patients (compare with genotypes GG + Gt) aa DTD0004 GENEPOLY rs2231142 Genotype TT Apixaban Atrial Fibrillation Correlated with the increased drug concentrations in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotype TT Lamotrigine Epilepsy Correlated with the increased drug concentrations in patients (compare with genotypes GG + Gt) aa DTD0004 GENEPOLY rs2231142 Genotype TT Dolutegravir HIV Infection Correlated with the increased drug concentrations in patients (compare with genotypes GG + Gt) aa DTD0004 GENEPOLY rs2231142 Genotype TT Fluvastatin Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with genotypes GG + Gt) aa DTD0004 GENEPOLY rs2231142 Genotype TT Simvastatin Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with genotypes GG + Gt) aa DTD0004 GENEPOLY rs2231142 Genotype TT Rosuvastatin Hypercholesterolemia Correlated with the increased drug plasma concentrations in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotype TT Rosuvastatin Healthy Individuals Correlated with the increased the total area under the plasma concentration-time curve (AUC) in healthy individuals (compare with genotypes GG + Gt) aa DTD0004 GENEPOLY rs2231142 Genotype TT Atorvastatin Healthy Individuals Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug in healthy individuals (compare with genotypes GG + Gt) aa DTD0004 GENEPOLY rs2231142 Genotypes GG + GT Apixaban Atrial Fibrillation Correlated with the increased drug clearance in patients (compare with Genotype TT) aa DTD0004 GENEPOLY rs2231142 Genotypes GT + TT Allopurinol Gout Correlated with the decreased drug response in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotypes GT + TT Lamotrigine Epilepsy Correlated with the increased drug concentrations in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotypes GT + TT Tenofovir HIV Infection Correlated with the increased drug concentrations in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotypes GT + TT Sunitinib Neoplasm Correlated with the increased drug exposure in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotypes GT + TT Sulfasalazine Rheumatoid Arthritis Correlated with the increased drug response in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotypes GT + TT Gemcitabine Non-Small-Cell Lung Carcinoma Correlated with the increased progression-free survival in patients (compare with genotype GG); Correlated with the increased severity of thrombocytopenia in patients (compare with genotype GG); Irrelevant to the overall survival in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotypes GT + TT Efavirenz HIV Infection Correlated with the increased abnormal dreams risk in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs2231142 Genotype GG Capecitabine Colorectal Neoplasm Correlated with the decreased drug response in patients (compare with Genotypes GT + TT) aa DTD0004 GENEPOLY rs2231142 Genotype TT Opioids Neoplasm Correlated with the increased drug response (compare with genotypes GG + Gt) ac DTD0004 GENEPOLY rs2725252 SITEOFGP chr4:88140758 (GRCh38.p12) DTD0004 GENEPOLY rs2725252 GPD_TYPE SNP DTD0004 GENEPOLY rs2725252 ALLDBSNP C>A / C>T DTD0004 GENEPOLY rs2725252 MAFDBSNP A=0.4145/2076 DTD0004 GENEPOLY rs2725252 Genotypes AC + CC Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the increased drug response in patients (compare with genotype AA) aa DTD0004 GENEPOLY rs3114020 SITEOFGP chr4:88162514 (GRCh38.p12) DTD0004 GENEPOLY rs3114020 GPD_TYPE SNP DTD0004 GENEPOLY rs3114020 ALLDBSNP T>C DTD0004 GENEPOLY rs3114020 MAFDBSNP C=0.4249/2128 DTD0004 GENEPOLY rs3114020 Genotypes CC + CT Lamotrigine Epilepsy Correlated with the increased drug concentrations in patients (compare with Genotype TT) aa DTD0004 GENEPOLY rs41282401 SITEOFGP chr4:88115014 (GRCh38.p12) DTD0004 GENEPOLY rs41282401 GPD_TYPE SNP DTD0004 GENEPOLY rs41282401 ALLDBSNP C>G DTD0004 GENEPOLY rs41282401 MAFDBSNP G=0.0002/1 DTD0004 GENEPOLY rs41282401 Allele C Nilotinib Chronic myelogenous leukaemia Correlated with the increased sensitivity to drug in K562 cells (compare with Allele G) aa DTD0004 GENEPOLY rs41282401 Allele C Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the increased sensitivity to drug in K562 cells (compare with Allele G) aa DTD0004 GENEPOLY rs41282401 Allele C Dasatinib Bacterial infections Correlated with the increased sensitivity to drug in K562 cells (compare with Allele G) aa DTD0004 GENEPOLY rs4148157 SITEOFGP chr4:88099782 (GRCh38.p12) DTD0004 GENEPOLY rs4148157 GPD_TYPE SNP DTD0004 GENEPOLY rs4148157 ALLDBSNP G>A DTD0004 GENEPOLY rs4148157 MAFDBSNP A=0.1006/504 DTD0004 GENEPOLY rs4148157 Genotypes AA + AG Topotecan Brain Neoplasm Correlated with the increased drug concentrations in patients (compare with genotype GG) aa DTD0004 GENEPOLY rs45605536 SITEOFGP chr4:88097518 (GRCh38.p12) DTD0004 GENEPOLY rs45605536 GPD_TYPE SNP DTD0004 GENEPOLY rs45605536 ALLDBSNP C>T DTD0004 GENEPOLY rs45605536 MAFDBSNP T=0.0018/9 DTD0004 GENEPOLY rs45605536 Allele T Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the increased sensitivity to drug in K562 cells (compare with allele C) aa DTD0004 GENEPOLY rs45605536 Allele T Dasatinib Bacterial infections Correlated with the increased sensitivity to drug in K562 cells (compare with allele C) aa DTD0004 GENEPOLY rs58818712 SITEOFGP chr4:88097526 (GRCh38.p12) DTD0004 GENEPOLY rs58818712 GPD_TYPE SNP DTD0004 GENEPOLY rs58818712 ALLDBSNP A>C DTD0004 GENEPOLY rs58818712 MAFDBSNP N.A. DTD0004 GENEPOLY rs58818712 Allele C Nilotinib Chronic myelogenous leukaemia Correlated with the increased sensitivity to drug in K562 cells (compare with Allele A) aa DTD0004 GENEPOLY rs58818712 Allele C Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the increased sensitivity to drug in K562 cells (compare with Allele A) aa DTD0004 GENEPOLY rs58818712 Allele C Dasatinib Bacterial infections Correlated with the increased sensitivity to drug in K562 cells (compare with Allele A) aa DTD0004 GENEPOLY rs7699188 SITEOFGP chr4:88174909 (GRCh38.p12) DTD0004 GENEPOLY rs7699188 GPD_TYPE SNP DTD0004 GENEPOLY rs7699188 ALLDBSNP G>A / G>C DTD0004 GENEPOLY rs7699188 MAFDBSNP A=0.2460/1232 DTD0004 GENEPOLY rs7699188 Allele A Irinotecan Colorectal Neoplasm Correlated with the increased grade 3-4 nonhematological toxicity risk in patients (compare with allele G); Correlated with the increased tumor response rate in patients (compare with allele G) aa DTD0004 GENEPOLY rs7699188 Allele A Fluorouracil Colorectal Neoplasm Correlated with the increased grade 3-4 nonhematological toxicity risk in patients (compare with allele G); Correlated with the increased tumor response rate in patients (compare with allele G) aa DTD0004 GENEPOLY rs7699188 Allele A Leucovorin Colorectal Neoplasm Correlated with the increased grade 3-4 nonhematological toxicity risk in patients (compare with allele G); Correlated with the increased tumor response rate in patients (compare with allele G) aa DTD0005 TRANSPID DTD0005 DTD0005 GENENAME SLC22A7 DTD0005 PROTNAME Organic anion transporter 2 DTD0005 GENEDBID 10864 DTD0005 UNIPROID Q9Y694 DTD0005 GENEPOLY rs2270860 SITEOFGP chr6:43302413 (GRCh38.p12) DTD0005 GENEPOLY rs2270860 GPD_TYPE SNP DTD0005 GENEPOLY rs2270860 ALLDBSNP C>T DTD0005 GENEPOLY rs2270860 MAFDBSNP T=0.4631/2319 DTD0005 GENEPOLY rs2270860 Genotype TT Capecitabine Colorectal Neoplasm Correlated with the increased likelihood of drug toxicity in patients (compare with genotypes CC + CT) aa DTD0005 GENEPOLY rs4149178 SITEOFGP chr6:43304450 (GRCh38.p12) DTD0005 GENEPOLY rs4149178 GPD_TYPE SNP DTD0005 GENEPOLY rs4149178 ALLDBSNP A>G DTD0005 GENEPOLY rs4149178 MAFDBSNP G=0.1897/950 DTD0005 GENEPOLY rs4149178 Genotypes AG + GG Capecitabine Colorectal Neoplasm Correlated with the decreased likelihood of diarrhea in patients (compare with genotype AA) aa DTD0006 TRANSPID DTD0006 DTD0006 GENENAME SLC22A2 DTD0006 PROTNAME Organic cation transporter 2 DTD0006 GENEDBID 6582 DTD0006 UNIPROID O15244 DTD0006 GENEPOLY rs316019 SITEOFGP chr6:160249250 (GRCh38.p12) DTD0006 GENEPOLY rs316019 GPD_TYPE SNP DTD0006 GENEPOLY rs316019 ALLDBSNP A>C DTD0006 GENEPOLY rs316019 MAFDBSNP A=0.1374/688 DTD0006 GENEPOLY rs316019 Allele A Cisplatin Neoplasm Correlated with the decreased ototoxicity risk in patients (compare with allele C) aa DTD0006 GENEPOLY rs316019 Allele A Daunorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele C) aa DTD0006 GENEPOLY rs316019 Allele A Doxorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele C) aa DTD0006 GENEPOLY rs316019 Allele A Metformin Healthy Individuals Irrelevant to the steady-state concentration of metformin in healthy individuals (compare with Allele C) aa DTD0006 GENEPOLY rs316019 Allele C Cisplatin Testicular Neoplasm Irrelevant to the likelihood of ototoxicity in patients (compare with Allele A) aa DTD0006 GENEPOLY rs316019 Genotype AC Cisplatin Neoplasm Correlated with the decreased nephrotoxicity risk in patients (compare with genotype CC) aa DTD0006 GENEPOLY rs316019 Genotype CC L-Tryptophan Depression Correlated with the increased drug clearance (compare with genotypes AA + AC) aa DTD0006 GENEPOLY rs316019 Genotype CC Metformin Healthy Individuals Correlated with the increased drug clearance in healthy individuals (compare with genotype AC) aa DTD0006 GENEPOLY rs316019 Genotype CC Cisplatin Neoplasm Irrelevant to the increased likelihood of nephrotoxicity in patients (compare with genotypes AA + AC) aa DTD0006 GENEPOLY rs316019 Allele A Anthracyclines Neoplasm Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C) ac DTD0006 GENEPOLY rs316019 Genotypes AA + AC Platinum compounds Non-Small-Cell Lung Carcinoma Correlated with the increased severity of drug toxicity in patients (compare with genotype CC); Correlated with the increased severity of toxic liver disease in patients (compare with genotype CC) ac DTD0007 TRANSPID DTD0007 DTD0007 GENENAME SLC47A1 DTD0007 PROTNAME Multidrug and toxin extrusion protein 1 DTD0007 GENEDBID 55244 DTD0007 UNIPROID Q96FL8 DTD0007 GENEPOLY rs2252281 SITEOFGP chr17:19533874 (GRCh38.p12) DTD0007 GENEPOLY rs2252281 GPD_TYPE SNP DTD0007 GENEPOLY rs2252281 ALLDBSNP T>C DTD0007 GENEPOLY rs2252281 MAFDBSNP C=0.3035/1520 DTD0007 GENEPOLY rs2252281 Allele C Metformin Polycystic Ovary Syndrome Irrelevant to the drug response in patients (compare with Allele T) aa DTD0007 GENEPOLY rs2252281 Genotype CC Metformin Healthy Individuals Correlated with the increased drug response in healthy individuals (compare with Genotypes CT + TT) aa DTD0007 GENEPOLY rs2252281 Genotype CC Metformin Diabetes Mellitus Correlated with the increased drug response in patients (compare with Genotypes CT + TT) aa DTD0007 GENEPOLY rs2289669 SITEOFGP chr17:19560030 (GRCh38.p12) DTD0007 GENEPOLY rs2289669 GPD_TYPE SNP DTD0007 GENEPOLY rs2289669 ALLDBSNP G>A DTD0007 GENEPOLY rs2289669 MAFDBSNP A=0.3552/1779 DTD0007 GENEPOLY rs2289669 Allele A Metformin Diabetes Mellitus Irrelevant to the drug response in patients (compare with Allele G) aa DTD0007 GENEPOLY rs2289669 Allele A Metformin Polycystic Ovary Syndrome Irrelevant to the drug response in patients (compare with Allele G) aa DTD0007 GENEPOLY rs2289669 Genotype AA Metformin Diabetes Mellitus Correlated with the increased drug response in patients (compare with genotypes AG + GG) aa DTD0007 GENEPOLY rs2289669 Genotype GG Metformin Diabetes Mellitus Correlated with the increased drug response in patients (compare with genotypes AA + AG) aa DTD0008 TRANSPID DTD0008 DTD0008 GENENAME SLCO1B1 DTD0008 PROTNAME Organic anion transporting polypeptide 1B1 DTD0008 GENEDBID 10599 DTD0008 UNIPROID Q9Y6L6 DTD0008 GENEPOLY rs10841753 SITEOFGP chr12:21168436 (GRCh38.p12) DTD0008 GENEPOLY rs10841753 GPD_TYPE SNP DTD0008 GENEPOLY rs10841753 ALLDBSNP T>C DTD0008 GENEPOLY rs10841753 MAFDBSNP C=0.2352/1178 DTD0008 GENEPOLY rs10841753 Allele C Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Irrelevant to the drug response in patients (compare with Allele T) aa DTD0008 GENEPOLY rs10841753 Genotypes CT + TT Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased drug concentrations in patients (compare with genotype CC); Irrelevant to the mucositis risk in patients (compare with genotype CC) aa DTD0008 GENEPOLY rs11045819 SITEOFGP chr12:21176879 (GRCh38.p12) DTD0008 GENEPOLY rs11045819 GPD_TYPE SNP DTD0008 GENEPOLY rs11045819 ALLDBSNP C>A / C>T DTD0008 GENEPOLY rs11045819 MAFDBSNP A=0.0649/325 DTD0008 GENEPOLY rs11045819 Genotype AC Rifampicin Healthy Individuals Correlated with the increased drug clearance in healthy individuals (compare with genotype CC) aa DTD0008 GENEPOLY rs11045819 Genotype CC Fluvastatin Hypercholesterolemia Correlated with the decreased LDL-C reduction in patients (compare with genotypes AA + AC) aa DTD0008 GENEPOLY rs11045821 SITEOFGP chr12:21179489 (GRCh38.p12) DTD0008 GENEPOLY rs11045821 GPD_TYPE SNP DTD0008 GENEPOLY rs11045821 ALLDBSNP G>A DTD0008 GENEPOLY rs11045821 MAFDBSNP A=0.0527/264 DTD0008 GENEPOLY rs11045821 Allele A Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased drug clearance in patients (compare with allele G) aa DTD0008 GENEPOLY rs11045879 SITEOFGP chr12:21229685 (GRCh38.p12) DTD0008 GENEPOLY rs11045879 GPD_TYPE SNP DTD0008 GENEPOLY rs11045879 ALLDBSNP T>C DTD0008 GENEPOLY rs11045879 MAFDBSNP C=0.2192/1098 DTD0008 GENEPOLY rs11045879 Allele C Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased drug clearance in patients (compare with Allele T) aa DTD0008 GENEPOLY rs11045879 Allele T Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased drug clearance in patients (compare with allele C); Correlated with the increased gastrointestinal toxicity in patients (compare with allele C) aa DTD0008 GENEPOLY rs11045879 Allele T Mercaptopurine Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased gastrointestinal toxicity in patients (compare with allele C) aa DTD0008 GENEPOLY rs11045879 Genotypes CC + CT Methotrexate Osteosarcoma Correlated with the increased drug concentrations in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs11045879 Genotypes CC + CT Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Irrelevant to the drug concentrations in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs113681054 SITEOFGP chr12:21250045 (GRCh38.p12) DTD0008 GENEPOLY rs113681054 GPD_TYPE SNP DTD0008 GENEPOLY rs113681054 ALLDBSNP T>C DTD0008 GENEPOLY rs113681054 MAFDBSNP C=0.2188/1096 DTD0008 GENEPOLY rs113681054 Allele C Ticagrelor Acute Coronary Syndrome Correlated with the increased drug concentrations in patients (compare with Allele T) ac DTD0008 GENEPOLY rs2291073 SITEOFGP chr12:21172880 (GRCh38.p12) DTD0008 GENEPOLY rs2291073 GPD_TYPE SNP DTD0008 GENEPOLY rs2291073 ALLDBSNP T>G DTD0008 GENEPOLY rs2291073 MAFDBSNP G=0.2925/1465 DTD0008 GENEPOLY rs2291073 Genotypes GT + TT Lovastatin Hypercholesterolemia Correlated with the increased drug response (compare with genotype GG) aa DTD0008 GENEPOLY rs2291075 SITEOFGP chr12:21178691 (GRCh38.p12) DTD0008 GENEPOLY rs2291075 GPD_TYPE SNP DTD0008 GENEPOLY rs2291075 ALLDBSNP C>T DTD0008 GENEPOLY rs2291075 MAFDBSNP T=0.4155/2081 DTD0008 GENEPOLY rs2291075 Genotypes CT + TT Etoposide Acute Myeloid Leukemia Correlated with the increased event-free survival and overall survival in patients (compare with genotype CC) aa DTD0008 GENEPOLY rs2291075 Genotypes CT + TT Mitoxantrone Acute Myeloid Leukemia Correlated with the increased event-free survival and overall survival in patients (compare with genotype CC) aa DTD0008 GENEPOLY rs2291075 Genotypes CT + TT Daunorubicin Acute Myeloid Leukemia Correlated with the increased event-free survival and overall survival in patients (compare with genotype CC) aa DTD0008 GENEPOLY rs2291075 Genotypes CT + TT Cytarabine Acute Myeloid Leukemia Correlated with the increased event-free survival and overall survival in patients (compare with genotype CC) aa DTD0008 GENEPOLY rs2306283 SITEOFGP chr12:21176804 (GRCh38.p12) DTD0008 GENEPOLY rs2306283 GPD_TYPE SNP DTD0008 GENEPOLY rs2306283 ALLDBSNP A>G / A>T DTD0008 GENEPOLY rs2306283 MAFDBSNP A=0.3776/1891 DTD0008 GENEPOLY rs2306283 Allele A Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased drug clearance in patients (compare with allele G) aa DTD0008 GENEPOLY rs2306283 Allele G Atorvastatin Coronary Artery Disease Irrelevant to the likelihood of statin-related myopathy in patients (compare with allele A) aa DTD0008 GENEPOLY rs2306283 Allele G Rosuvastatin Coronary Artery Disease Irrelevant to the likelihood of statin-related myopathy in patients (compare with allele A) aa DTD0008 GENEPOLY rs2306283 Allele G Simvastatin Coronary Artery Disease Irrelevant to the likelihood of statin-related myopathy in patients (compare with allele A) aa DTD0008 GENEPOLY rs2306283 Genotype AA Mycophenolic acid Lung Transplantation Correlated with the decreased drug concentrations in patients (compare with genotypes AG + GG) aa DTD0008 GENEPOLY rs2306283 Genotype AA Atorvastatin Hypercholesterolemia Correlated with the increased drug response in patients (compare with genotypes AG + GG) aa DTD0008 GENEPOLY rs2306283 Genotype AA Pravastatin Hypercholesterolemia Irrelevant to the drug response in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs2306283 Genotype GG Rifampicin Healthy Individuals Correlated with the decreased drug clearance in healthy individuals (compare with genotypes AA + AG) aa DTD0008 GENEPOLY rs2306283 Genotype GG Repaglinide Healthy Individuals Correlated with the decreased the total area under the plasma concentration-time curve (AUC) of drug and Cmax in healthy individuals (compare with genotype AA) aa DTD0008 GENEPOLY rs2306283 Genotype GG Irinotecan Neoplasm Correlated with the increased neutropenia risk in patients (compare with genotype AA) aa DTD0008 GENEPOLY rs2306283 Genotype GG Atorvastatin Hypercholesterolemia Correlated with the increased reduction in LDL in patients (compare with genotypes AA + AG); Irrelevant to the increased drug response in patients (compare with genotypes AA + AG) aa DTD0008 GENEPOLY rs2306283 Genotype GG Simvastatin Hypercholesterolemia Irrelevant to the increased drug response in patients (compare with genotypes AA + AG) aa DTD0008 GENEPOLY rs2306283 Genotype GG Irinotecan Non-Small-Cell Lung Carcinoma Irrelevant to the neutropenia in patients (compare with genotypes AA + AG) aa DTD0008 GENEPOLY rs2306283 Genotypes AA + AG Mycophenolic acid Kidney Transplantation Correlated with the decreased drug clearance in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs2306283 Genotypes AA + AG Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased drug clearance in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs2306283 Genotypes AA + AG Irinotecan Colorectal Neoplasm Correlated with the increased drug response in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs2306283 Genotypes AA + AG Fluorouracil Colorectal Neoplasm Correlated with the increased drug response in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs2306283 Genotypes AA + AG Leucovorin Colorectal Neoplasm Correlated with the increased drug response in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs2306283 Genotypes AG + GG Sorafenib Diarrhea Correlated with the decreased likelihood of diarrhea in patients (compare with genotype AA) aa DTD0008 GENEPOLY rs2306283 Genotypes AG + GG Atorvastatin Hypercholesterolemia Correlated with the increased drug response in patients (compare with genotype AA); Irrelevant to the increased myalgia unspecified risk in patients (compare with genotype AA) aa DTD0008 GENEPOLY rs2306283 Genotypes AG + GG Pitavastatin calcium Healthy Individuals Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug and Cmax in healthy individuals (compare with genotype AA) aa DTD0008 GENEPOLY rs2306283 Genotypes AG + GG Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Irrelevant to the drug concentrations in patients (compare with genotype AA) aa DTD0008 GENEPOLY rs2306283 Genotypes AG + GG Irinotecan Neoplasm Irrelevant to the severity of neutropenia in patients (compare with genotype AA) aa DTD0008 GENEPOLY rs2306283 Genotype AA Rocuronium Muscle Relaxant Correlated with the decreased drug response in patients (compare with genotypes AG + GG) aa DTD0008 GENEPOLY rs2306283 Genotypes AA + AG Capecitabine Colorectal Neoplasm Correlated with the increased drug response in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs2306283 Allele G Hmg coa reductase inhibitors Diabetes Mellitus Correlated with the decreased drug-Induced abnormalities risk in patients (compare with Allele A) ac DTD0008 GENEPOLY rs2306283 Genotype AA Hmg coa reductase inhibitors Coronary Artery Disease Correlated with the increased creatine kinase in patients (compare with genotype AG) ac DTD0008 GENEPOLY rs2900478 SITEOFGP chr12:21215863 (GRCh38.p12) DTD0008 GENEPOLY rs2900478 GPD_TYPE SNP DTD0008 GENEPOLY rs2900478 ALLDBSNP T>A DTD0008 GENEPOLY rs2900478 MAFDBSNP A=0.0895/448 DTD0008 GENEPOLY rs2900478 Allele A Hmg coa reductase inhibitors Coronary Artery Disease Correlated with the decreased drug response in patients (compare with Allele T) ac DTD0008 GENEPOLY rs4149015 SITEOFGP chr12:21130388 (GRCh38.p12) DTD0008 GENEPOLY rs4149015 GPD_TYPE SNP DTD0008 GENEPOLY rs4149015 ALLDBSNP G>A / G>C DTD0008 GENEPOLY rs4149015 MAFDBSNP A=0.0547/274 DTD0008 GENEPOLY rs4149015 Genotype AG Pravastatin Hypercholesterolemia Correlated with the decreased drug response (compare with genotype GG) aa DTD0008 GENEPOLY rs4149015 Genotype AG Pravastatin Healthy Individuals Correlated with the increased drug AUC0-12 in healthy individuals (compare with genotype GG) aa DTD0008 GENEPOLY rs4149015 Genotypes AA + AG Irinotecan Non-Small-Cell Lung Carcinoma Correlated with the increased neutropenia in patients (compare with genotype GG); Irrelevant to the diarrhea in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs4149032 SITEOFGP chr12:21164857 (GRCh38.p12) DTD0008 GENEPOLY rs4149032 GPD_TYPE SNP DTD0008 GENEPOLY rs4149032 ALLDBSNP C>T DTD0008 GENEPOLY rs4149032 MAFDBSNP C=0.4643/2325 DTD0008 GENEPOLY rs4149032 Allele T Rifampicin Tuberculosis Correlated with the decreased drug exposure in patients (compare with allele C) aa DTD0008 GENEPOLY rs4149036 SITEOFGP chr12:21174806 (GRCh38.p12) DTD0008 GENEPOLY rs4149036 GPD_TYPE SNP DTD0008 GENEPOLY rs4149036 ALLDBSNP C>A DTD0008 GENEPOLY rs4149036 MAFDBSNP A=0.3542/1774 DTD0008 GENEPOLY rs4149036 Genotypes AC + CC Atorvastatin Coronary Artery Disease Correlated with the increased drug response in patients (compare with genotype AA) aa DTD0008 GENEPOLY rs4149056 SITEOFGP chr12:21178615 (GRCh38.p12) DTD0008 GENEPOLY rs4149056 GPD_TYPE SNP DTD0008 GENEPOLY rs4149056 ALLDBSNP T>C DTD0008 GENEPOLY rs4149056 MAFDBSNP C=0.0877/439 DTD0008 GENEPOLY rs4149056 Allele C Fluvastatin Muscular Diseases Correlated with the all statin-induced myopathy and severe myopathy in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Simvastatin Muscular Diseases Correlated with the all statin-induced myopathy and severe myopathy in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Atorvastatin Muscular Diseases Correlated with the all statin-induced myopathy and severe myopathy in patients (compare with Allele T); Correlated with the increased drug plasma concentrations in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Rosuvastatin Muscular Diseases Correlated with the all statin-induced myopathy and severe myopathy in patients (compare with Allele T); Correlated with the increased drug plasma concentrations in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Pravastatin Muscular Diseases Correlated with the all statin-induced myopathy and severe myopathy in patients (compare with Allele T); Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug and Cmax in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Mycophenolate mofetil Kidney Transplantation Correlated with the decreased adverse drug reactions risk in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased drug clearance in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Pravastatin Healthy Individuals Correlated with the decreased drug metabolism in healthy individuals (compare with Allele T); Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug in healthy individuals (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Atorvastatin Hypercholesterolemia Correlated with the increased composite adverse events risk in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Pravastatin Hypercholesterolemia Correlated with the increased composite adverse events risk in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Simvastatin Hypercholesterolemia Correlated with the increased composite adverse events risk in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Rosuvastatin Hypercholesterolemia Correlated with the increased drug plasma concentrations in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Rosuvastatin Coronary Artery Disease Correlated with the increased likelihood of statin-related myopathy in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Cytarabine Acute Myeloid Leukemia Correlated with the increased likelihood of toxic liver disease in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Nateglinide Diabetes Irrelevant to the drug pharmacokinetics (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Allele C Atorvastatin Hyperlipidemias Irrelevant to the muscular diseases risk in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele T Rosuvastatin Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with allele C) aa DTD0008 GENEPOLY rs4149056 Allele T Mycophenolate mofetil Kidney Transplantation Irrelevant to the increased diarrhea risk in patients (compare with allele C); Irrelevant to the increased leukopenia risk in patients (compare with allele C) aa DTD0008 GENEPOLY rs4149056 Allele T Rosuvastatin Coronary Disease Irrelevant to the LDL-C response in patients (compare with allele C) aa DTD0008 GENEPOLY rs4149056 Allele T Simvastatin Coronary Disease Irrelevant to the LDL-C response in patients (compare with allele C) aa DTD0008 GENEPOLY rs4149056 Genotype CC Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased drug response in patients (compare with Genotypes CT + TT) aa DTD0008 GENEPOLY rs4149056 Genotype CC Rosuvastatin Hypercholesterolemia Correlated with the increased drug AUC in patients (p=0.002) and Cmax in patients (p=0.003) (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CC Pravastatin Hypercholesterolemia Correlated with the increased drug mean peak concentration in plasma and area under the plasma concentration in patients (compare with Genotypes CT + TT); Irrelevant to the drug response in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CC Lopinavir HIV Infection Correlated with the increased drug median plasma Cmin and C2-6 (compare with Genotypes CT + TT) aa DTD0008 GENEPOLY rs4149056 Genotype CC Simvastatin Healthy Individuals Correlated with the increased drug plasma concentrations in healthy individuals (compare with Genotypes CT + TT) aa DTD0008 GENEPOLY rs4149056 Genotype CC Simvastatin Myocardial Infarction Correlated with the increased likelihood of muscular diseases in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CC Simvastatin Muscular Diseases Correlated with the increased muscular diseases risk in patients (compare with genotype Ct); Irrelevant to the increased drug dose decrease or switch to another cholesterol-lowering drug risk in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CC Cerivastatin Muscular Diseases Correlated with the increased rhabdomyolysis risk in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CC Cerivastatin Rhabdomyolysis Correlated with the increased rhabdomyolysis risk in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CC Repaglinide Diabetes Mellitus Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug (compare with Genotypes CT + TT) aa DTD0008 GENEPOLY rs4149056 Genotype CC Atorvastatin Healthy Individuals Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug in healthy individuals (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CC Fluvastatin Muscular Diseases Irrelevant to the increased mean peak concentration in plasma and area under the plasma concentration in patients (compare with Genotypes CT + TT) aa DTD0008 GENEPOLY rs4149056 Genotype CT Simvastatin Muscular Diseases Correlated with the decreased drug clearance in patients (compare with Genotype TT); Correlated with the increased muscular diseases risk in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CT Pravastatin Coronary Stenosis Correlated with the decreased drug response in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CT Pravastatin Muscular Diseases Correlated with the decreased drug response in patients (compare with Genotype TT); Correlated with the increased drug AUC0-12 in patients (compare with Genotype TT); Correlated with the increased drug metabolism in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CT Pravastatin Transplantation Correlated with the drug response in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CT Pravastatin Healthy Individuals Correlated with the increased drug AUC and Cmax in healthy individuals (compare with Genotype TT); Correlated with the increased drug AUC0-12 in healthy individuals (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CT Repaglinide Healthy Individuals Correlated with the increased drug concentrations in healthy individuals (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CT Atorvastatin Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CT Rosuvastatin Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CT Pravastatin Hyperlipoproteinemia Irrelevant to the increased drug metabolism in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype CT Irinotecan Neoplasm Irrelevant to the severity of neutropenia in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotype TT Atorvastatin Coronary Artery Disease Correlated with the a nearly tripled increased percentage of drug AUC (0 - 48) values in patients (compare with genotype CC) aa DTD0008 GENEPOLY rs4149056 Genotype TT Rifampicin Tuberculosis Correlated with the a nearly tripled increased percentage of drug AUC (0 - 48) values in patients (compare with genotype CC) aa DTD0008 GENEPOLY rs4149056 Genotype TT Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased drug concentrations in patients (compare with genotypes CC + CT) aa DTD0008 GENEPOLY rs4149056 Genotype TT Rosuvastatin Hypercholesterolemia Correlated with the decreased drug plasma concentrations in patients (compare with genotypes CC + CT); Irrelevant to the percentage change in LDL-cholesterol levels in patients (compare with Genotypes CT + TT) aa DTD0008 GENEPOLY rs4149056 Genotype TT Mycophenolate mofetil Kidney Transplantation Correlated with the increased adverse drug reaction risk in patients (compare with genotype CC) aa DTD0008 GENEPOLY rs4149056 Genotype TT Fluorouracil Breast Neoplasm Correlated with the increased alcoholism risk in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs4149056 Genotype TT Epirubicin Breast Neoplasm Correlated with the increased alcoholism risk in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs4149056 Genotype TT Docetaxel Breast Neoplasm Correlated with the increased alcoholism risk in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs4149056 Genotype TT Doxorubicin Breast Neoplasm Correlated with the increased alcoholism risk in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs4149056 Genotype TT Cyclophosphamide Breast Neoplasm Correlated with the increased alcoholism risk in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs4149056 Genotype TT Fluvastatin Muscular Diseases Correlated with the increased drug response as in patients (compare with genotypes CC + CT) aa DTD0008 GENEPOLY rs4149056 Genotypes CC + CT Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased drug clearance in patients (compare with Genotype TT); Correlated with the decreased drug dose in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotypes CC + CT Mercaptopurine Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased drug dose in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotypes CC + CT Atorvastatin Obesity Correlated with the decreased drug oral clearance in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotypes CC + CT Atorvastatin Muscular Diseases Correlated with the increased drug dose decrease or switch to another cholesterol-lowering drug risk in patients (compare with Genotype TT); Correlated with the increased likelihood of drug toxicity, muscular diseases, rhabdomyolysis and toxic liver disease in patients (compare with Genotype TT); Irrelevant to the increased drug dose decrease or switch to another cholesterol-lowering drug risk in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotypes CC + CT Sn-38 Non-Small-Cell Lung Carcinoma Correlated with the increased drug dose in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotypes CC + CT Enalapril Essential Hypertension Correlated with the increased likelihood of cough in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotypes CC + CT Simvastatin Hyperlipidemias Correlated with the increased muscular diseases risk in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotypes CC + CT Irinotecan Non-Small-Cell Lung Carcinoma Correlated with the increased neutropenia risk in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotypes CC + CT Irinotecan Neoplasm Irrelevant to the diarrhea in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotypes CC + CT Atorvastatin Hypercholesterolemia Irrelevant to the increased myalgia unspecified risk in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotypes CC + CT Rosuvastatin Muscular Diseases Irrelevant to the increased myalgia unspecified risk in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4149056 Genotypes CT + TT Sorafenib Thrombocytopenia Correlated with the increased likelihood of disease in patients (compare with genotype CC) aa DTD0008 GENEPOLY rs4149056 Genotypes CT + TT Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Irrelevant to the drug concentrations in patients (compare with genotype CC) aa DTD0008 GENEPOLY rs4149056 Genotypes CT + TT Pravastatin Hypercholesterolemia Irrelevant to the the drug response in patients (compare with genotype CC) aa DTD0008 GENEPOLY rs4149056 Allele C Rosiglitazone Diabetes Mellitus Correlated with the increased drug response in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Fludarabine Acute Myeloid Leukemia Correlated with the increased likelihood of toxic liver disease in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Gemtuzumab ozogamicin Acute Myeloid Leukemia Correlated with the increased likelihood of toxic liver disease in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Allele C Idarubicin Acute Myeloid Leukemia Correlated with the increased likelihood of toxic liver disease in patients (compare with Allele T) aa DTD0008 GENEPOLY rs4149056 Genotype TT Goserelin Breast Neoplasm Correlated with the increased alcoholism risk in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs4149056 Allele C Hmg coa reductase inhibitors Muscular Diseases Correlated with the all statin-induced myopathy and severe myopathy in patients (compare with Allele T) ac DTD0008 GENEPOLY rs4149056 Allele C Simvastatin acid Hypercholesterolemia Correlated with the increased drug concentrations (compare with Genotype TT); Correlated with the increased drug concentrations in patients (compare with Allele T) ac DTD0008 GENEPOLY rs4149056 Allele C Hmg coa reductase inhibitors Diabetes Mellitus Correlated with the increased drug-Induced abnormalities risk in patients (compare with Allele T) ac DTD0008 GENEPOLY rs4149056 Allele T Ticagrelor Acute Coronary Syndrome Correlated with the decreased drug concentrations in patients (compare with allele C) ac DTD0008 GENEPOLY rs4149056 Genotype CC Hmg coa reductase inhibitors Muscular Diseases Correlated with the increased creatine kinase in patients (compare with Genotypes CT + TT); Correlated with the increased drug dose decrease or switch to another cholesterol-lowering drug risk in patients (compare with Genotype TT) ac DTD0008 GENEPOLY rs4149056 Genotype CC Simvastatin acid Healthy Individuals Correlated with the increased drug concentrations in healthy individuals (compare with Genotype TT) ac DTD0008 GENEPOLY rs4149056 Genotype CT Simvastatin acid Hypercholesterolemia Correlated with the increased drug exposure in patients (compare with Genotype TT) ac DTD0008 GENEPOLY rs4149056 Genotypes CC + CT Simvastatin acid Hypercholesterolemia Correlated with the increased drug concentrations (compare with Genotype TT) ac DTD0008 GENEPOLY rs4149081 SITEOFGP chr12:21225087 (GRCh38.p12) DTD0008 GENEPOLY rs4149081 GPD_TYPE SNP DTD0008 GENEPOLY rs4149081 ALLDBSNP G>A DTD0008 GENEPOLY rs4149081 MAFDBSNP A=0.2188/1096 DTD0008 GENEPOLY rs4149081 Allele G Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the drug clearance in patients (compare with allele A); Correlated with the increased gastrointestinal toxicity risk in patients (compare with Allele A) aa DTD0008 GENEPOLY rs4149081 Genotype AA Rosuvastatin Coronary Disease Correlated with the increased LDL-C reduction in patients (compare with genotypes AG + GG) aa DTD0008 GENEPOLY rs4149081 Genotype AA Simvastatin Coronary Disease Correlated with the increased LDL-C reduction in patients (compare with genotypes AG + GG) aa DTD0008 GENEPOLY rs4149081 Genotype AG Rosuvastatin Coronary Disease Correlated with the increased LDL-C reduction in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs4149081 Genotype AG Simvastatin Coronary Disease Correlated with the increased LDL-C reduction in patients (compare with genotype GG) aa DTD0008 GENEPOLY rs4363657 SITEOFGP chr12:21215788 (GRCh38.p12) DTD0008 GENEPOLY rs4363657 GPD_TYPE SNP DTD0008 GENEPOLY rs4363657 ALLDBSNP T>C DTD0008 GENEPOLY rs4363657 MAFDBSNP C=0.2149/1076 DTD0008 GENEPOLY rs4363657 Genotype CC Simvastatin Myocardial Infarction Correlated with the increased likelihood of muscular diseases in patients (compare with Genotype TT) aa DTD0008 GENEPOLY rs4363657 Genotypes CC + CT Rosuvastatin Muscular Diseases Irrelevant to the increased myalgia unspecified risk in patients (compare with Genotype TT) aa DTD0009 TRANSPID DTD0009 DTD0009 GENENAME SLC22A3 DTD0009 PROTNAME Organic cation transporter 3 DTD0009 GENEDBID 6581 DTD0009 UNIPROID O75751 DTD0009 GENEPOLY rs2076828 SITEOFGP chr6:160451754 (GRCh38.p12) DTD0009 GENEPOLY rs2076828 GPD_TYPE SNP DTD0009 GENEPOLY rs2076828 ALLDBSNP C>G DTD0009 GENEPOLY rs2076828 MAFDBSNP G=0.4866/2437 DTD0009 GENEPOLY rs2076828 Allele G Metformin Healthy Individuals Correlated with the decreased drug response in healthy individuals (compare with Allele C) aa DTD0009 GENEPOLY rs2076828 Allele G Metformin Diabetes Mellitus Correlated with the decreased expression of SLC22A3 (compare with Allele C) aa DTD0009 GENEPOLY rs8187725 SITEOFGP chr6:160437122 (GRCh38.p12) DTD0009 GENEPOLY rs8187725 GPD_TYPE SNP DTD0009 GENEPOLY rs8187725 ALLDBSNP C>A / C>T DTD0009 GENEPOLY rs8187725 MAFDBSNP N.A. DTD0009 GENEPOLY rs8187725 Allele T Metformin Diabetes Mellitus Correlated with the decreased drug metabolism (compare with allele C) aa DTD0009 GENEPOLY rs8187725 Allele T Catecholamines N.A. Correlated with the decreased drug metabolism (compare with allele C) ac DTD0010 TRANSPID DTD0010 DTD0010 GENENAME SLC22A1 DTD0010 PROTNAME Organic cation transporter 1 DTD0010 GENEDBID 6580 DTD0010 UNIPROID O15245 DTD0010 GENEPOLY rs12208357 SITEOFGP chr6:160122116 (GRCh38.p12) DTD0010 GENEPOLY rs12208357 GPD_TYPE SNP DTD0010 GENEPOLY rs12208357 ALLDBSNP C>T DTD0010 GENEPOLY rs12208357 MAFDBSNP T=0.0204/102 DTD0010 GENEPOLY rs12208357 Allele C Metformin Diabetes Mellitus Correlated with the increased drug bioavailability (AUC, CL & AUC/CL ratio) aa DTD0010 GENEPOLY rs12208357 Allele T Tramadol Healthy Individuals Correlated with the higher o-desmethyltramadol plasma concentrations in healthy individuals (compare with allele C) aa DTD0010 GENEPOLY rs12208357 Allele T Metformin Healthy Individuals Correlated with the increased drug exposure in healthy individuals (compare with allele C) aa DTD0010 GENEPOLY rs12208357 Allele T Metformin Diabetes Mellitus Irrelevant to the drug response in patients (compare with allele C) aa DTD0010 GENEPOLY rs12208357 Allele T Metformin Polycystic Ovary Syndrome Irrelevant to the drug response in patients (compare with allele C) aa DTD0010 GENEPOLY rs12208357 Genotype TT Metformin Healthy Individuals Correlated with the decreased drug exposure in healthy individuals (compare with genotype CC) aa DTD0010 GENEPOLY rs2282143 SITEOFGP chr6:160136611 (GRCh38.p12) DTD0010 GENEPOLY rs2282143 GPD_TYPE SNP DTD0010 GENEPOLY rs2282143 ALLDBSNP C>G / C>T DTD0010 GENEPOLY rs2282143 MAFDBSNP T=0.0663/332 DTD0010 GENEPOLY rs2282143 Genotype CC Metformin Healthy Individuals Correlated with the increased drug clearance in healthy individuals (compare with Genotypes CT + TT) aa DTD0010 GENEPOLY rs35167514 SITEOFGP chr6:160139849 (GRCh38.p12) DTD0010 GENEPOLY rs35167514 GPD_TYPE DeletionDeletion DTD0010 GENEPOLY rs35167514 ALLDBSNP delA DTD0010 GENEPOLY rs35167514 MAFDBSNP N.A. DTD0010 GENEPOLY rs35167514 Genotype DEL Tramadol Healthy Individuals Correlated with the increased plasma concentrations of o-desmethyltramadol in healthy individuals (compare with allele A) aa DTD0010 GENEPOLY rs36056065 SITEOFGP N.A. DTD0010 GENEPOLY rs36056065 GPD_TYPE N.A. DTD0010 GENEPOLY rs36056065 ALLDBSNP N.A. DTD0010 GENEPOLY rs36056065 MAFDBSNP N.A. DTD0010 GENEPOLY rs36056065 Allele GTAAGTTG Metformin Diabetes Mellitus Correlated with the gastrointestinal side effects in patients (compare with allele del) aa DTD0010 GENEPOLY rs594709 SITEOFGP chr6:160134722 (GRCh38.p12) DTD0010 GENEPOLY rs594709 GPD_TYPE SNP DTD0010 GENEPOLY rs594709 ALLDBSNP G>A DTD0010 GENEPOLY rs594709 MAFDBSNP G=0.3179/1592 DTD0010 GENEPOLY rs594709 Genotypes AA + AG Metformin Diabetes Mellitus Correlated with the increased drug response in patients (compare with genotype GG) aa DTD0010 GENEPOLY rs628031 SITEOFGP chr6:160139813 (GRCh38.p12) DTD0010 GENEPOLY rs628031 GPD_TYPE SNP DTD0010 GENEPOLY rs628031 ALLDBSNP A>C / A>G DTD0010 GENEPOLY rs628031 MAFDBSNP A=0.3123/1564 DTD0010 GENEPOLY rs628031 Allele A Metformin Diabetes Mellitus Correlated with the decreased drug response in patients (compare with allele G); Correlated with the gastrointestinal toxicity in patients (compare with allele G) aa DTD0010 GENEPOLY rs628031 Allele A Lamotrigine Epilepsy Irrelevant to the drug response in patients (compare with Allele G) aa DTD0010 GENEPOLY rs628031 Genotype GG Lamotrigine Epilepsy Correlated with the increased drug dose in patients (compare with genotypes AA + AG) aa DTD0010 GENEPOLY rs628031 Genotypes AA + AG Lamotrigine Epilepsy Correlated with the increased drug concentrations in patients (compare with genotype GG) aa DTD0010 GENEPOLY rs683369 SITEOFGP chr6:160130172 (GRCh38.p12) DTD0010 GENEPOLY rs683369 GPD_TYPE SNP DTD0010 GENEPOLY rs683369 ALLDBSNP G>A / G>C / G>T DTD0010 GENEPOLY rs683369 MAFDBSNP G=0.1238/620 DTD0010 GENEPOLY rs683369 Genotype CC Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the decreased drug concentrations in patients (compare with genotypes CG + GG); Correlated with the increased drug clearance in patients (compare with genotypes CG + GG) aa DTD0010 GENEPOLY rs683369 Genotypes CG + GG Imatinib Gastrointestinal Stromal Tumors Correlated with the increased conjunctival hemorrhage risk in patients (compare with genotype CC) aa DTD0010 GENEPOLY rs72552763 SITEOFGP chr6:160139849-160139853 (GRCh38.p12) DTD0010 GENEPOLY rs72552763 GPD_TYPE Indel Insertion and Deletion DTD0010 GENEPOLY rs72552763 ALLDBSNP delGAT DTD0010 GENEPOLY rs72552763 MAFDBSNP N.A. DTD0010 GENEPOLY rs72552763 Genotype GAT/DEL Metformin Diabetes Mellitus Correlated with the decreased drug trough steady-state concentration in patients (compare with genotype GAt/GAt) aa DTD0012 TRANSPID DTD0012 DTD0012 GENENAME ABCC3 DTD0012 PROTNAME Multidrug resistance-associated protein 3 DTD0012 GENEDBID 8714 DTD0012 UNIPROID O15438 DTD0012 GENEPOLY rs1051640 SITEOFGP chr17:50691125 (GRCh38.p12) DTD0012 GENEPOLY rs1051640 GPD_TYPE SNP DTD0012 GENEPOLY rs1051640 ALLDBSNP A>G DTD0012 GENEPOLY rs1051640 MAFDBSNP G=0.1040/521 DTD0012 GENEPOLY rs1051640 Allele G Cisplatin Neoplasm Correlated with the increased ototoxicity risk in patients (compare with Allele A); Irrelevant to the ototoxicity risk in patients (compare with allele A) aa DTD0012 GENEPOLY rs1051640 Allele G Cisplatin Testicular Neoplasm Irrelevant to the likelihood of ototoxicity in patients (compare with allele A) aa DTD0012 GENEPOLY rs4148416 SITEOFGP chr17:50676062 (GRCh38.p12) DTD0012 GENEPOLY rs4148416 GPD_TYPE SNP DTD0012 GENEPOLY rs4148416 ALLDBSNP C>T DTD0012 GENEPOLY rs4148416 MAFDBSNP T=0.1370/686 DTD0012 GENEPOLY rs4148416 Allele T Methotrexate Osteosarcoma Correlated with the increased death risk in patients (compare with allele C) aa DTD0012 GENEPOLY rs4148416 Allele T Vincristine Osteosarcoma Correlated with the increased death risk in patients (compare with allele C) aa DTD0012 GENEPOLY rs4148416 Allele T Cisplatin Osteosarcoma Correlated with the increased death risk in patients (compare with allele C) aa DTD0012 GENEPOLY rs4148416 Allele T Doxorubicin Osteosarcoma Correlated with the increased death risk in patients (compare with allele C) aa DTD0012 GENEPOLY rs4148416 Allele T Cyclophosphamide Osteosarcoma Correlated with the increased death risk in patients (compare with allele C) aa DTD0012 GENEPOLY rs4793665 SITEOFGP chr17:50634726 (GRCh38.p12) DTD0012 GENEPOLY rs4793665 GPD_TYPE SNP DTD0012 GENEPOLY rs4793665 ALLDBSNP C>A / C>T DTD0012 GENEPOLY rs4793665 MAFDBSNP C=0.3313/1659 DTD0012 GENEPOLY rs4793665 Genotype CC Morphine Pain Correlated with the increased drug metabolism in patients (compare with Genotypes CT + TT) aa DTD0012 GENEPOLY rs9895420 SITEOFGP chr17:50634677 (GRCh38.p12) DTD0012 GENEPOLY rs9895420 GPD_TYPE SNP DTD0012 GENEPOLY rs9895420 ALLDBSNP T>A DTD0012 GENEPOLY rs9895420 MAFDBSNP A=0.1276/639 DTD0012 GENEPOLY rs9895420 Genotypes AA + AT Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased likelihood of thrombocytopenia in patients (compare with Genotype TT); Correlated with the increased drug plasma levels in patients (compare with Genotype TT); Correlated with the increased relapse in the central nervous system risk in patients (compare with Genotype TT) aa DTD0013 TRANSPID DTD0013 DTD0013 GENENAME ABCB4 DTD0013 PROTNAME Multidrug resistance protein 3 DTD0013 GENEDBID 5244 DTD0013 UNIPROID P21439 DTD0013 GENEPOLY rs1149222 SITEOFGP chr7:87444459 (GRCh38.p12) DTD0013 GENEPOLY rs1149222 GPD_TYPE SNP DTD0013 GENEPOLY rs1149222 ALLDBSNP G>T DTD0013 GENEPOLY rs1149222 MAFDBSNP G=0.3842/1924 DTD0013 GENEPOLY rs1149222 Allele G Daunorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele T) aa DTD0013 GENEPOLY rs1149222 Allele G Doxorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele T) aa DTD0013 GENEPOLY rs1149222 Allele G Anthracyclines Neoplasm Correlated with the increased likelihood of cardiotoxicity in patients (compare with Allele T) ac DTD0013 GENEPOLY rs4148808 SITEOFGP chr7:87476479 (GRCh38.p12) DTD0013 GENEPOLY rs4148808 GPD_TYPE SNP DTD0013 GENEPOLY rs4148808 ALLDBSNP T>C DTD0013 GENEPOLY rs4148808 MAFDBSNP C=0.2206/1105 DTD0013 GENEPOLY rs4148808 Allele T Daunorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with allele C) aa DTD0013 GENEPOLY rs4148808 Allele T Doxorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with allele C) aa DTD0013 GENEPOLY rs4148808 Allele T Anthracyclines Neoplasm Correlated with the increased likelihood of cardiotoxicity in patients (compare with allele C) ac DTD0014 TRANSPID DTD0014 DTD0014 GENENAME ABCB11 DTD0014 PROTNAME Bile salt export pump DTD0014 GENEDBID 8647 DTD0014 UNIPROID O95342 DTD0014 GENEPOLY rs2287622 SITEOFGP chr2:168973818 (GRCh38.p12) DTD0014 GENEPOLY rs2287622 GPD_TYPE SNP DTD0014 GENEPOLY rs2287622 ALLDBSNP A>C / A>G / A>T DTD0014 GENEPOLY rs2287622 MAFDBSNP A=0.3892/1500 DTD0014 GENEPOLY rs2287622 Genotype CC Bile acid Intrahepatic cholestasis of pregnancy Correlated with the development of intrahepatic cholestasis of pregnancy (compare with genotypes TT + TC) ac DTD0014 GENEPOLY rs2287622 Genotype CC Bile acid Chronic hepatitis C Correlated with the increased plasma bile acid levels (compare with genotype TT + TC) ac DTD0015 TRANSPID DTD0015 DTD0015 GENENAME ABCC4 DTD0015 PROTNAME Multidrug resistance-associated protein 4 DTD0015 GENEDBID 10257 DTD0015 UNIPROID O15439 DTD0015 GENEPOLY rs1059751 SITEOFGP chr13:95020696 (GRCh38.p12) DTD0015 GENEPOLY rs1059751 GPD_TYPE SNP DTD0015 GENEPOLY rs1059751 ALLDBSNP A>G DTD0015 GENEPOLY rs1059751 MAFDBSNP G=0.4145/2076 DTD0015 GENEPOLY rs1059751 Allele G Tenofovir HIV Infection Correlated with the increased likelihood of kidney diseases in patients (compare with Allele A) aa DTD0015 GENEPOLY rs11568658 SITEOFGP chr13:95210754 (GRCh38.p12) DTD0015 GENEPOLY rs11568658 GPD_TYPE SNP DTD0015 GENEPOLY rs11568658 ALLDBSNP C>A DTD0015 GENEPOLY rs11568658 MAFDBSNP A=0.0517/259 DTD0015 GENEPOLY rs11568658 Genotype AC Latanoprost Open-Angle Glaucoma Correlated with the decreased drug response in patients (compare with genotype CC) aa DTD0015 GENEPOLY rs11568658 Genotype AC Valganciclovir Kidney Transplantation Correlated with the increased neutropenia risk in patients (compare with genotype CC) aa DTD0015 GENEPOLY rs1678387 SITEOFGP chr13:95065652 (GRCh38.p12) DTD0015 GENEPOLY rs1678387 GPD_TYPE SNP DTD0015 GENEPOLY rs1678387 ALLDBSNP T>C DTD0015 GENEPOLY rs1678387 MAFDBSNP T=0.0978/490 DTD0015 GENEPOLY rs1678387 Allele T Bisphosphonates Osteonecrosis Correlated with the increased likelihood of osteonecrosis in patients (compare with allele C) aa DTD0015 GENEPOLY rs16950650 SITEOFGP chr13:95123178 (GRCh38.p12) DTD0015 GENEPOLY rs16950650 GPD_TYPE SNP DTD0015 GENEPOLY rs16950650 ALLDBSNP C>T DTD0015 GENEPOLY rs16950650 MAFDBSNP T=0.0437/219 DTD0015 GENEPOLY rs16950650 Genotype CT Irinotecan Small Cell Carcinoma Correlated with the decreased overall survival in patients (compare with genotype CC) aa DTD0015 GENEPOLY rs16950650 Genotype CT Cisplatin Small Cell Carcinoma Correlated with the decreased overall survival in patients (compare with genotype CC) aa DTD0015 GENEPOLY rs17268282 SITEOFGP chr13:95273060 (GRCh38.p12) DTD0015 GENEPOLY rs17268282 GPD_TYPE SNP DTD0015 GENEPOLY rs17268282 ALLDBSNP G>T DTD0015 GENEPOLY rs17268282 MAFDBSNP T=0.0389/195 DTD0015 GENEPOLY rs17268282 Allele T Furosemide Heart Failure Correlated with the increased drug response in patients (compare with allele G) aa DTD0015 GENEPOLY rs1751034 SITEOFGP chr13:95062722 (GRCh38.p12) DTD0015 GENEPOLY rs1751034 GPD_TYPE SNP DTD0015 GENEPOLY rs1751034 ALLDBSNP C>G / C>T DTD0015 GENEPOLY rs1751034 MAFDBSNP C=0.2057/1030 DTD0015 GENEPOLY rs1751034 Genotype TT Tenofovir HIV Infection Correlated with the increased drug renal clearance, and lower the total area under the plasma concentration-time curve (AUC) in patients (compare with genotypes CC + CT) aa DTD0015 GENEPOLY rs1751034 Genotypes CC + CT Tenofovir HIV Infection Correlated with the increased intracellular tenofovir diphosphate (tFV-DP) concentrations in patients (compare with Genotype TT) aa DTD0015 GENEPOLY rs3742106 SITEOFGP chr13:95021537 (GRCh38.p12) DTD0015 GENEPOLY rs3742106 GPD_TYPE SNP DTD0015 GENEPOLY rs3742106 ALLDBSNP A>C DTD0015 GENEPOLY rs3742106 MAFDBSNP C=0.4149/2078 DTD0015 GENEPOLY rs3742106 Genotypes AC + CC Tenofovir HIV Infection Correlated with the increased drug concentrations in patients (compare with genotype AA) aa DTD0015 GENEPOLY rs3765534 SITEOFGP chr13:95163161 (GRCh38.p12) DTD0015 GENEPOLY rs3765534 GPD_TYPE SNP DTD0015 GENEPOLY rs3765534 ALLDBSNP C>T DTD0015 GENEPOLY rs3765534 MAFDBSNP T=0.0312/156 DTD0015 GENEPOLY rs3765534 Genotype TT Mercaptopurine Inflammatory Bowel Diseases Correlated with the increased sensitivity to drug in nA18967 cells (compare with genotype CC) aa DTD0015 GENEPOLY rs3765534 Genotypes CT + TT Azathioprine Inflammatory Bowel Diseases Correlated with the increased likelihood of leukopenia in patients (compare with genotype CC) aa DTD0015 GENEPOLY rs3765534 Genotypes CT + TT Mercaptopurine Inflammatory Bowel Diseases Correlated with the increased likelihood of leukopenia in patients (compare with genotype CC) aa DTD0015 GENEPOLY rs7317112 SITEOFGP chr13:95271269 (GRCh38.p12) DTD0015 GENEPOLY rs7317112 GPD_TYPE SNP DTD0015 GENEPOLY rs7317112 ALLDBSNP A>G DTD0015 GENEPOLY rs7317112 MAFDBSNP G=0.3922/1964 DTD0015 GENEPOLY rs7317112 Genotype AA Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased mucositis risk in patients (compare with genotypes AG + GG) aa DTD0015 GENEPOLY rs9516519 SITEOFGP chr13:95020203 (GRCh38.p12) DTD0015 GENEPOLY rs9516519 GPD_TYPE SNP DTD0015 GENEPOLY rs9516519 ALLDBSNP T>C / T>G DTD0015 GENEPOLY rs9516519 MAFDBSNP G=0.0591/296 DTD0015 GENEPOLY rs9516519 Genotypes GG + GT Methotrexate Acute B-Cell Leukemia Correlated with the decreased drug plasma level in patients (compare with Genotype TT); Correlated with the decreased toxicity risk in patients (compare with Genotype TT) aa DTD0015 GENEPOLY rs9561765 SITEOFGP chr13:95030989 (GRCh38.p12) DTD0015 GENEPOLY rs9561765 GPD_TYPE SNP DTD0015 GENEPOLY rs9561765 ALLDBSNP G>A DTD0015 GENEPOLY rs9561765 MAFDBSNP A=0.1088/545 DTD0015 GENEPOLY rs9561765 Genotype AG Imatinib Gastrointestinal Stromal Tumors Correlated with the increased drug response in patients (compare with genotype AA) aa DTD0015 GENEPOLY rs9561778 SITEOFGP chr13:95061461 (GRCh38.p12) DTD0015 GENEPOLY rs9561778 GPD_TYPE SNP DTD0015 GENEPOLY rs9561778 ALLDBSNP G>A / G>T DTD0015 GENEPOLY rs9561778 MAFDBSNP T=0.1633/818 DTD0015 GENEPOLY rs9561778 Allele T Fluorouracil Breast Neoplasm Correlated with the increased adverse drug reaction risk in patients (compare with allele G) aa DTD0015 GENEPOLY rs9561778 Allele T Doxorubicin Breast Neoplasm Correlated with the increased adverse drug reaction risk in patients (compare with allele G) aa DTD0015 GENEPOLY rs9561778 Allele T Cyclophosphamide Breast Neoplasm Correlated with the increased adverse drug reaction risk in patients (compare with allele G); Correlated with the increased gastrointestinal toxicity risk in patients (compare with allele G); Correlated with the increased severity of neutropenia in patients (compare with allele G) aa DTD0016 TRANSPID DTD0016 DTD0016 GENENAME ABCC5 DTD0016 PROTNAME Multidrug resistance-associated protein 5 DTD0016 GENEDBID 10057 DTD0016 UNIPROID O15440 DTD0016 GENEPOLY rs10937158 SITEOFGP chr3:183990651 (GRCh38.p12) DTD0016 GENEPOLY rs10937158 GPD_TYPE SNP DTD0016 GENEPOLY rs10937158 ALLDBSNP T>C DTD0016 GENEPOLY rs10937158 MAFDBSNP T=0.3171/1588 DTD0016 GENEPOLY rs10937158 Allele T Irinotecan Colorectal Neoplasm Correlated with the decreased diarrhea risk in patients (compare with genotype CC) aa DTD0016 GENEPOLY rs10937158 Allele T Fluorouracil Colorectal Neoplasm Correlated with the decreased diarrhea risk in patients (compare with genotype CC) aa DTD0016 GENEPOLY rs10937158 Allele T Leucovorin Colorectal Neoplasm Correlated with the decreased diarrhea risk in patients (compare with genotype CC) aa DTD0016 GENEPOLY rs3749438 SITEOFGP chr3:183987396 (GRCh38.p12) DTD0016 GENEPOLY rs3749438 GPD_TYPE SNP DTD0016 GENEPOLY rs3749438 ALLDBSNP G>A DTD0016 GENEPOLY rs3749438 MAFDBSNP A=0.3339/1672 DTD0016 GENEPOLY rs3749438 Allele A Irinotecan Colorectal Neoplasm Correlated with the increased diarrhea risk in patients (compare with genotype GG) aa DTD0016 GENEPOLY rs3749438 Allele A Fluorouracil Colorectal Neoplasm Correlated with the increased diarrhea risk in patients (compare with genotype GG) aa DTD0016 GENEPOLY rs3749438 Allele A Leucovorin Colorectal Neoplasm Correlated with the increased diarrhea risk in patients (compare with genotype GG) aa DTD0017 TRANSPID DTD0017 DTD0017 GENENAME ABCC6 DTD0017 PROTNAME Multidrug resistance-associated protein 6 DTD0017 GENEDBID 368 DTD0017 UNIPROID O95255 DTD0017 GENEPOLY rs2238472 SITEOFGP chr16:16157742 (GRCh38.p12) DTD0017 GENEPOLY rs2238472 GPD_TYPE SNP DTD0017 GENEPOLY rs2238472 ALLDBSNP C>T DTD0017 GENEPOLY rs2238472 MAFDBSNP T=0.1813/908 DTD0017 GENEPOLY rs2238472 Allele C Docetaxel Prostatic Neoplasm Correlated with the increased toxicity risk in patients (compare with Allele T) aa DTD0017 GENEPOLY rs2238472 Allele C Thalidomide Prostatic Neoplasm Correlated with the increased toxicity risk in patients (compare with Allele T) aa DTD0019 TRANSPID DTD0019 DTD0019 GENENAME SLC10A1 DTD0019 PROTNAME Sodium/taurocholate cotransporting polypeptide DTD0019 GENEDBID 6554 DTD0019 UNIPROID Q14973 DTD0020 TRANSPID DTD0020 DTD0020 GENENAME SLC10A2 DTD0020 PROTNAME Apical sodium-dependent bile acid transporter DTD0020 GENEDBID 6555 DTD0020 UNIPROID Q12908 DTD0020 GENEPOLY rs2301159 SITEOFGP chr13:103045378 (GRCh38.p12) DTD0020 GENEPOLY rs2301159 GPD_TYPE SNP DTD0020 GENEPOLY rs2301159 ALLDBSNP G>A DTD0020 GENEPOLY rs2301159 MAFDBSNP A=0.2704/1354 DTD0020 GENEPOLY rs2301159 Allele A Docetaxel Prostatic Neoplasm Correlated with the increased drug toxicity risk in patients (compare with allele G) aa DTD0020 GENEPOLY rs2301159 Allele A Thalidomide Prostatic Neoplasm Correlated with the increased drug toxicity risk in patients (compare with allele G) aa DTD0020 GENEPOLY rs7319981 SITEOFGP chr13:103071372 (GRCh38.p12) DTD0020 GENEPOLY rs7319981 GPD_TYPE SNP DTD0020 GENEPOLY rs7319981 ALLDBSNP G>A DTD0020 GENEPOLY rs7319981 MAFDBSNP A=0.3790/1898 DTD0020 GENEPOLY rs7319981 Allele A Daunorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele G) aa DTD0020 GENEPOLY rs7319981 Allele A Doxorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele G) aa DTD0020 GENEPOLY rs7319981 Allele A Anthracyclines Neoplasm Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C) ac DTD0020 GENEPOLY rs9514091 SITEOFGP chr13:103061904 (GRCh38.p12) DTD0020 GENEPOLY rs9514091 GPD_TYPE SNP DTD0020 GENEPOLY rs9514091 ALLDBSNP G>A DTD0020 GENEPOLY rs9514091 MAFDBSNP A=0.2346/1175 DTD0020 GENEPOLY rs9514091 Allele A Daunorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele G) aa DTD0020 GENEPOLY rs9514091 Allele A Doxorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele G) aa DTD0020 GENEPOLY rs9514091 Allele A Anthracyclines Neoplasm Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C) ac DTD0021 TRANSPID DTD0021 DTD0021 GENENAME SLC15A1 DTD0021 PROTNAME Peptide transporter 1 DTD0021 GENEDBID 6564 DTD0021 UNIPROID P46059 DTD0022 TRANSPID DTD0022 DTD0022 GENENAME SLC15A2 DTD0022 PROTNAME Peptide transporter 2 DTD0022 GENEDBID 6565 DTD0022 UNIPROID Q16348 DTD0022 GENEPOLY rs2257212 SITEOFGP chr3:121924957 (GRCh38.p12) DTD0022 GENEPOLY rs2257212 GPD_TYPE SNP DTD0022 GENEPOLY rs2257212 ALLDBSNP C>G / C>T DTD0022 GENEPOLY rs2257212 MAFDBSNP T=0.4519/2263 DTD0022 GENEPOLY rs2257212 Genotype CC Sorafenib Hepatocellular Carcinoma Correlated with the decreased progression-free survival in patients (compare with Genotypes CT + TT) aa DTD0023 TRANSPID DTD0023 DTD0023 GENENAME SLC22A5 DTD0023 PROTNAME Organic cation/carnitine transporter 2 DTD0023 GENEDBID 6584 DTD0023 UNIPROID O76082 DTD0023 GENEPOLY rs2631367 SITEOFGP chr5:132369766 (GRCh38.p12) DTD0023 GENEPOLY rs2631367 GPD_TYPE SNP DTD0023 GENEPOLY rs2631367 ALLDBSNP C>G DTD0023 GENEPOLY rs2631367 MAFDBSNP C=0.2670/1337 DTD0023 GENEPOLY rs2631367 Genotypes CG + GG Imatinib Gastrointestinal Stromal Tumors Correlated with the increased drug response in patients (compare with genotype CC) aa DTD0023 GENEPOLY rs2631372 SITEOFGP chr5:132367886 (GRCh38.p12) DTD0023 GENEPOLY rs2631372 GPD_TYPE SNP DTD0023 GENEPOLY rs2631372 ALLDBSNP G>C DTD0023 GENEPOLY rs2631372 MAFDBSNP C=0.3347/1676 DTD0023 GENEPOLY rs2631372 Genotypes CG + GG Imatinib Gastrointestinal Stromal Tumors Correlated with the increased drug response in patients (compare with genotype CC) aa DTD0023 GENEPOLY rs274558 SITEOFGP chr5:132385482 (GRCh38.p12) DTD0023 GENEPOLY rs274558 GPD_TYPE SNP DTD0023 GENEPOLY rs274558 ALLDBSNP A>G DTD0023 GENEPOLY rs274558 MAFDBSNP G=0.4862/2435 DTD0023 GENEPOLY rs274558 Genotypes AA + AG Imatinib Gastrointestinal Stromal Tumors Correlated with the decreased periorbital edema risk in patients (compare with genotype GG) aa DTD0024 TRANSPID DTD0024 DTD0024 GENENAME SLC22A6 DTD0024 PROTNAME Organic anion transporter 1 DTD0024 GENEDBID 9356 DTD0024 UNIPROID Q4U2R8 DTD0024 GENEPOLY rs11568626 SITEOFGP chr11:62984542 (GRCh38.p12) DTD0024 GENEPOLY rs11568626 GPD_TYPE SNP DTD0024 GENEPOLY rs11568626 ALLDBSNP C>A / C>G / C>T DTD0024 GENEPOLY rs11568626 MAFDBSNP T=0.0186/93 DTD0024 GENEPOLY rs11568626 Allele T Cidofovir Cytomegalovirus Infection Correlated with the decreased the drug K(m) (compare with Allele C); Irrelevant to the increased drug toxicity risk in patients (compare with allele C) aa DTD0024 GENEPOLY rs11568626 Allele T Tenofovir HIV Infection Correlated with the decreased the drug K(m) (compare with Allele C); Irrelevant to the increased drug toxicity risk in patients (compare with allele C) aa DTD0024 GENEPOLY rs11568626 Allele T Methotrexate Acute B-Cell Leukemia Irrelevant to the the drug uptake (compare wuth Allele C) aa DTD0024 GENEPOLY rs11568626 Allele T Adefovir Dipivoxil Hepatitis B Correlated with the decreased the drug K(m) (compare with Allele C); Irrelevant to the increased drug toxicity risk in patients (compare with allele C) aa DTD0024 GENEPOLY rs11568626 Allele T Aminohippurate Cancer Irrelevant to the the drug uptake (compare wuth Allele C) ac DTD0024 GENEPOLY rs11568634 SITEOFGP chr11:62979488 (GRCh38.p12) DTD0024 GENEPOLY rs11568634 GPD_TYPE SNP DTD0024 GENEPOLY rs11568634 ALLDBSNP C>T DTD0024 GENEPOLY rs11568634 MAFDBSNP N.A. DTD0024 GENEPOLY rs11568634 Allele T Adefovir Dipivoxil HBV Infection Correlated with the decreased drug uptake (compare with Allele C) aa DTD0024 GENEPOLY rs11568634 Allele T Adefovir Dipivoxil Hepatitis B Correlated with the decreased drug uptake (compare with Allele C); Irrelevant to the drug clearance in patients (compare with Allele C); Irrelevant to the nephrotoxicity risk in patients (compare with Allele C) aa DTD0025 TRANSPID DTD0025 DTD0025 GENENAME SLC22A8 DTD0025 PROTNAME Organic anion transporter 3 DTD0025 GENEDBID 9376 DTD0025 UNIPROID Q8TCC7 DTD0025 GENEPOLY rs11568482 SITEOFGP chr11:62995792 (GRCh38.p12) DTD0025 GENEPOLY rs11568482 GPD_TYPE SNP DTD0025 GENEPOLY rs11568482 ALLDBSNP T>A DTD0025 GENEPOLY rs11568482 MAFDBSNP A=0.0134/67 DTD0025 GENEPOLY rs11568482 Allele A Cefotaxime Upper Respiratory Tract Infections and Bacterial Meningitis Correlated with the decreased transport of drug (compare with Allele T) aa DTD0025 GENEPOLY rs11568482 Genotype AT Cefotaxime Healthy Individuals Correlated with the decreased drug clearance in healthy individuals (compare with Genotype TT) aa DTD0026 TRANSPID DTD0026 DTD0026 GENENAME SLC22A11 DTD0026 PROTNAME Organic anion transporter 4 DTD0026 GENEDBID 55867 DTD0026 UNIPROID Q9NSA0 DTD0026 GENEPOLY rs11231809 SITEOFGP chr11:64535478 (GRCh38.p12) DTD0026 GENEPOLY rs11231809 GPD_TYPE SNP DTD0026 GENEPOLY rs11231809 ALLDBSNP T>A DTD0026 GENEPOLY rs11231809 MAFDBSNP A=0.2802/1403 DTD0026 GENEPOLY rs11231809 Genotypes AT + TT Methotrexate Rheumatoid Arthritis Correlated with the decreased drug response in patients (compare with genotype AA) aa DTD0027 TRANSPID DTD0027 DTD0027 GENENAME SLC22A12 DTD0027 PROTNAME Urate anion exchanger 1 DTD0027 GENEDBID 116085 DTD0027 UNIPROID Q96S37 DTD0027 GENEPOLY rs11231825 SITEOFGP chr11:64592802 (GRCh38.p12) DTD0027 GENEPOLY rs11231825 GPD_TYPE SNP DTD0027 GENEPOLY rs11231825 ALLDBSNP T>C DTD0027 GENEPOLY rs11231825 MAFDBSNP C=0.3860/1933 DTD0027 GENEPOLY rs11231825 Genotype TT Cytarabine Acute Myeloid Leukemia Correlated with the increased likelihood of fever in patients (compare with genotypes CC + CT) aa DTD0027 GENEPOLY rs11231825 Genotype TT Fludarabine Acute Myeloid Leukemia Correlated with the increased likelihood of fever in patients (compare with genotypes CC + CT) aa DTD0027 GENEPOLY rs11231825 Genotype TT Gemtuzumab ozogamicin Acute Myeloid Leukemia Correlated with the increased likelihood of fever in patients (compare with genotypes CC + CT) aa DTD0027 GENEPOLY rs11231825 Genotype TT Idarubicin Acute Myeloid Leukemia Correlated with the increased likelihood of fever in patients (compare with genotypes CC + CT) aa DTD0028 TRANSPID DTD0028 DTD0028 GENENAME SLC47A2 DTD0028 PROTNAME Multidrug and toxin extrusion protein 2 DTD0028 GENEDBID 146802 DTD0028 UNIPROID Q86VL8 DTD0028 GENEPOLY rs12943590 SITEOFGP chr17:19716685 (GRCh38.p12) DTD0028 GENEPOLY rs12943590 GPD_TYPE SNP DTD0028 GENEPOLY rs12943590 ALLDBSNP G>A DTD0028 GENEPOLY rs12943590 MAFDBSNP A=0.3155/1580 DTD0028 GENEPOLY rs12943590 Allele A Metformin Polycystic Ovary Syndrome Irrelevant to the drug response in patients (compare with Allele G) aa DTD0028 GENEPOLY rs12943590 Allele A Metformin Healthy Individuals Irrelevant to the steady-state concentration of metformin in healthy individuals (compare with Allele G) aa DTD0028 GENEPOLY rs12943590 Genotype AA Metformin Healthy Individuals Correlated with the decreased drug response in healthy individuals (compare with genotypes AG + GG); Correlated with the increased drug renal clearance and secretion clearance in healthy individuals (compare with genotype GG); Irrelevant to the differences in the plasma metformin concentration versus time curve or the maximum metformin concentration in healthy individuals (compare with genotype GG); Irrelevant to the drug glucose-lowering effect in healthy individuals (compare with genotype GG) aa DTD0028 GENEPOLY rs12943590 Genotype AA Metformin Diabetes Mellitus Correlated with the decreased drug response in patients (compare with genotypes AG + GG) aa DTD0028 GENEPOLY rs12943590 Genotype GG Metformin Healthy Individuals Irrelevant to the increased drug clearance in healthy individuals (compare with genotypes AA + AG) aa DTD0028 GENEPOLY rs12943590 Genotypes AA + AG Metformin Healthy Individuals Correlated with the increased renal and secretory drug clearance in healthy individuals (compare with genotype GG) aa DTD0028 GENEPOLY rs34834489 SITEOFGP chr17:19716951 (GRCh38.p12) DTD0028 GENEPOLY rs34834489 GPD_TYPE SNP DTD0028 GENEPOLY rs34834489 ALLDBSNP G>A DTD0028 GENEPOLY rs34834489 MAFDBSNP A=0.2694/1349 DTD0028 GENEPOLY rs34834489 Genotype AA Metformin Healthy Individuals Correlated with the increased drug renal clearance and secretion clearance in healthy individuals (compare with genotype GG); Irrelevant to the differences in the plasma metformin concentration versus time curve or the maximum drug concentration in healthy individuals (compare with genotype GG); Irrelevant to the drug glucose-lowering effect in healthy individuals (compare with genotype GG) aa DTD0029 TRANSPID DTD0029 DTD0029 GENENAME SLCO1A2 DTD0029 PROTNAME Organic anion transporting polypeptide 1A2 DTD0029 GENEDBID 6579 DTD0029 UNIPROID P46721 DTD0029 GENEPOLY rs3764043 SITEOFGP chr12:21335070 (GRCh38.p12) DTD0029 GENEPOLY rs3764043 GPD_TYPE SNP DTD0029 GENEPOLY rs3764043 ALLDBSNP C>T DTD0029 GENEPOLY rs3764043 MAFDBSNP T=0.0877/439 DTD0029 GENEPOLY rs3764043 Genotype CC Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the decreased drug clearance in patients (compare with Genotypes CT + TT) aa DTD0029 GENEPOLY rs3834939 SITEOFGP chr12:21334836-21334838 (GRCh38.p12) DTD0029 GENEPOLY rs3834939 GPD_TYPE Indel Insertion and Deletion DTD0029 GENEPOLY rs3834939 ALLDBSNP dupT DTD0029 GENEPOLY rs3834939 MAFDBSNP T=0.3708/1857 DTD0029 GENEPOLY rs3834939 Genotypes T/del + TT Rocuronium Healthy Individuals Correlated with the decreased drug clearance in healthy individuals (compare with genotype del/del) aa DTD0030 TRANSPID DTD0030 DTD0030 GENENAME SLCO1B3 DTD0030 PROTNAME Organic anion transporting polypeptide 1B3 DTD0030 GENEDBID 28234 DTD0030 UNIPROID Q9NPD5 DTD0030 GENEPOLY rs11045585 SITEOFGP chr12:20892760 (GRCh38.p12) DTD0030 GENEPOLY rs11045585 GPD_TYPE SNP DTD0030 GENEPOLY rs11045585 ALLDBSNP A>G DTD0030 GENEPOLY rs11045585 MAFDBSNP G=0.1552/777 DTD0030 GENEPOLY rs11045585 Allele G Docetaxel Neoplasm Correlated with the increased leukopenia risk in patients (compare with Allele A) aa DTD0030 GENEPOLY rs4149117 SITEOFGP chr12:20858546 (GRCh38.p12) DTD0030 GENEPOLY rs4149117 GPD_TYPE SNP DTD0030 GENEPOLY rs4149117 ALLDBSNP T>C / T>G DTD0030 GENEPOLY rs4149117 MAFDBSNP T=0.2975/1490 DTD0030 GENEPOLY rs4149117 Allele G Mycophenolate mofetil Kidney Transplantation Correlated with the decreased dose-normalized Cmax and dose-normalized AUC0to12 h in patients (compare with Allele T); Correlated with the increased adverse drug reactions risk in patients (compare with Allele T); Irrelevant to the drug clearance in patients (compare with Allele T) aa DTD0030 GENEPOLY rs4149117 Allele T Mycophenolate mofetil Kidney Transplantation Irrelevant to the increased leukopenia risk in patients (compare with allele G) aa DTD0030 GENEPOLY rs4149117 Genotype GG Sunitinib Gastrointestinal Stromal Tumors Correlated with the decreased overall survival in patients (compare with Genotypes GT + TT) aa DTD0030 GENEPOLY rs4149117 Genotype GG Paclitaxel Non-Small-Cell Lung Carcinoma Correlated with the increased anemia risk in patients (compare with Genotypes GT + TT) aa DTD0030 GENEPOLY rs4149117 Genotype GG Carboplatin Non-Small-Cell Lung Carcinoma Correlated with the increased anemia risk in patients (compare with Genotypes GT + TT) aa DTD0030 GENEPOLY rs4149117 Genotype GG Mycophenolate mofetil Kidney Transplantation Correlated with the increased dose-adjusted area under the curve of mycophenolic acid in patients (AUC6-12) (compare with Genotype TT) aa DTD0030 GENEPOLY rs4149117 Genotype TT Mycophenolate mofetil Kidney Transplantation Correlated with the increased diarrhea risk in patients (compare with genotype GG); Correlated with the increased diarrhea risk in patients (compare with genotype Gt) aa DTD0030 GENEPOLY rs4149117 Genotypes GT + TT Paclitaxel Lung Neoplasm; Malignant Tumor Of Peritoneum; Ovarian Neoplasm; Uterine Neoplasm Correlated with the decreased likelihood of thrombocytopenia in patients (compare with genotype GG) aa DTD0030 GENEPOLY rs4149117 Genotypes GT + TT Carboplatin Lung Neoplasm; Malignant Tumor Of Peritoneum; Ovarian Neoplasm; Uterine Neoplasm Correlated with the decreased likelihood of thrombocytopenia in patients (compare with genotype GG) aa DTD0030 GENEPOLY rs7311358 SITEOFGP chr12:20862826 (GRCh38.p12) DTD0030 GENEPOLY rs7311358 GPD_TYPE SNP DTD0030 GENEPOLY rs7311358 ALLDBSNP G>A DTD0030 GENEPOLY rs7311358 MAFDBSNP G=0.2975/1490 DTD0030 GENEPOLY rs7311358 Allele A Mycophenolate mofetil Kidney Transplantation Correlated with the decreased drug clearance in patients (compare with allele G); Irrelevant to the drug clearance in patients (compare with allele G) aa DTD0030 GENEPOLY rs7311358 Allele A Paclitaxel Non-Small-Cell Lung Carcinoma Correlated with the decreased transport of drug (compare with allele G) aa DTD0030 GENEPOLY rs7311358 Genotype AA Paclitaxel Non-Small-Cell Lung Carcinoma Correlated with the increased anemia risk in patients (compare with genotypes AG + GG) aa DTD0030 GENEPOLY rs7311358 Genotype AA Carboplatin Non-Small-Cell Lung Carcinoma Correlated with the increased anemia risk in patients (compare with genotypes AG + GG) aa DTD0030 GENEPOLY rs7311358 Genotype AA Mycophenolate mofetil Kidney Transplantation Correlated with the increased dose-adjusted area under the curve (AUC6-12) of mycophenolic acid in patients (compare with genotype GG) aa DTD0031 TRANSPID DTD0031 DTD0031 GENENAME SLCO2B1 DTD0031 PROTNAME Organic anion transporting polypeptide 2B1 DTD0031 GENEDBID 11309 DTD0031 UNIPROID O94956 DTD0031 GENEPOLY rs12422149 SITEOFGP chr11:75172532 (GRCh38.p12) DTD0031 GENEPOLY rs12422149 GPD_TYPE SNP DTD0031 GENEPOLY rs12422149 ALLDBSNP G>A / G>T DTD0031 GENEPOLY rs12422149 MAFDBSNP A=0.2099/1051 DTD0031 GENEPOLY rs12422149 Allele A Montelukast Healthy Individuals Irrelevant to the drug clearance in healthy individuals (compare with allele G) aa DTD0031 GENEPOLY rs12422149 Genotype AG Montelukast Asthma Correlated with the decreased drug response in patients (compare with genotype GG) aa DTD0031 GENEPOLY rs2306168 SITEOFGP chr11:75196537 (GRCh38.p12) DTD0031 GENEPOLY rs2306168 GPD_TYPE SNP DTD0031 GENEPOLY rs2306168 ALLDBSNP C>T DTD0031 GENEPOLY rs2306168 MAFDBSNP T=0.1803/903 DTD0031 GENEPOLY rs2306168 Allele T Fexofenadine Healthy Individuals Correlated with the decreased area under the plasma concentration-time curve (AUC) in healthy individuals (compare with genotype CC) aa DTD0034 TRANSPID DTD0034 DTD0034 GENENAME SLC18A2 DTD0034 PROTNAME Vesicular amine transporter 2 DTD0034 GENEDBID 6571 DTD0034 UNIPROID Q05940 DTD0034 GENEPOLY rs363341 SITEOFGP chr10:117250954 (GRCh38.p12) DTD0034 GENEPOLY rs363341 GPD_TYPE SNP DTD0034 GENEPOLY rs363341 ALLDBSNP C>T DTD0034 GENEPOLY rs363341 MAFDBSNP T=0.3982/1994 DTD0034 GENEPOLY rs363341 Genotype TT Antipsychotics Psychotic Disorders Correlated with the increased drug toxicity risk in patients (compare with genotypes CC + CT) ac DTD0035 TRANSPID DTD0035 DTD0035 GENENAME SLC30A8 DTD0035 PROTNAME Zinc transporter 8 DTD0035 GENEDBID 169026 DTD0035 UNIPROID Q8IWU4 DTD0035 GENEPOLY rs13266634 SITEOFGP chr8:117172544 (GRCh38.p12) DTD0035 GENEPOLY rs13266634 GPD_TYPE SNP DTD0035 GENEPOLY rs13266634 ALLDBSNP C>A / C>T DTD0035 GENEPOLY rs13266634 MAFDBSNP T=0.2552/1278 DTD0035 GENEPOLY rs13266634 Genotypes CT + TT Repaglinide Diabetes Mellitus Correlated with the increased drug response in patients (compare with genotype CC) aa DTD0035 GENEPOLY rs13266634 Genotypes CT + TT Zinc Acetate Healthy Individuals Correlated with the increased drug response in healthy individuals (compare with genotype CC) aa DTD0035 GENEPOLY rs13266634 Genotypes CT + TT Insulin recombinant Healthy Individuals Correlated with the increased drug response in healthy individuals (compare with genotype CC) aa DTD0036 TRANSPID DTD0036 DTD0036 GENENAME ABCA1 DTD0036 PROTNAME ATP-binding cassette sub-family A member 1 DTD0036 GENEDBID 19 DTD0036 UNIPROID O95477 DTD0036 GENEPOLY rs12003906 SITEOFGP chr9:104883196 (GRCh38.p12) DTD0036 GENEPOLY rs12003906 GPD_TYPE SNP DTD0036 GENEPOLY rs12003906 ALLDBSNP G>C / G>T DTD0036 GENEPOLY rs12003906 MAFDBSNP T=0.0665/333 DTD0036 GENEPOLY rs12003906 Allele C Atorvastatin Hyperlipidemias Correlated with the decreased drug response in patients (compare with Allele G) aa DTD0036 GENEPOLY rs12003906 Allele C Pravastatin Hyperlipidemias Correlated with the decreased drug response in patients (compare with Allele G) aa DTD0036 GENEPOLY rs12003906 Allele C Simvastatin Hyperlipidemias Correlated with the decreased drug response in patients (compare with Allele G) aa DTD0036 GENEPOLY rs2230806 SITEOFGP chr9:104858586 (GRCh38.p12) DTD0036 GENEPOLY rs2230806 GPD_TYPE SNP DTD0036 GENEPOLY rs2230806 ALLDBSNP C>T DTD0036 GENEPOLY rs2230806 MAFDBSNP T=0.4397/2202 DTD0036 GENEPOLY rs2230806 Genotype TT Pravastatin Coronary Disease Correlated with the increased HDL-cholesterol in patients (compare with genotype CC) aa DTD0036 GENEPOLY rs2230806 Genotype CT Fenofibrate Hypertriglyceridemia Correlated with the increased drug response in patients (compare with genotype CC) aa DTD0036 GENEPOLY rs2230806 Genotype TT Fenofibrate Hypertriglyceridemia Correlated with the increased drug response in patients (compare with genotype CC) aa DTD0036 GENEPOLY rs2230808 SITEOFGP chr9:104800523 (GRCh38.p12) DTD0036 GENEPOLY rs2230808 GPD_TYPE SNP DTD0036 GENEPOLY rs2230808 ALLDBSNP T>C DTD0036 GENEPOLY rs2230808 MAFDBSNP T=0.4617/2312 DTD0036 GENEPOLY rs2230808 Genotype CC Fenofibrate Hypertriglyceridemia Correlated with the increased drug response in patients (compare with Genotype TT) aa DTD0037 TRANSPID DTD0037 DTD0037 GENENAME ABCA10 DTD0037 PROTNAME ATP-binding cassette sub-family A member 10 DTD0037 GENEDBID 10349 DTD0037 UNIPROID Q8WWZ4 DTD0038 TRANSPID DTD0038 DTD0038 GENENAME ABCA12 DTD0038 PROTNAME ATP-binding cassette sub-family A member 12 DTD0038 GENEDBID 26154 DTD0038 UNIPROID Q86UK0 DTD0040 TRANSPID DTD0040 DTD0040 GENENAME ABCA2 DTD0040 PROTNAME ATP-binding cassette sub-family A member 2 DTD0040 GENEDBID 20 DTD0040 UNIPROID Q9BZC7 DTD0040 GENEPOLY rs241453 SITEOFGP chr6:32828449 (GRCh38.p12) DTD0040 GENEPOLY rs241453 GPD_TYPE SNP DTD0040 GENEPOLY rs241453 ALLDBSNP G>A DTD0040 GENEPOLY rs241453 MAFDBSNP A=0.2290/849 DTD0040 GENEPOLY rs241453 Allele G Anti-Ro/SSA production Systemic Lupus Erythematosus Correlated with the predisposition to systemic lupus erythematosus (compare with allele A) ac DTD0041 TRANSPID DTD0041 DTD0041 GENENAME ABCA3 DTD0041 PROTNAME ATP-binding cassette sub-family A member 3 DTD0041 GENEDBID 21 DTD0041 UNIPROID Q99758 DTD0041 GENEPOLY rs13332514 SITEOFGP chr16:2317335 (GRCh38.p12) DTD0041 GENEPOLY rs13332514 GPD_TYPE SNP DTD0041 GENEPOLY rs13332514 ALLDBSNP G>A DTD0041 GENEPOLY rs13332514 MAFDBSNP A=0.0873/391 DTD0041 GENEPOLY rs13332514 Allele T N.A. Respiratory Distress Syndrome Correlated with the chronic lung disease in very premature infants (compare with allele C) ad DTD0042 TRANSPID DTD0042 DTD0042 GENENAME ABCA4 DTD0042 PROTNAME ATP-binding cassette sub-family A member 4 DTD0042 GENEDBID 24 DTD0042 UNIPROID P78363 DTD0043 TRANSPID DTD0043 DTD0043 GENENAME ABCA5 DTD0043 PROTNAME ATP-binding cassette sub-family A member 5 DTD0043 GENEDBID 23461 DTD0043 UNIPROID Q8WWZ7 DTD0044 TRANSPID DTD0044 DTD0044 GENENAME ABCA6 DTD0044 PROTNAME ATP-binding cassette sub-family A member 6 DTD0044 GENEDBID 23460 DTD0044 UNIPROID Q8N139 DTD0045 TRANSPID DTD0045 DTD0045 GENENAME ABCA7 DTD0045 PROTNAME ATP-binding cassette sub-family A member 7 DTD0045 GENEDBID 10347 DTD0045 UNIPROID Q8IZY2 DTD0045 GENEPOLY rs200538373 SITEOFGP chr19:1061893 (GRCh38.p12) DTD0045 GENEPOLY rs200538373 GPD_TYPE SNP DTD0045 GENEPOLY rs200538373 ALLDBSNP G>A / G>C DTD0045 GENEPOLY rs200538373 MAFDBSNP C=0.0010/5 DTD0045 GENEPOLY rs200538373 Allele C N.A. Alzheimer's disease Correlated with the increased risk of alzheimer's disease (compare with allele G) ad DTD0045 GENEPOLY rs200538373 Allele C N.A. Alzheimer's disease Irrelevant to the significantly decreased the expression of transport (compare with allele G) ad DTD0045 GENEPOLY rs3764650 SITEOFGP chr19:1046521 (GRCh38.p12) DTD0045 GENEPOLY rs3764650 GPD_TYPE SNP DTD0045 GENEPOLY rs3764650 ALLDBSNP T>G DTD0045 GENEPOLY rs3764650 MAFDBSNP G=0.0641/287 DTD0045 GENEPOLY rs3764650 Allele G N.A. Alzheimer's disease Correlated with the modest increased risk of alzheimer's disease (compare with allele T) ad DTD0045 GENEPOLY rs3764650 Allele G N.A. Alzheimer's disease Correlated with the significantly decreased the expression of transport (compare with allele T) ad DTD0046 TRANSPID DTD0046 DTD0046 GENENAME ABCA8 DTD0046 PROTNAME ATP-binding cassette sub-family A member 8 DTD0046 GENEDBID 10351 DTD0046 UNIPROID O94911 DTD0047 TRANSPID DTD0047 DTD0047 GENENAME ABCA9 DTD0047 PROTNAME ATP-binding cassette sub-family A member 9 DTD0047 GENEDBID 10350 DTD0047 UNIPROID Q8IUA7 DTD0051 TRANSPID DTD0051 DTD0051 GENENAME ABCB5 DTD0051 PROTNAME ATP-binding cassette sub-family B member 5 DTD0051 GENEDBID 340273 DTD0051 UNIPROID Q2M3G0 DTD0051 GENEPOLY rs17143212 SITEOFGP chr7:20643261 (GRCh38.p12) DTD0051 GENEPOLY rs17143212 GPD_TYPE SNP DTD0051 GENEPOLY rs17143212 ALLDBSNP C>T DTD0051 GENEPOLY rs17143212 MAFDBSNP T=0.0705/353 DTD0051 GENEPOLY rs17143212 Genotype CT Haloperidol Psychotic Disorders Correlated with the increased drug toxicity in patients (compare with genotype CC) aa DTD0052 TRANSPID DTD0052 DTD0052 GENENAME ABCB6 DTD0052 PROTNAME ATP-binding cassette sub-family B member 6 DTD0052 GENEDBID 10058 DTD0052 UNIPROID Q9NP58 DTD0053 TRANSPID DTD0053 DTD0053 GENENAME ABCB7 DTD0053 PROTNAME ABC transporter 7 protein DTD0053 GENEDBID 22 DTD0053 UNIPROID O75027 DTD0054 TRANSPID DTD0054 DTD0054 GENENAME ABCB8 DTD0054 PROTNAME ATP-binding cassette sub-family B member 8 DTD0054 GENEDBID 11194 DTD0054 UNIPROID Q9NUT2 DTD0055 TRANSPID DTD0055 DTD0055 GENENAME ABCB9 DTD0055 PROTNAME TAP-like protein DTD0055 GENEDBID 23457 DTD0055 UNIPROID Q9NP78 DTD0056 TRANSPID DTD0056 DTD0056 GENENAME ABCC10 DTD0056 PROTNAME Multidrug resistance-associated protein 7 DTD0056 GENEDBID 89845 DTD0056 UNIPROID Q5T3U5 DTD0056 GENEPOLY rs2125739 SITEOFGP chr6:43445127 (GRCh38.p12) DTD0056 GENEPOLY rs2125739 GPD_TYPE SNP DTD0056 GENEPOLY rs2125739 ALLDBSNP T>C DTD0056 GENEPOLY rs2125739 MAFDBSNP C=0.2001/1002 DTD0056 GENEPOLY rs2125739 Genotype CC Nevirapine HIV Infection Correlated with the increased likelihood of lower nevirapine plasma concentrations in patients (compare with Genotypes CT + TT) aa DTD0056 GENEPOLY rs9349256 SITEOFGP chr6:43436773 (GRCh38.p12) DTD0056 GENEPOLY rs9349256 GPD_TYPE SNP DTD0056 GENEPOLY rs9349256 ALLDBSNP G>A DTD0056 GENEPOLY rs9349256 MAFDBSNP A=0.3646/1826 DTD0056 GENEPOLY rs9349256 Allele G Tenofovir HIV Infection Correlated with the increased kidney tubular dysfunction in patients (compare with Allele A) aa DTD0057 TRANSPID DTD0057 DTD0057 GENENAME ABCC11 DTD0057 PROTNAME Multidrug resistance-associated protein 8 DTD0057 GENEDBID 85320 DTD0057 UNIPROID Q96J66 DTD0057 GENEPOLY rs7194667 SITEOFGP chr16:48208987 (GRCh38.p12) DTD0057 GENEPOLY rs7194667 GPD_TYPE SNP DTD0057 GENEPOLY rs7194667 ALLDBSNP T>G DTD0057 GENEPOLY rs7194667 MAFDBSNP G=0.0421/211 DTD0057 GENEPOLY rs7194667 Genotypes GG + GT Fluorouracil Neoplasm Correlated with the increased leukopenia risk in patients (compare with Genotype TT) aa DTD0060 TRANSPID DTD0060 DTD0060 GENENAME ABCC7 DTD0060 PROTNAME Cystic fibrosis transmembrane conductance regulator DTD0060 GENEDBID 1080 DTD0060 UNIPROID P13569 DTD0061 TRANSPID DTD0061 DTD0061 GENENAME ABCC8 DTD0061 PROTNAME Sulfonylurea receptor 1 DTD0061 GENEDBID 6833 DTD0061 UNIPROID Q09428 DTD0061 GENEPOLY rs757110 SITEOFGP chr11:17396930 (GRCh38.p12) DTD0061 GENEPOLY rs757110 GPD_TYPE SNP DTD0061 GENEPOLY rs757110 ALLDBSNP C>A / C>T DTD0061 GENEPOLY rs757110 MAFDBSNP C=0.2736/1370 DTD0061 GENEPOLY rs757110 Allele C Glibenclamide Diabetes Mellitus Irrelevant to the decreased hemoglobin levels in patients (compare with Allele A) aa DTD0061 GENEPOLY rs757110 Allele C Glimepiride Diabetes Mellitus Irrelevant to the decreased hemoglobin levels in patients (compare with Allele A) aa DTD0061 GENEPOLY rs757110 Allele C Glipizide Diabetes Mellitus Irrelevant to the decreased hemoglobin levels in patients (compare with Allele A) aa DTD0061 GENEPOLY rs757110 Genotypes AA + CC Sulfonamides Diabetes Mellitus Correlated with the increased drug response in patients (compare with genotype AC) aa DTD0061 GENEPOLY rs757110 Allele C Gliclazide Diabetes Mellitus Irrelevant to the decreased hemoglobin levels in patients (compare with Allele A) aa DTD0061 GENEPOLY rs757110 Allele C Gliquidone Diabetes Mellitus Irrelevant to the decreased hemoglobin levels in patients (compare with Allele A) aa DTD0061 GENEPOLY rs757110 Genotypes AA + CC Urea derivatives Diabetes Mellitus Correlated with the increased drug response in patients (compare with genotype AC) ac DTD0062 TRANSPID DTD0062 DTD0062 GENENAME ABCC9 DTD0062 PROTNAME Sulfonylurea receptor 2 DTD0062 GENEDBID 10060 DTD0062 UNIPROID O60706 DTD0062 GENEPOLY rs704212 SITEOFGP chr12:21891410 (GRCh38.p12) DTD0062 GENEPOLY rs704212 GPD_TYPE SNP DTD0062 GENEPOLY rs704212 ALLDBSNP C>T DTD0062 GENEPOLY rs704212 MAFDBSNP T=0.2636/1320 DTD0062 GENEPOLY rs704212 Allele T Montelukast Healthy Individuals Correlated with the decreased drug concentration in healthy individuals (compare with allele C) aa DTD0063 TRANSPID DTD0063 DTD0063 GENENAME ABCD1 DTD0063 PROTNAME Adrenoleukodystrophy protein DTD0063 GENEDBID 215 DTD0063 UNIPROID P33897 DTD0064 TRANSPID DTD0064 DTD0064 GENENAME ABCD2 DTD0064 PROTNAME Adrenoleukodystrophy-like 1 DTD0064 GENEDBID 225 DTD0064 UNIPROID Q9UBJ2 DTD0065 TRANSPID DTD0065 DTD0065 GENENAME ABCD3 DTD0065 PROTNAME ATP-binding cassette sub-family D member 3 DTD0065 GENEDBID 5825 DTD0065 UNIPROID P28288 DTD0066 TRANSPID DTD0066 DTD0066 GENENAME ABCD4 DTD0066 PROTNAME Peroxisomal membrane protein 1-like DTD0066 GENEDBID 5826 DTD0066 UNIPROID O14678 DTD0071 TRANSPID DTD0071 DTD0071 GENENAME ABCG1 DTD0071 PROTNAME ATP-binding cassette sub-family G member 1 DTD0071 GENEDBID 9619 DTD0071 UNIPROID P45844 DTD0071 GENEPOLY rs225440 SITEOFGP chr21:42232943 (GRCh38.p12) DTD0071 GENEPOLY rs225440 GPD_TYPE SNP DTD0071 GENEPOLY rs225440 ALLDBSNP C>T DTD0071 GENEPOLY rs225440 MAFDBSNP T=0.4295/2151 DTD0071 GENEPOLY rs225440 Allele T Irinotecan Colorectal Neoplasm Correlated with the increased neutropenia risk in patients (compare with genotype CC) aa DTD0071 GENEPOLY rs225440 Allele T Fluorouracil Colorectal Neoplasm Correlated with the increased neutropenia risk in patients (compare with genotype CC) aa DTD0071 GENEPOLY rs225440 Allele T Leucovorin Colorectal Neoplasm Correlated with the increased neutropenia risk in patients (compare with genotype CC) aa DTD0074 GENEPOLY rs11887534 SITEOFGP chr2:43839108 (GRCh38.p12) DTD0074 GENEPOLY rs11887534 GPD_TYPE SNP DTD0074 GENEPOLY rs11887534 ALLDBSNP G>A / G>C DTD0074 GENEPOLY rs11887534 MAFDBSNP C=0.0605/303 DTD0074 GENEPOLY rs11887534 Genotype CG Atorvastatin Coronary Artery Disease Correlated with the increase coronary artery disease risk in patients (compare with genotype GG); Irrelevant to the drug response in patients (compare with genotype GG) aa DTD0074 GENEPOLY rs11887534 Genotype GG Atorvastatin Hypercholesterolemia Irrelevant to the drug response in patients (compare with genotype CG) aa DTD0074 GENEPOLY rs11887534 Genotypes CC + CG Atorvastatin Hypercholesterolemia Correlated with the increased drug response in patients (compare with genotype GG) aa DTD0076 TRANSPID DTD0076 DTD0076 GENENAME SLC10A4 DTD0076 PROTNAME Sodium/bile acid cotransporter 4 DTD0076 GENEDBID 201780 DTD0076 UNIPROID Q96EP9 DTD0077 TRANSPID DTD0077 DTD0077 GENENAME SLC10A5 DTD0077 PROTNAME Sodium/bile acid cotransporter 5 DTD0077 GENEDBID 347051 DTD0077 UNIPROID Q5PT55 DTD0078 TRANSPID DTD0078 DTD0078 GENENAME SLC10A6 DTD0078 PROTNAME Sodium-dependent organic anion transporter DTD0078 GENEDBID 345274 DTD0078 UNIPROID Q3KNW5 DTD0079 TRANSPID DTD0079 DTD0079 GENENAME SLC10A7 DTD0079 PROTNAME Sodium/bile acid cotransporter 7 DTD0079 GENEDBID 84068 DTD0079 UNIPROID Q0GE19 DTD0080 TRANSPID DTD0080 DTD0080 GENENAME SLC11A1 DTD0080 PROTNAME Natural resistance-associated macrophage protein 1 DTD0080 GENEDBID 6556 DTD0080 UNIPROID P49279 DTD0081 TRANSPID DTD0081 DTD0081 GENENAME SLC11A2 DTD0081 PROTNAME Natural resistance-associated macrophage protein 2 DTD0081 GENEDBID 4891 DTD0081 UNIPROID P49281 DTD0082 TRANSPID DTD0082 DTD0082 GENENAME SLC12A1 DTD0082 PROTNAME Bumetanide-sensitive sodium-(potassium)-chloride cotransporter 2 DTD0082 GENEDBID 6557 DTD0082 UNIPROID Q13621 DTD0083 TRANSPID DTD0083 DTD0083 GENENAME SLC12A2 DTD0083 PROTNAME Bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1 DTD0083 GENEDBID 6558 DTD0083 UNIPROID P55011 DTD0084 TRANSPID DTD0084 DTD0084 GENENAME SLC12A3 DTD0084 PROTNAME Thiazide-sensitive sodium-chloride cotransporter DTD0084 GENEDBID 6559 DTD0084 UNIPROID P55017 DTD0084 GENEPOLY rs13306673 SITEOFGP chr16:56867019 (GRCh38.p12) DTD0084 GENEPOLY rs13306673 GPD_TYPE SNP DTD0084 GENEPOLY rs13306673 ALLDBSNP C>T DTD0084 GENEPOLY rs13306673 MAFDBSNP T=0.1488/745 DTD0084 GENEPOLY rs13306673 Genotype CC Thiazides Essential Hypertension Correlated with the increased reduction in mean blood pressure in patients (compare with Genotypes CT + TT) ac DTD0084 GENEPOLY rs1529927 SITEOFGP chr16:56870675 (GRCh38.p12) DTD0084 GENEPOLY rs1529927 GPD_TYPE SNP DTD0084 GENEPOLY rs1529927 ALLDBSNP C>G DTD0084 GENEPOLY rs1529927 MAFDBSNP C=0.0094/47 DTD0084 GENEPOLY rs1529927 Allele C Torsemide Healthy Individuals Correlated with the increased 24-h excretion of chloride and potassium in healthy individuals (compare with Allele G) aa DTD0084 GENEPOLY rs1529927 Allele C Furosemide Healthy Individuals Correlated with the increased 24-h excretion of chloride and potassium in healthy individuals (compare with Allele G) aa DTD0084 GENEPOLY rs1529927 Allele C Bumetanide Healthy Individuals Correlated with the increased 24-h excretion of chloride and potassium in healthy individuals (compare with Allele G) aa DTD0084 GENEPOLY rs1529927 Genotype CC Torsemide Healthy Individuals Correlated with the increased drug response in healthy individuals (compare with genotype GG) aa DTD0084 GENEPOLY rs1529927 Genotype CC Furosemide Healthy Individuals Correlated with the increased drug response in healthy individuals (compare with genotype GG) aa DTD0084 GENEPOLY rs1529927 Genotype CC Bumetanide Healthy Individuals Correlated with the increased drug response in healthy individuals (compare with genotype GG) aa DTD0085 TRANSPID DTD0085 DTD0085 GENENAME SLC12A4 DTD0085 PROTNAME Electroneutral potassium-chloride cotransporter 1 DTD0085 GENEDBID 6560 DTD0085 UNIPROID Q9UP95 DTD0086 TRANSPID DTD0086 DTD0086 GENENAME SLC12A5 DTD0086 PROTNAME Electroneutral potassium-chloride cotransporter 2 DTD0086 GENEDBID 57468 DTD0086 UNIPROID Q9H2X9 DTD0087 TRANSPID DTD0087 DTD0087 GENENAME SLC12A6 DTD0087 PROTNAME Electroneutral potassium-chloride cotransporter 3 DTD0087 GENEDBID 9990 DTD0087 UNIPROID Q9UHW9 DTD0088 TRANSPID DTD0088 DTD0088 GENENAME SLC12A7 DTD0088 PROTNAME Electroneutral potassium-chloride cotransporter 4 DTD0088 GENEDBID 10723 DTD0088 UNIPROID Q9Y666 DTD0089 TRANSPID DTD0089 DTD0089 GENENAME SLC12A8 DTD0089 PROTNAME Cation-chloride cotransporter 9 DTD0089 GENEDBID 84561 DTD0089 UNIPROID A0AV02 DTD0089 GENEPOLY rs651630 SITEOFGP chr3:125092470 (GRCh38.p12) DTD0089 GENEPOLY rs651630 GPD_TYPE SNP DTD0089 GENEPOLY rs651630 ALLDBSNP G>A DTD0089 GENEPOLY rs651630 MAFDBSNP A=0.3916/1961 DTD0089 GENEPOLY rs651630 Genotype AA Tumor necrosis factor alpha (Tnf-Alpha) inhibitors Psoriasis Correlated with the decreased psoriasis risk in patients (compare with genotypes AG + GG) ac DTD0091 TRANSPID DTD0091 DTD0091 GENENAME SLC13A1 DTD0091 PROTNAME Sodium/sulfate cotransporter 1 DTD0091 GENEDBID 6561 DTD0091 UNIPROID Q9BZW2 DTD0092 TRANSPID DTD0092 DTD0092 GENENAME SLC13A2 DTD0092 PROTNAME Sodium/dicarboxylate cotransporter 1 DTD0092 GENEDBID 9058 DTD0092 UNIPROID Q13183 DTD0093 TRANSPID DTD0093 DTD0093 GENENAME SLC13A3 DTD0093 PROTNAME Sodium/dicarboxylate cotransporter 3 DTD0093 GENEDBID 64849 DTD0093 UNIPROID Q8WWT9 DTD0094 TRANSPID DTD0094 DTD0094 GENENAME SLC13A4 DTD0094 PROTNAME Na(+)/sulfate cotransporter SUT-1 DTD0094 GENEDBID 26266 DTD0094 UNIPROID Q9UKG4 DTD0095 TRANSPID DTD0095 DTD0095 GENENAME SLC13A5 DTD0095 PROTNAME Sodium-coupled citrate transporter DTD0095 GENEDBID 284111 DTD0095 UNIPROID Q86YT5 DTD0096 TRANSPID DTD0096 DTD0096 GENENAME SLC14A1 DTD0096 PROTNAME Urea transporter 1 DTD0096 GENEDBID 6563 DTD0096 UNIPROID Q13336 DTD0097 TRANSPID DTD0097 DTD0097 GENENAME SLC14A2 DTD0097 PROTNAME Urea transporter 2 DTD0097 GENEDBID 8170 DTD0097 UNIPROID Q15849 DTD0097 GENEPOLY rs1123617 SITEOFGP chr18:45672918 (GRCh38.p12) DTD0097 GENEPOLY rs1123617 GPD_TYPE SNP DTD0097 GENEPOLY rs1123617 ALLDBSNP G>A / G>T DTD0097 GENEPOLY rs1123617 MAFDBSNP A=0.1703/853 DTD0097 GENEPOLY rs1123617 Genotype AA Nifedipine Hypertension Correlated with the larger mean changes in systolic and diastolic blood pressure in patients (compare with genotype GG) aa DTD0097 GENEPOLY rs1123617 Genotype GA Nifedipine Hypertension Correlated with the larger mean changes in systolic and diastolic blood pressure in patients (compare with genotype GG) aa DTD0097 GENEPOLY rs3745009 SITEOFGP chr18:45682394 (GRCh38.p12) DTD0097 GENEPOLY rs3745009 GPD_TYPE SNP DTD0097 GENEPOLY rs3745009 ALLDBSNP G>A DTD0097 GENEPOLY rs3745009 MAFDBSNP A=0.4277/2142 DTD0097 GENEPOLY rs3745009 Genotype AA Nifedipine Hypertension Correlated with the smaller mean changes in systolic and diastolic blood pressure in patients (compare with genotype GG) aa DTD0097 GENEPOLY rs3745009 Genotype GA Nifedipine Hypertension Correlated with the Smaller mean changes in systolic and diastolic blood pressure in patients (compare with genotype GG) aa DTD0098 TRANSPID DTD0098 DTD0098 GENENAME SLC15A3 DTD0098 PROTNAME Peptide/histidine transporter 2 DTD0098 GENEDBID 51296 DTD0098 UNIPROID Q8IY34 DTD0099 TRANSPID DTD0099 DTD0099 GENENAME SLC15A4 DTD0099 PROTNAME Peptide transporter 4 DTD0099 GENEDBID 121260 DTD0099 UNIPROID Q8N697 DTD0099 GENEPOLY rs1385374 SITEOFGP chr12:128816149 (GRCh38.p12) DTD0099 GENEPOLY rs1385374 GPD_TYPE SNP DTD0099 GENEPOLY rs1385374 ALLDBSNP C>T DTD0099 GENEPOLY rs1385374 MAFDBSNP T=0.0699/313 DTD0099 GENEPOLY rs1385374 Genotypes TT+CT N.A. Systemic Lupus Erythematosus Correlated with the increased the risk of systemic lupus erythematosus in Han Chinese patients (compare with genotype CC) ad DTD0099 GENEPOLY rs3765108 SITEOFGP chr12:128793662 (GRCh38.p12) DTD0099 GENEPOLY rs3765108 GPD_TYPE SNP DTD0099 GENEPOLY rs3765108 ALLDBSNP T>C DTD0099 GENEPOLY rs3765108 MAFDBSNP C=0.2212/1108 DTD0099 GENEPOLY rs3765108 Genotype AG N.A. Systemic Lupus Erythematosus Correlated with the increased risk of systemic lupus erythematosus in Han Chinese patients (compare with genotypes AA +GG) ad DTD0099 GENEPOLY rs7308691 SITEOFGP chr12:128794774 (GRCh38.p12) DTD0099 GENEPOLY rs7308691 GPD_TYPE SNP DTD0099 GENEPOLY rs7308691 ALLDBSNP T>A DTD0099 GENEPOLY rs7308691 MAFDBSNP A=0.2183/1093 DTD0099 GENEPOLY rs7308691 Genotype AT N.A. Systemic Lupus Erythematosus Correlated with the increased risk of systemic lupus erythematosus in Han Chinese patients (compare with genotypes AA +TT) ad DTD0099 GENEPOLY rs959989 SITEOFGP chr12:128808163 (GRCh38.p12) DTD0099 GENEPOLY rs959989 GPD_TYPE SNP DTD0099 GENEPOLY rs959989 ALLDBSNP A>T DTD0099 GENEPOLY rs959989 MAFDBSNP T=0.0699/313 DTD0099 GENEPOLY rs959989 Allele T N.A. Systemic Lupus Erythematosus Correlated with the increased risk of systemic lupus erythematosus in Han Chinese patients (compare with allele A) ad DTD0099 GENEPOLY rs983492 SITEOFGP chr12:128821576 (GRCh38.p12) DTD0099 GENEPOLY rs983492 GPD_TYPE SNP DTD0099 GENEPOLY rs983492 ALLDBSNP C>T DTD0099 GENEPOLY rs983492 MAFDBSNP C=0.2421/933 DTD0099 GENEPOLY rs983492 Allele T N.A. Systemic Lupus Erythematosus Correlated with the increased risk of systemic lupus erythematosus in Han Chinese patients (compare with allele C) ad DTD0100 TRANSPID DTD0100 DTD0100 GENENAME SLC16A1 DTD0100 PROTNAME Monocarboxylate transporter 1 DTD0100 GENEDBID 6566 DTD0100 UNIPROID P53985 DTD0100 GENEPOLY rs1049434 SITEOFGP chr1:112913924 (GRCh38.p12) DTD0100 GENEPOLY rs1049434 GPD_TYPE SNP DTD0100 GENEPOLY rs1049434 ALLDBSNP A>T DTD0100 GENEPOLY rs1049434 MAFDBSNP A=0.3233/1619 DTD0100 GENEPOLY rs1049434 Allele T N.A. Multiple myeloma Correlated with the progression-free and overall survival in patients (compare with allele A) ad DTD0101 TRANSPID DTD0101 DTD0101 GENENAME SLC16A10 DTD0101 PROTNAME Monocarboxylate transporter 10 DTD0101 GENEDBID 117247 DTD0101 UNIPROID Q8TF71 DTD0102 TRANSPID DTD0102 DTD0102 GENENAME SLC16A11 DTD0102 PROTNAME Monocarboxylate transporter 11 DTD0102 GENEDBID 162515 DTD0102 UNIPROID Q8NCK7 DTD0102 GENEPOLY rs13342692 SITEOFGP chr17:7042968 (GRCh38.p12) DTD0102 GENEPOLY rs13342692 GPD_TYPE SNP DTD0102 GENEPOLY rs13342692 ALLDBSNP T>C DTD0102 GENEPOLY rs13342692 MAFDBSNP C=0.0089/33 DTD0102 GENEPOLY rs13342692 Allele C Triacylglycerol meta Type 2 diabetes Correlated with increased the risk for type 2 diabetes (compare with wide type) ac DTD0103 TRANSPID DTD0103 DTD0103 GENENAME SLC16A12 DTD0103 PROTNAME Monocarboxylate transporter 12 DTD0103 GENEDBID 387700 DTD0103 UNIPROID Q6ZSM3 DTD0104 TRANSPID DTD0104 DTD0104 GENENAME SLC16A13 DTD0104 PROTNAME Monocarboxylate transporter 13 DTD0104 GENEDBID 201232 DTD0104 UNIPROID Q7RTY0 DTD0105 TRANSPID DTD0105 DTD0105 GENENAME SLC16A14 DTD0105 PROTNAME Monocarboxylate transporter 14 DTD0105 GENEDBID 151473 DTD0105 UNIPROID Q7RTX9 DTD0106 TRANSPID DTD0106 DTD0106 GENENAME SLC16A2 DTD0106 PROTNAME Monocarboxylate transporter 8 DTD0106 GENEDBID 6567 DTD0106 UNIPROID P36021 DTD0107 TRANSPID DTD0107 DTD0107 GENENAME SLC16A3 DTD0107 PROTNAME Monocarboxylate transporter 4 DTD0107 GENEDBID 9123 DTD0107 UNIPROID O15427 DTD0109 TRANSPID DTD0109 DTD0109 GENENAME SLC16A5 DTD0109 PROTNAME Monocarboxylate transporter 6 DTD0109 GENEDBID 9121 DTD0109 UNIPROID O15375 DTD0109 GENEPOLY rs4788863 SITEOFGP chr17:75093757 (GRCh38.p12) DTD0109 GENEPOLY rs4788863 GPD_TYPE SNP DTD0109 GENEPOLY rs4788863 ALLDBSNP T>C DTD0109 GENEPOLY rs4788863 MAFDBSNP T=0.3746/1876 DTD0109 GENEPOLY rs4788863 Allele T Cisplatin Testicular Neoplasm Correlated with the decreased likelihood of ototoxicity in patients (compare with allele C) aa DTD0110 TRANSPID DTD0110 DTD0110 GENENAME SLC16A6 DTD0110 PROTNAME Monocarboxylate transporter 7 DTD0110 GENEDBID 9120 DTD0110 UNIPROID O15403 DTD0111 TRANSPID DTD0111 DTD0111 GENENAME SLC16A7 DTD0111 PROTNAME Monocarboxylate transporter 2 DTD0111 GENEDBID 9194 DTD0111 UNIPROID O60669 DTD0111 GENEPOLY rs3763980 SITEOFGP chr12:59779575 (GRCh38.p12) DTD0111 GENEPOLY rs3763980 GPD_TYPE SNP DTD0111 GENEPOLY rs3763980 ALLDBSNP A>G / A>T DTD0111 GENEPOLY rs3763980 MAFDBSNP T=0.2450/1227 DTD0111 GENEPOLY rs3763980 Allele A Methotrexate Rheumatoid Arthritis Correlated with the increased drug non-response risk in patients (compare with Allele T) aa DTD0112 TRANSPID DTD0112 DTD0112 GENENAME SLC16A8 DTD0112 PROTNAME Monocarboxylate transporter 3 DTD0112 GENEDBID 23539 DTD0112 UNIPROID O95907 DTD0113 TRANSPID DTD0113 DTD0113 GENENAME SLC16A9 DTD0113 PROTNAME Monocarboxylate transporter 9 DTD0113 GENEDBID 220963 DTD0113 UNIPROID Q7RTY1 DTD0114 TRANSPID DTD0114 DTD0114 GENENAME SLC17A1 DTD0114 PROTNAME Sodium-dependent phosphate transport protein 1 DTD0114 GENEDBID 6568 DTD0114 UNIPROID Q14916 DTD0114 GENEPOLY rs2096386 SITEOFGP chr6:25787589 (GRCh38.p12) DTD0114 GENEPOLY rs2096386 GPD_TYPE SNP DTD0114 GENEPOLY rs2096386 ALLDBSNP G>A DTD0114 GENEPOLY rs2096386 MAFDBSNP G=0.4013/1798 DTD0114 GENEPOLY rs2096386 Genotype TC N.A. Hyperuricemia Correlated with the higher risk for hyperuricemia (compare with genotypes TT + CC) ad DTD0114 GENEPOLY rs9467596 SITEOFGP chr6:25782794 (GRCh38.p12) DTD0114 GENEPOLY rs9467596 GPD_TYPE SNP DTD0114 GENEPOLY rs9467596 ALLDBSNP T>A / T>C DTD0114 GENEPOLY rs9467596 MAFDBSNP T=0.4107/1840 DTD0114 GENEPOLY rs9467596 Genotype CT N.A. Hyperuricemia Correlated with the higher risk for hyperuricemia (compare with genotypes CC + TT) ad DTD0115 TRANSPID DTD0115 DTD0115 GENENAME SLC17A2 DTD0115 PROTNAME Sodium-dependent phosphate transport protein 3 DTD0115 GENEDBID 10246 DTD0115 UNIPROID O00624 DTD0116 TRANSPID DTD0116 DTD0116 GENENAME SLC17A3 DTD0116 PROTNAME Sodium-dependent phosphate transport protein 4 DTD0116 GENEDBID 10786 DTD0116 UNIPROID O00476 DTD0116 GENEPOLY rs548987 SITEOFGP chr6:25869143 (GRCh38.p12) DTD0116 GENEPOLY rs548987 GPD_TYPE SNP DTD0116 GENEPOLY rs548987 ALLDBSNP G>C DTD0116 GENEPOLY rs548987 MAFDBSNP C=0.0980/439 DTD0116 GENEPOLY rs548987 Allele C Antihypertensive Drug Small Vessel Disease Subtype of Ischemic Stroke Correlated with the small vessel disease subtype of ischemic stroke in Chinese population (compare with allele G) ac DTD0117 TRANSPID DTD0117 DTD0117 GENENAME SLC17A4 DTD0117 PROTNAME Probable small intestine urate exporter DTD0117 GENEDBID 10050 DTD0117 UNIPROID Q9Y2C5 DTD0118 TRANSPID DTD0118 DTD0118 GENENAME SLC17A5 DTD0118 PROTNAME Vesicular H(+)/Aspartate-glutamate cotransporter DTD0118 GENEDBID 26503 DTD0118 UNIPROID Q9NRA2 DTD0119 TRANSPID DTD0119 DTD0119 GENENAME SLC17A6 DTD0119 PROTNAME Vesicular glutamate transporter 2 DTD0119 GENEDBID 57084 DTD0119 UNIPROID Q9P2U8 DTD0120 TRANSPID DTD0120 DTD0120 GENENAME SLC17A7 DTD0120 PROTNAME Vesicular glutamate transporter 1 DTD0120 GENEDBID 57030 DTD0120 UNIPROID Q9P2U7 DTD0120 GENEPOLY rs1578944 SITEOFGP chr19:49442593 (GRCh38.p12) DTD0120 GENEPOLY rs1578944 GPD_TYPE SNP DTD0120 GENEPOLY rs1578944 ALLDBSNP C>T DTD0120 GENEPOLY rs1578944 MAFDBSNP C=0.2408/893 DTD0120 GENEPOLY rs1578944 Genotype CT Selective Serotonin Reuptake Inhibitors (SSRIs) Major Depressive Disorder (MDD) Correlated with the vesicular glutamate transporter 1 coding (compare with genotypes CC + TT) ac DTD0120 GENEPOLY rs74174284 SITEOFGP chr19:49441627 (GRCh38.p12) DTD0120 GENEPOLY rs74174284 GPD_TYPE SNP DTD0120 GENEPOLY rs74174284 ALLDBSNP C>A / C>G DTD0120 GENEPOLY rs74174284 MAFDBSNP G=0.3043/1524 DTD0120 GENEPOLY rs74174284 Genotype CG Selective Serotonin Reuptake Inhibitors (SSRIs) Major Depressive Disorder (MDD) Correlated with the vesicular glutamate transporter 1 coding (compare with genotypes CC + GG) ac DTD0121 TRANSPID DTD0121 DTD0121 GENENAME SLC17A8 DTD0121 PROTNAME Vesicular glutamate transporter 3 DTD0121 GENEDBID 246213 DTD0121 UNIPROID Q8NDX2 DTD0122 TRANSPID DTD0122 DTD0122 GENENAME SLC17A9 DTD0122 PROTNAME Solute carrier family 17 member 9 DTD0122 GENEDBID 63910 DTD0122 UNIPROID Q9BYT1 DTD0123 TRANSPID DTD0123 DTD0123 GENENAME SLC18A1 DTD0123 PROTNAME Vesicular amine transporter 1 DTD0123 GENEDBID 6570 DTD0123 UNIPROID P54219 DTD0123 GENEPOLY rs1390938 SITEOFGP chr8:20179202 (GRCh38.p12) DTD0123 GENEPOLY rs1390938 GPD_TYPE SNP DTD0123 GENEPOLY rs1390938 ALLDBSNP A>G DTD0123 GENEPOLY rs1390938 MAFDBSNP A=0.1889/2457 DTD0123 GENEPOLY rs1390938 Allele A Reserpine Neuropsychiatric Disorder Correlated with the neuropsychiatric disorders (compare with G) aa DTD0123 GENEPOLY rs1390938 Allele A Tetrabenazine Neuropsychiatric Disorder Correlated with the neuropsychiatric disorders (compare with G) aa DTD0123 GENEPOLY rs2270637 SITEOFGP chr8:20179316 (GRCh38.p12) DTD0123 GENEPOLY rs2270637 GPD_TYPE SNP DTD0123 GENEPOLY rs2270637 ALLDBSNP C>G DTD0123 GENEPOLY rs2270637 MAFDBSNP G=0.1809/697 DTD0123 GENEPOLY rs2270637 Allele G Reserpine Neuropsychiatric Disorder Correlated with the neuropsychiatric disorders (compare with C) aa DTD0123 GENEPOLY rs2270637 Allele G Tetrabenazine Neuropsychiatric Disorder Correlated with the neuropsychiatric disorders (compare with C) aa DTD0123 GENEPOLY rs2270641 SITEOFGP chr8:20180955 (GRCh38.p12) DTD0123 GENEPOLY rs2270641 GPD_TYPE SNP DTD0123 GENEPOLY rs2270641 ALLDBSNP T>C / T>G DTD0123 GENEPOLY rs2270641 MAFDBSNP G=0.2462/1233 DTD0123 GENEPOLY rs2270641 Allele G Reserpine Neuropsychiatric Disorder Correlated with the risk for schizophrenia (compare with T) aa DTD0123 GENEPOLY rs2270641 Allele G Tetrabenazine Neuropsychiatric Disorder Correlated with the risk for schizophrenia (compare with T) aa DTD0124 TRANSPID DTD0124 DTD0124 GENENAME SLC18A3 DTD0124 PROTNAME Vesicular acetylcholine transporter DTD0124 GENEDBID 6572 DTD0124 UNIPROID Q16572 DTD0125 TRANSPID DTD0125 DTD0125 GENENAME SLC18B1 DTD0125 PROTNAME MFS-type transporter SLC18B1 DTD0125 GENEDBID 116843 DTD0125 UNIPROID Q6NT16 DTD0126 TRANSPID DTD0126 DTD0126 GENENAME SLC19A1 DTD0126 PROTNAME Folate transporter 1 DTD0126 GENEDBID 6573 DTD0126 UNIPROID P41440 DTD0126 GENEPOLY rs1051266 SITEOFGP chr21:45537880 (GRCh38.p12) DTD0126 GENEPOLY rs1051266 GPD_TYPE SNP DTD0126 GENEPOLY rs1051266 ALLDBSNP T>C / T>G DTD0126 GENEPOLY rs1051266 MAFDBSNP C=0.4886/2447 DTD0126 GENEPOLY rs1051266 Allele C Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased vomiting in patients (compare with Allele T); Irrelevant to the differences in plasma or cerebrospinal fluid homocysteine levels or in toxicity in patients (compare with Allele T); Irrelevant to the drug response in patients (compare with Allele T) aa DTD0126 GENEPOLY rs1051266 Allele C Methotrexate Leukemia Irrelevant to the nephrotoxicity risk in patients (compare with Allele T); Irrelevant to the prolonged high drug concentrations risk patients (compare with Allele T) aa DTD0126 GENEPOLY rs1051266 Allele T Folic Acid Rheumatoid Arthritis Correlated with the increased drug response in patients (compare with allele C) aa DTD0126 GENEPOLY rs1051266 Allele T Sulfasalazine Rheumatoid Arthritis Correlated with the increased drug response in patients (compare with allele C) aa DTD0126 GENEPOLY rs1051266 Allele T Hydroxychloroquine Rheumatoid Arthritis Correlated with the increased drug response in patients (compare with allele C) aa DTD0126 GENEPOLY rs1051266 Allele T Methotrexate Rheumatoid Arthritis Correlated with the increased drug response in patients (compare with allele C); Correlated with the increased drug response in patients (compare with allele C); Irrelevant to the drug response in patients (compare with allele C) aa DTD0126 GENEPOLY rs1051266 Allele T Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the worse prognose in patients (compare with genotype CC) aa DTD0126 GENEPOLY rs1051266 Genotype CC Irinotecan Colorectal Neoplasm Correlated with the increased drug response in patients (compare with Genotypes CT + TT) aa DTD0126 GENEPOLY rs1051266 Genotype CC Fluorouracil Colorectal Neoplasm Correlated with the increased drug response in patients (compare with Genotypes CT + TT) aa DTD0126 GENEPOLY rs1051266 Genotype CC Leucovorin Colorectal Neoplasm Correlated with the increased drug response in patients (compare with Genotypes CT + TT) aa DTD0126 GENEPOLY rs1051266 Genotype CC Methotrexate Rheumatoid Arthritis Correlated with the increased drug toxicity risk in patients (compare with Genotypes CT + TT) aa DTD0126 GENEPOLY rs1051266 Genotype CC Mercaptopurine Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased likelihood of toxic liver disease in patients (compare with genotypes tt + Ct) aa DTD0126 GENEPOLY rs1051266 Genotype CC Leucovorin Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased likelihood of toxic liver disease in patients (compare with genotypes tt + Ct) aa DTD0126 GENEPOLY rs1051266 Genotype CC Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased likelihood of toxic liver disease in patients (compare with genotypes tt + Ct); Correlated with the increased severity of mucositis risk in patients (compare with Genotypes CT + TT) aa DTD0126 GENEPOLY rs1051266 Genotype CC Methotrexate Osteosarcoma Correlated with the increased overall survival in patients (compare with Genotype TT) aa DTD0126 GENEPOLY rs1051266 Genotype CT Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased drug response in patients (compare with Genotype TT) aa DTD0126 GENEPOLY rs1051266 Genotype TT Methotrexate Rheumatoid Arthritis Correlated with the decreased disease activity in patients (compare with genotypes CC + CT); Correlated with the decreased drug response in patients (compare with genotype CC); Correlated with the increased aminotransferase activity in patients (compare with genotypes CC + CT); Correlated with the increased likelihood of remission in patients (compare with genotype CC); Correlated with the increased methotrexate polyglutamate (mtXPG3-5) levels in patients (compare with genotypes CC + CT) aa DTD0126 GENEPOLY rs1051266 Genotype TT Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased likelihood of myelosuppression in patients (compare with genotypes CC + CT); Correlated with the increased likelihood of staying in remission in patients (compare with genotypes CC + CT); Correlated with the increased likelihood of toxic liver disease in patients (compare with genotypes CC + CT); Correlated with the increased plasma drug levels in patients (compare with genotypes CC + CT); Irrelevant to the drug concentrations in patients (compare with genotypes CC + CT); Irrelevant to the drug toxicity risk in patients (compare with genotypes CC + CT) aa DTD0126 GENEPOLY rs1051266 Genotype TT Mercaptopurine Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased likelihood of staying in remission in patients (compare with genotypes CC + CT) aa DTD0126 GENEPOLY rs1051266 Genotype TT Leucovorin Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased likelihood of staying in remission in patients (compare with genotypes CC + CT) aa DTD0126 GENEPOLY rs1051266 Genotype TT Methotrexate Osteosarcoma Correlated with the increased neoplasm metastasis risk in patients (compare with genotypes CC + CT) aa DTD0126 GENEPOLY rs1051266 Genotype TT Methotrexate Lymphoma Correlated with the increased toxic liver disease risk in patients (compare with genotype CC); Irrelevant to the increased drug concentrations in patients (compare with genotype CC) aa DTD0126 GENEPOLY rs1051266 Genotypes CC + CT Methotrexate Rheumatoid Arthritis Correlated with the increased gastrointestinal toxicity risk in patients (compare with Genotype TT); Correlated with the increased severity of disease in patients (compare with Genotype TT) aa DTD0126 GENEPOLY rs1051266 Genotypes CC + CT Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Irrelevant to the mucositis risk in patients (compare with Genotype TT) aa DTD0126 GENEPOLY rs1051266 Genotypes CT + TT Methotrexate Rheumatoid Arthritis Correlated with the decreased drug discontinuation in patients (compare with genotype CC); Correlated with the increased drug response in patients (compare with genotype CC) aa DTD0126 GENEPOLY rs1051266 Genotypes CT + TT Mercaptopurine Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased drug toxicity risk in patients (compare with genotype CC) aa DTD0126 GENEPOLY rs1051266 Genotypes CT + TT Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased drug toxicity risk in patients (compare with genotype CC); Irrelevant to the drug concentrations in patients (compare with genotype CC) aa DTD0126 GENEPOLY rs1051266 Genotypes TT + CT Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased likelihood of drug toxicity in patients (compare with genotype CC) aa DTD0126 GENEPOLY rs1051266 Genotypes TT + CT Mercaptopurine Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the increased likelihood of drug toxicity in patients (compare with genotype CC); Correlated with the increased likelihood of treatment interruptions in patients (compare with genotype CC) aa DTD0126 GENEPOLY rs1051266 Genotype TT Prednisone Rheumatoid Arthritis Correlated with the increased likelihood of remission in patients (compare with genotype CC) aa DTD0126 GENEPOLY rs1051266 Genotype CC Capecitabine Colorectal Neoplasm Correlated with the increased drug response in patients (compare with Genotypes CT + TT) aa DTD0126 GENEPOLY rs1051266 Genotype TT Platinum compounds Non-Small-Cell Lung Carcinoma Correlated with the decreased progression-free survival in patients (compare with genotypes CC + CT) ac DTD0126 GENEPOLY rs1051298 SITEOFGP chr21:45514912 (GRCh38.p12) DTD0126 GENEPOLY rs1051298 GPD_TYPE SNP DTD0126 GENEPOLY rs1051298 ALLDBSNP G>A DTD0126 GENEPOLY rs1051298 MAFDBSNP G=0.4756/2382 DTD0126 GENEPOLY rs1051298 Allele G Pemetrexed Lung Neoplasm Correlated with the increased progression-free survival in patients (compare with Allele A) aa DTD0126 GENEPOLY rs1051298 Genotypes AA + AG Pemetrexed Non-Small-Cell Lung Carcinoma Correlated with the decreased overall survival in patients (compare with genotype GG) aa DTD0126 GENEPOLY rs1051298 Allele G Bevacizumab Lung Neoplasm Correlated with the increased progression-free survival in patients (compare with Allele A) ac DTD0126 GENEPOLY rs12659 SITEOFGP chr21:45531642 (GRCh38.p12) DTD0126 GENEPOLY rs12659 GPD_TYPE SNP DTD0126 GENEPOLY rs12659 ALLDBSNP A>G DTD0126 GENEPOLY rs12659 MAFDBSNP A=0.4469/2238 DTD0126 GENEPOLY rs12659 Allele A Fluorouracil Uterine Cervical Neoplasm Correlated with the decreased drug response in patients (compare with allele G) aa DTD0126 GENEPOLY rs12659 Allele A Cisplatin Uterine Cervical Neoplasm Correlated with the decreased drug response in patients (compare with allele G) aa DTD0126 GENEPOLY rs12659 Allele A Carboplatin Uterine Cervical Neoplasm Correlated with the decreased drug response in patients (compare with allele G) aa DTD0126 GENEPOLY rs2838958 SITEOFGP chr21:45528653 (GRCh38.p12) DTD0126 GENEPOLY rs2838958 GPD_TYPE SNP DTD0126 GENEPOLY rs2838958 ALLDBSNP G>A DTD0126 GENEPOLY rs2838958 MAFDBSNP A=0.4173/2090 DTD0126 GENEPOLY rs2838958 Genotype AA Methotrexate Precursor Cell Lymphoblastic Leukemia-Lymphoma Correlated with the decreased drug response in patients (compare with genotypes AG + GG) aa DTD0126 GENEPOLY rs3788189 SITEOFGP chr21:45516669 (GRCh38.p12) DTD0126 GENEPOLY rs3788189 GPD_TYPE SNP DTD0126 GENEPOLY rs3788189 ALLDBSNP T>G DTD0126 GENEPOLY rs3788189 MAFDBSNP T=0.4491/2249 DTD0126 GENEPOLY rs3788189 Genotypes GG + GT Pemetrexed Non-Small-Cell Lung Carcinoma Correlated with the decreased overall survival in patients (compare with Genotype TT) aa DTD0126 GENEPOLY rs914232 SITEOFGP chr21:45532836 (GRCh38.p12) DTD0126 GENEPOLY rs914232 GPD_TYPE SNP DTD0126 GENEPOLY rs914232 ALLDBSNP T>C DTD0126 GENEPOLY rs914232 MAFDBSNP T=0.4936/2472 DTD0126 GENEPOLY rs914232 Genotype TT Pemetrexed Non-Small-Cell Lung Carcinoma Correlated with the decreased overall survival in patients (compare with genotypes CC + CT) aa DTD0126 GENEPOLY rs9977268 SITEOFGP chr21:45487373 (GRCh38.p12) DTD0126 GENEPOLY rs9977268 GPD_TYPE SNP DTD0126 GENEPOLY rs9977268 ALLDBSNP C>T DTD0126 GENEPOLY rs9977268 MAFDBSNP T=0.1587/795 DTD0126 GENEPOLY rs9977268 Allele T Methotrexate Rheumatoid Arthritis Correlated with the increased likelihood of treatment inefficacy in patients (compare with allele C) aa DTD0127 TRANSPID DTD0127 DTD0127 GENENAME SLC19A2 DTD0127 PROTNAME Thiamine transporter 1 DTD0127 GENEDBID 10560 DTD0127 UNIPROID O60779 DTD0128 TRANSPID DTD0128 DTD0128 GENENAME SLC19A3 DTD0128 PROTNAME Thiamine transporter 2 DTD0128 GENEDBID 80704 DTD0128 UNIPROID Q9BZV2 DTD0128 GENEPOLY rs148144444 SITEOFGP chr2:227699294 (GRCh38.p12) DTD0128 GENEPOLY rs148144444 GPD_TYPE SNP DTD0128 GENEPOLY rs148144444 ALLDBSNP C>G / C>T DTD0128 GENEPOLY rs148144444 MAFDBSNP T=0.0022/11 DTD0128 GENEPOLY rs148144444 Allele T N.A. Alcohol Dependence Syndrome Irrelevant to the alcohol dependence syndrome (compare with allele C) ad DTD0129 TRANSPID DTD0129 DTD0129 GENENAME SLC1A1 DTD0129 PROTNAME Excitatory amino acid transporter 3 DTD0129 GENEDBID 6505 DTD0129 UNIPROID P43005 DTD0129 GENEPOLY rs301434 SITEOFGP chr9:4582082 (GRCh38.p12) DTD0129 GENEPOLY rs301434 GPD_TYPE SNP DTD0129 GENEPOLY rs301434 ALLDBSNP C>G / C>T DTD0129 GENEPOLY rs301434 MAFDBSNP C=0.3872/1939 DTD0129 GENEPOLY rs301434 Allele T Selective serotonin reuptake inhibitors Obsessive-Compulsive Disorder Correlated with the increased severity of pharmacological resistance in patients (compare with allele C) ac DTD0129 GENEPOLY rs301435 SITEOFGP chr9:4582843 (GRCh38.p12) DTD0129 GENEPOLY rs301435 GPD_TYPE SNP DTD0129 GENEPOLY rs301435 ALLDBSNP T>C DTD0129 GENEPOLY rs301435 MAFDBSNP T=0.3726/1866 DTD0129 GENEPOLY rs301435 Allele C Selective serotonin reuptake inhibitors Obsessive-Compulsive Disorder Correlated with the increased severity of pharmacological resistance in patients (compare with Allele T) ac DTD0129 GENEPOLY rs3087879 SITEOFGP chr9:4586808 (GRCh38.p12) DTD0129 GENEPOLY rs3087879 GPD_TYPE SNP DTD0129 GENEPOLY rs3087879 ALLDBSNP G>C DTD0129 GENEPOLY rs3087879 MAFDBSNP C=0.2280/1142 DTD0129 GENEPOLY rs3087879 Allele C Selective serotonin reuptake inhibitors Obsessive-Compulsive Disorder Correlated with the increased severity of pharmacological resistance in patients (compare with Allele G) ac DTD0130 TRANSPID DTD0130 DTD0130 GENENAME SLC1A2 DTD0130 PROTNAME Excitatory amino acid transporter 2 DTD0130 GENEDBID 6506 DTD0130 UNIPROID P43004 DTD0130 GENEPOLY rs3794087 SITEOFGP chr11:35308068 (GRCh38.p12) DTD0130 GENEPOLY rs3794087 GPD_TYPE SNP DTD0130 GENEPOLY rs3794087 ALLDBSNP G>T DTD0130 GENEPOLY rs3794087 MAFDBSNP T=0.1597/800 DTD0130 GENEPOLY rs3794087 Allele G N.A. Migraine Irrelevant to the risk for migraine (compare with wide type) ad DTD0130 GENEPOLY rs4354668 SITEOFGP chr11:35419429 (GRCh38.p12) DTD0130 GENEPOLY rs4354668 GPD_TYPE SNP DTD0130 GENEPOLY rs4354668 ALLDBSNP T>G DTD0130 GENEPOLY rs4354668 MAFDBSNP G=0.3980/1534 DTD0130 GENEPOLY rs4354668 Allele G N.A. Schizophrenia Correlated with the risk of schizophrenia (compare with T) ad DTD0131 TRANSPID DTD0131 DTD0131 GENENAME SLC1A3 DTD0131 PROTNAME Excitatory amino acid transporter 1 DTD0131 GENEDBID 6507 DTD0131 UNIPROID P43003 DTD0132 TRANSPID DTD0132 DTD0132 GENENAME SLC1A4 DTD0132 PROTNAME Alanine/serine/cysteine/threonine transporter 1 DTD0132 GENEDBID 6509 DTD0132 UNIPROID P43007 DTD0133 TRANSPID DTD0133 DTD0133 GENENAME SLC1A5 DTD0133 PROTNAME Alanine/serine/cysteine/threonine transporter 2 DTD0133 GENEDBID 6510 DTD0133 UNIPROID Q15758 DTD0133 GENEPOLY rs1644343 SITEOFGP chr19:46782332 (GRCh38.p12) DTD0133 GENEPOLY rs1644343 GPD_TYPE SNP DTD0133 GENEPOLY rs1644343 ALLDBSNP A>C DTD0133 GENEPOLY rs1644343 MAFDBSNP C=0.1639/2107 DTD0133 GENEPOLY rs1644343 Genotype AA N.A. Human Longevity Correlated with the human longevity (compare with allele C) ad DTD0133 GENEPOLY rs3027958 SITEOFGP chr19:46784148 (GRCh38.p12) DTD0133 GENEPOLY rs3027958 GPD_TYPE SNP DTD0133 GENEPOLY rs3027958 ALLDBSNP T>C DTD0133 GENEPOLY rs3027958 MAFDBSNP C=0.1026/514 DTD0133 GENEPOLY rs3027958 Genotype AA N.A. Human Longevity Correlated with the human longevity (compare with genotypes AG + GG ) ad DTD0134 TRANSPID DTD0134 DTD0134 GENENAME SLC1A6 DTD0134 PROTNAME Excitatory amino acid transporter 4 DTD0134 GENEDBID 6511 DTD0134 UNIPROID P48664 DTD0135 TRANSPID DTD0135 DTD0135 GENENAME SLC1A7 DTD0135 PROTNAME Excitatory amino acid transporter 5 DTD0135 GENEDBID 6512 DTD0135 UNIPROID O00341 DTD0136 TRANSPID DTD0136 DTD0136 GENENAME SLC20A1 DTD0136 PROTNAME Sodium-dependent phosphate transporter 1 DTD0136 GENEDBID 6574 DTD0136 UNIPROID Q8WUM9 DTD0137 TRANSPID DTD0137 DTD0137 GENENAME SLC20A2 DTD0137 PROTNAME Sodium-dependent phosphate transporter 2 DTD0137 GENEDBID 6575 DTD0137 UNIPROID Q08357 DTD0139 TRANSPID DTD0139 DTD0139 GENENAME SLC22A13 DTD0139 PROTNAME Organic cation transporter-like 3 DTD0139 GENEDBID 9390 DTD0139 UNIPROID Q9Y226 DTD0142 TRANSPID DTD0142 DTD0142 GENENAME SLC22A16 DTD0142 PROTNAME Fly-like putative transporter 2 DTD0142 GENEDBID 85413 DTD0142 UNIPROID Q86VW1 DTD0142 GENEPOLY rs12210538 SITEOFGP chr6:110438805 (GRCh38.p12) DTD0142 GENEPOLY rs12210538 GPD_TYPE SNP DTD0142 GENEPOLY rs12210538 ALLDBSNP A>G DTD0142 GENEPOLY rs12210538 MAFDBSNP G=0.0915/458 DTD0142 GENEPOLY rs12210538 Allele A Doxorubicin Breast Neoplasm Irrelevant to the likelihood of febrile neutropenia in patients (compare with Allele G) aa DTD0142 GENEPOLY rs12210538 Allele G Doxorubicin Breast Neoplasm Correlated with the increased likelihood of drug toxicity in patients (compare with Allele A) aa DTD0142 GENEPOLY rs12210538 Allele G Cyclophosphamide Breast Neoplasm Correlated with the increased likelihood of drug toxicity in patients (compare with Allele A) aa DTD0142 GENEPOLY rs6907567 SITEOFGP chr6:110456759 (GRCh38.p12) DTD0142 GENEPOLY rs6907567 GPD_TYPE SNP DTD0142 GENEPOLY rs6907567 ALLDBSNP A>G DTD0142 GENEPOLY rs6907567 MAFDBSNP G=0.3141/1573 DTD0142 GENEPOLY rs6907567 Allele G Doxorubicin Breast Neoplasm Correlated with the decreased likelihood of dose delay in patients (compare with Allele A) aa DTD0142 GENEPOLY rs6907567 Allele G Cyclophosphamide Breast Neoplasm Correlated with the decreased likelihood of dose delay in patients (compare with Allele A) aa DTD0142 GENEPOLY rs6907567 Genotypes AG + GG Fluorouracil Breast Neoplasm Correlated with the decreased neutropenia risk in patients (compare with Genotype AA) aa DTD0142 GENEPOLY rs6907567 Genotypes AG + GG Doxorubicin Breast Neoplasm Correlated with the decreased neutropenia risk in patients (compare with Genotype AA) aa DTD0142 GENEPOLY rs6907567 Genotypes AG + GG Cyclophosphamide Breast Neoplasm Correlated with the decreased neutropenia risk in patients (compare with Genotype AA) aa DTD0142 GENEPOLY rs714368 SITEOFGP chr6:110456925 (GRCh38.p12) DTD0142 GENEPOLY rs714368 GPD_TYPE SNP DTD0142 GENEPOLY rs714368 ALLDBSNP T>C DTD0142 GENEPOLY rs714368 MAFDBSNP C=0.3139/1572 DTD0142 GENEPOLY rs714368 Allele C Doxorubicin Breast Neoplasm Correlated with the decreased likelihood of dose delay in patients (compare with Allele T) aa DTD0142 GENEPOLY rs714368 Allele C Cyclophosphamide Breast Neoplasm Correlated with the decreased likelihood of dose delay in patients (compare with Allele T) aa DTD0142 GENEPOLY rs714368 Genotype CC Doxorubicin Breast Neoplasm Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug in patients (compare with genotypes tt + Ct) aa DTD0142 GENEPOLY rs714368 Genotypes CC + CT Fluorouracil Breast Neoplasm Correlated with the increased nausea risk in patients (compare with Genotype TT) aa DTD0142 GENEPOLY rs714368 Genotypes CC + CT Doxorubicin Breast Neoplasm Correlated with the increased nausea risk in patients (compare with Genotype TT) aa DTD0142 GENEPOLY rs714368 Genotypes CC + CT Cyclophosphamide Breast Neoplasm Correlated with the increased nausea risk in patients (compare with Genotype TT) aa DTD0142 GENEPOLY rs714368 Genotype CC Doxorubicinol Breast Neoplasm Correlated with the increased the total area under the plasma concentration-time curve (AUC) of drug in patients (compare with genotypes tt + Ct) ac DTD0142 GENEPOLY rs723685 SITEOFGP chr6:110442672 (GRCh38.p12) DTD0142 GENEPOLY rs723685 GPD_TYPE SNP DTD0142 GENEPOLY rs723685 ALLDBSNP A>G DTD0142 GENEPOLY rs723685 MAFDBSNP G=0.0881/441 DTD0142 GENEPOLY rs723685 Allele G Doxorubicin Breast Neoplasm Correlated with the decreased likelihood of dose delay in patients (compare with Allele A) aa DTD0142 GENEPOLY rs723685 Allele G Cyclophosphamide Breast Neoplasm Correlated with the decreased likelihood of dose delay in patients (compare with Allele A) aa DTD0143 TRANSPID DTD0143 DTD0143 GENENAME SLC22A17 DTD0143 PROTNAME Brain-type organic cation transporter DTD0143 GENEDBID 51310 DTD0143 UNIPROID Q8WUG5 DTD0143 GENEPOLY rs4982753 SITEOFGP chr14:23345360 (GRCh38.p12) DTD0143 GENEPOLY rs4982753 GPD_TYPE SNP DTD0143 GENEPOLY rs4982753 ALLDBSNP C>A / C>T DTD0143 GENEPOLY rs4982753 MAFDBSNP T=0.2283/28669 DTD0143 GENEPOLY rs4982753 Allele G Anthracyclines Cardiotoxicity Correlated with the anthracycline-induced cardiotoxicity (compare with allele A) ac DTD0145 TRANSPID DTD0145 DTD0145 GENENAME SLC22A20 DTD0145 PROTNAME Organic anion transporter 6 DTD0145 GENEDBID 440044 DTD0145 UNIPROID A6NK97 DTD0146 TRANSPID DTD0146 DTD0146 GENENAME SLC22A23 DTD0146 PROTNAME Solute carrier family 22 member 23 DTD0146 GENEDBID 63027 DTD0146 UNIPROID A1A5C7 DTD0148 TRANSPID DTD0148 DTD0148 GENENAME SLC22A25 DTD0148 PROTNAME Organic anion transporter UST6 DTD0148 GENEDBID 387601 DTD0148 UNIPROID Q6T423 DTD0151 TRANSPID DTD0151 DTD0151 GENENAME SLC22A4 DTD0151 PROTNAME Organic cation/carnitine transporter 1 DTD0151 GENEDBID 6583 DTD0151 UNIPROID Q9H015 DTD0151 GENEPOLY rs1050152 SITEOFGP chr5:132340627 (GRCh38.p12) DTD0151 GENEPOLY rs1050152 GPD_TYPE SNP DTD0151 GENEPOLY rs1050152 ALLDBSNP C>T DTD0151 GENEPOLY rs1050152 MAFDBSNP T=0.1344/673 DTD0151 GENEPOLY rs1050152 Genotype TT Imatinib Gastrointestinal Stromal Tumors Correlated with the decreased drug response in patients (compare with genotypes CC + CT) aa DTD0151 GENEPOLY rs1050152 Genotype TT Imatinib Bcr-Abl Positive Chronic Myelogenous Leukemia Correlated with the decreased drug response in patients (compare with genotypes CC + CT); Irrelevant to the drug response in patients (compare with genotypes CC + CT) aa DTD0152 TRANSPID DTD0152 DTD0152 GENENAME SLC22A9 DTD0152 PROTNAME Organic anion transporter 7 DTD0152 GENEDBID 114571 DTD0152 UNIPROID Q8IVM8 DTD0155 TRANSPID DTD0155 DTD0155 GENENAME SLC22B3 DTD0155 PROTNAME Synaptic vesicle glycoprotein 2C DTD0155 GENEDBID 22987 DTD0155 UNIPROID Q496J9 DTD0158 TRANSPID DTD0158 DTD0158 GENENAME SLC23A1 DTD0158 PROTNAME Sodium-dependent vitamin C transporter 1 DTD0158 GENEDBID 9963 DTD0158 UNIPROID Q9UHI7 DTD0158 GENEPOLY rs6596473 SITEOFGP chr5:139374887 (GRCh38.p12) DTD0158 GENEPOLY rs6596473 GPD_TYPE SNP DTD0158 GENEPOLY rs6596473 ALLDBSNP G>C / G>T DTD0158 GENEPOLY rs6596473 MAFDBSNP C=0.2558/1146 DTD0158 GENEPOLY rs6596473 Allele C Vitamin C Periodontitis Correlated with the aggressive periodontitis (compare with allele G) aa DTD0159 TRANSPID DTD0159 DTD0159 GENENAME SLC23A2 DTD0159 PROTNAME Sodium-dependent vitamin C transporter 2 DTD0159 GENEDBID 9962 DTD0159 UNIPROID Q9UGH3 DTD0159 GENEPOLY rs1776948 SITEOFGP chr20:4950467 (GRCh38.p12) DTD0159 GENEPOLY rs1776948 GPD_TYPE SNP DTD0159 GENEPOLY rs1776948 ALLDBSNP G>A / G>C DTD0159 GENEPOLY rs1776948 MAFDBSNP A=0.4563/1692 DTD0159 GENEPOLY rs1776948 Allele T N.A. Chronic Lymphocytic Leukaemia Correlated with the risk for chronic lymphocytic leukaemia (compare with allele A) ad DTD0159 GENEPOLY rs6133175 SITEOFGP chr20:4911113 (GRCh38.p12) DTD0159 GENEPOLY rs6133175 GPD_TYPE SNP DTD0159 GENEPOLY rs6133175 ALLDBSNP A>G DTD0159 GENEPOLY rs6133175 MAFDBSNP G=0.2793/35070 DTD0159 GENEPOLY rs6133175 Genotype GG Vitamin C Chronic Lymphocytic Leukaemia Correlated with the higher drug concentrations in plasma (compare with genotypes AA + AG) aa DTD0160 TRANSPID DTD0160 DTD0160 GENENAME SLC23A3 DTD0160 PROTNAME Na(+)/L-ascorbic acid transporter 3 DTD0160 GENEDBID 151295 DTD0160 UNIPROID Q6PIS1 DTD0160 GENEPOLY rs1043160 SITEOFGP chr2:219173034 (GRCh38.p12) DTD0160 GENEPOLY rs1043160 GPD_TYPE SNP DTD0160 GENEPOLY rs1043160 ALLDBSNP A>G DTD0160 GENEPOLY rs1043160 MAFDBSNP A=0.3752/1681 DTD0160 GENEPOLY rs1043160 Allele A N.A. Schizophrenia Correlated with the schizophrenia susceptibility (compare with wide type) ad DTD0160 GENEPOLY rs13404754 SITEOFGP chr2:219170859 (GRCh38.p12) DTD0160 GENEPOLY rs13404754 GPD_TYPE SNP DTD0160 GENEPOLY rs13404754 ALLDBSNP A>G / A>T DTD0160 GENEPOLY rs13404754 MAFDBSNP A=0.3741/1676 DTD0160 GENEPOLY rs13404754 Allele G N.A. Schizophrenia Correlated with the schizophrenia susceptibility (compare with wide type) ad DTD0160 GENEPOLY rs6436122 SITEOFGP chr2:219171668 (GRCh38.p12) DTD0160 GENEPOLY rs6436122 GPD_TYPE SNP DTD0160 GENEPOLY rs6436122 ALLDBSNP A>G DTD0160 GENEPOLY rs6436122 MAFDBSNP A=0.0379/170 DTD0160 GENEPOLY rs6436122 Allele A N.A. Schizophrenia Correlated with the schizophrenia susceptibility (compare with wide type) ad DTD0162 TRANSPID DTD0162 DTD0162 GENENAME SLC24A1 DTD0162 PROTNAME Sodium/potassium/calcium exchanger 1 DTD0162 GENEDBID 9187 DTD0162 UNIPROID O60721 DTD0163 TRANSPID DTD0163 DTD0163 GENENAME SLC24A2 DTD0163 PROTNAME Sodium/potassium/calcium exchanger 2 DTD0163 GENEDBID 25769 DTD0163 UNIPROID Q9UI40 DTD0164 TRANSPID DTD0164 DTD0164 GENENAME SLC24A3 DTD0164 PROTNAME Sodium/potassium/calcium exchanger 3 DTD0164 GENEDBID 57419 DTD0164 UNIPROID Q9HC58 DTD0165 TRANSPID DTD0165 DTD0165 GENENAME SLC24A4 DTD0165 PROTNAME Sodium/potassium/calcium exchanger 4 DTD0165 GENEDBID 123041 DTD0165 UNIPROID Q8NFF2 DTD0166 TRANSPID DTD0166 DTD0166 GENENAME SLC24A5 DTD0166 PROTNAME Sodium/potassium/calcium exchanger 5 DTD0166 GENEDBID 283652 DTD0166 UNIPROID Q71RS6 DTD0166 GENEPOLY rs1426654 SITEOFGP chr15:48134287 (GRCh38.p12) DTD0166 GENEPOLY rs1426654 GPD_TYPE SNP DTD0166 GENEPOLY rs1426654 ALLDBSNP A>G / A>T DTD0166 GENEPOLY rs1426654 MAFDBSNP A=0.4377/2192 DTD0166 GENEPOLY rs1426654 Allele A N.A. Pigmentation Correlated with the blue eyes and blond hair (compare with allele G) ad DTD0167 TRANSPID DTD0167 DTD0167 GENENAME SLC25A1 DTD0167 PROTNAME Tricarboxylate transport protein DTD0167 GENEDBID 6576 DTD0167 UNIPROID P53007 DTD0168 TRANSPID DTD0168 DTD0168 GENENAME SLC25A10 DTD0168 PROTNAME Mitochondrial dicarboxylate carrier DTD0168 GENEDBID 1468 DTD0168 UNIPROID Q9UBX3 DTD0169 TRANSPID DTD0169 DTD0169 GENENAME SLC25A11 DTD0169 PROTNAME Mitochondrial 2-oxoglutarate/malate carrier DTD0169 GENEDBID 8402 DTD0169 UNIPROID Q02978 DTD0170 TRANSPID DTD0170 DTD0170 GENENAME SLC25A12 DTD0170 PROTNAME Calcium-binding mitochondrial carrier protein Aralar1 DTD0170 GENEDBID 8604 DTD0170 UNIPROID O75746 DTD0170 GENEPOLY rs2056202 SITEOFGP chr2:171855970 (GRCh38.p12) DTD0170 GENEPOLY rs2056202 GPD_TYPE SNP DTD0170 GENEPOLY rs2056202 ALLDBSNP T>C DTD0170 GENEPOLY rs2056202 MAFDBSNP T=0.1341/517 DTD0170 GENEPOLY rs2056202 Allele T N.A. Autism Spectrum Disorder Correlated with the decteased risk for autism spectrum disorder (compare with allele C) ad DTD0170 GENEPOLY rs2292813 SITEOFGP chr2:171787719 (GRCh38.p12) DTD0170 GENEPOLY rs2292813 GPD_TYPE SNP DTD0170 GENEPOLY rs2292813 ALLDBSNP T>C DTD0170 GENEPOLY rs2292813 MAFDBSNP T=0.0791/305 DTD0170 GENEPOLY rs2292813 Allele T N.A. Autism Spectrum Disorder Correlated with the decteased risk for autism spectrum disorder (compare with allele C) ad DTD0171 TRANSPID DTD0171 DTD0171 GENENAME SLC25A13 DTD0171 PROTNAME Calcium-binding mitochondrial carrier protein Aralar2 DTD0171 GENEDBID 10165 DTD0171 UNIPROID Q9UJS0 DTD0172 TRANSPID DTD0172 DTD0172 GENENAME SLC25A14 DTD0172 PROTNAME Brain mitochondrial carrier protein 1 DTD0172 GENEDBID 9016 DTD0172 UNIPROID O95258 DTD0173 TRANSPID DTD0173 DTD0173 GENENAME SLC25A15 DTD0173 PROTNAME Mitochondrial ornithine transporter 1 DTD0173 GENEDBID 10166 DTD0173 UNIPROID Q9Y619 DTD0175 TRANSPID DTD0175 DTD0175 GENENAME SLC25A16 DTD0175 PROTNAME Graves disease carrier protein DTD0175 GENEDBID 8034 DTD0175 UNIPROID P16260 DTD0176 TRANSPID DTD0176 DTD0176 GENENAME SLC25A17 DTD0176 PROTNAME Peroxisomal membrane protein PMP34 DTD0176 GENEDBID 10478 DTD0176 UNIPROID O43808 DTD0177 TRANSPID DTD0177 DTD0177 GENENAME SLC25A18 DTD0177 PROTNAME Mitochondrial glutamate carrier 2 DTD0177 GENEDBID 83733 DTD0177 UNIPROID Q9H1K4 DTD0178 TRANSPID DTD0178 DTD0178 GENENAME SLC25A19 DTD0178 PROTNAME Mitochondrial thiamine pyrophosphate carrier DTD0178 GENEDBID 60386 DTD0178 UNIPROID Q9HC21 DTD0179 TRANSPID DTD0179 DTD0179 GENENAME SLC25A2 DTD0179 PROTNAME Mitochondrial ornithine transporter 2 DTD0179 GENEDBID 83884 DTD0179 UNIPROID Q9BXI2 DTD0180 TRANSPID DTD0180 DTD0180 GENENAME SLC25A20 DTD0180 PROTNAME Carnitine/acylcarnitine translocase DTD0180 GENEDBID 788 DTD0180 UNIPROID O43772 DTD0182 TRANSPID DTD0182 DTD0182 GENENAME SLC25A21 DTD0182 PROTNAME Mitochondrial 2-oxodicarboxylate carrier DTD0182 GENEDBID 89874 DTD0182 UNIPROID Q9BQT8 DTD0183 TRANSPID DTD0183 DTD0183 GENENAME SLC25A22 DTD0183 PROTNAME Mitochondrial glutamate carrier 1 DTD0183 GENEDBID 79751 DTD0183 UNIPROID Q9H936 DTD0184 TRANSPID DTD0184 DTD0184 GENENAME SLC25A23 DTD0184 PROTNAME Calcium-binding mitochondrial carrier protein SCaMC-3 DTD0184 GENEDBID 79085 DTD0184 UNIPROID Q9BV35 DTD0185 TRANSPID DTD0185 DTD0185 GENENAME SLC25A24 DTD0185 PROTNAME Calcium-binding mitochondrial carrier protein SCaMC-1 DTD0185 GENEDBID 29957 DTD0185 UNIPROID Q6NUK1 DTD0186 TRANSPID DTD0186 DTD0186 GENENAME SLC25A25 DTD0186 PROTNAME Calcium-binding mitochondrial carrier protein SCaMC-2 DTD0186 GENEDBID 114789 DTD0186 UNIPROID Q6KCM7 DTD0187 TRANSPID DTD0187 DTD0187 GENENAME SLC25A26 DTD0187 PROTNAME S-adenosylmethionine mitochondrial carrier protein DTD0187 GENEDBID 115286 DTD0187 UNIPROID Q70HW3 DTD0188 TRANSPID DTD0188 DTD0188 GENENAME SLC25A27 DTD0188 PROTNAME Mitochondrial uncoupling protein 4 DTD0188 GENEDBID 9481 DTD0188 UNIPROID O95847 DTD0189 TRANSPID DTD0189 DTD0189 GENENAME SLC25A28 DTD0189 PROTNAME Mitochondrial iron transporter 2 DTD0189 GENEDBID 81894 DTD0189 UNIPROID Q96A46 DTD0190 TRANSPID DTD0190 DTD0190 GENENAME SLC25A29 DTD0190 PROTNAME Mitochondrial ornithine transporter 3 DTD0190 GENEDBID 123096 DTD0190 UNIPROID Q8N8R3 DTD0191 TRANSPID DTD0191 DTD0191 GENENAME SLC25A3 DTD0191 PROTNAME Phosphate carrier protein DTD0191 GENEDBID 5250 DTD0191 UNIPROID Q00325 DTD0193 TRANSPID DTD0193 DTD0193 GENENAME SLC25A31 DTD0193 PROTNAME Adenine nucleotide translocator 4 DTD0193 GENEDBID 83447 DTD0193 UNIPROID Q9H0C2 DTD0193 GENEPOLY rs201279313 SITEOFGP chr4:127735886-127735890 (GRCh38.p12) DTD0193 GENEPOLY rs201279313 GPD_TYPE IndelInsertion and Deletion DTD0193 GENEPOLY rs201279313 ALLDBSNP delATT DTD0193 GENEPOLY rs201279313 MAFDBSNP N.A. DTD0193 GENEPOLY rs201279313 Genotype TTA/de Atenolol Hypertension Correlated with the increased drug response in patienrs (compare with Genotype TTA/ttA) aa DTD0193 GENEPOLY rs201279313 Genotype TTA/de Hydrochlorothiazide Hypertension Correlated with the increased drug response in patienrs (compare with Genotype TTA/ttA) aa DTD0193 GENEPOLY rs201279313 Genotype TTA/de Metoprolol Hypertension Correlated with the increased drug response in patienrs (compare with Genotype TTA/ttA) aa DTD0194 TRANSPID DTD0194 DTD0194 GENENAME SLC25A32 DTD0194 PROTNAME Mitochondrial folate transporter/carrier DTD0194 GENEDBID 81034 DTD0194 UNIPROID Q9H2D1 DTD0195 TRANSPID DTD0195 DTD0195 GENENAME SLC25A33 DTD0195 PROTNAME Bone marrow stromal cell mitochondrial carrier protein DTD0195 GENEDBID 84275 DTD0195 UNIPROID Q9BSK2 DTD0198 TRANSPID DTD0198 DTD0198 GENENAME SLC25A36 DTD0198 PROTNAME Solute carrier family 25 member 36 DTD0198 GENEDBID 55186 DTD0198 UNIPROID Q96CQ1 DTD0199 TRANSPID DTD0199 DTD0199 GENENAME SLC25A37 DTD0199 PROTNAME Mitochondrial iron transporter 1 DTD0199 GENEDBID 51312 DTD0199 UNIPROID Q9NYZ2 DTD0200 TRANSPID DTD0200 DTD0200 GENENAME SLC25A38 DTD0200 PROTNAME Mitochondrial glycine transporter DTD0200 GENEDBID 54977 DTD0200 UNIPROID Q96DW6 DTD0202 TRANSPID DTD0202 DTD0202 GENENAME SLC25A4 DTD0202 PROTNAME Adenine nucleotide translocator 1 DTD0202 GENEDBID 291 DTD0202 UNIPROID P12235 DTD0205 TRANSPID DTD0205 DTD0205 GENENAME SLC25A42 DTD0205 PROTNAME Mitochondrial coenzyme A transporter SLC25A42 DTD0205 GENEDBID 284439 DTD0205 UNIPROID Q86VD7 DTD0213 TRANSPID DTD0213 DTD0213 GENENAME SLC25A5 DTD0213 PROTNAME Adenine nucleotide translocator 2 DTD0213 GENEDBID 292 DTD0213 UNIPROID P05141 DTD0222 TRANSPID DTD0222 DTD0222 GENENAME SLC25A6 DTD0222 PROTNAME Adenine nucleotide translocator 3 DTD0222 GENEDBID 293 DTD0222 UNIPROID P12236 DTD0224 TRANSPID DTD0224 DTD0224 GENENAME SLC25A7 DTD0224 PROTNAME Mitochondrial brown fat uncoupling protein 1 DTD0224 GENEDBID 7350 DTD0224 UNIPROID P25874 DTD0225 TRANSPID DTD0225 DTD0225 GENENAME SLC25A8 DTD0225 PROTNAME Mitochondrial uncoupling protein 2 DTD0225 GENEDBID 7351 DTD0225 UNIPROID P55851 DTD0226 TRANSPID DTD0226 DTD0226 GENENAME SLC25A9 DTD0226 PROTNAME Mitochondrial uncoupling protein 3 DTD0226 GENEDBID 7352 DTD0226 UNIPROID P55916 DTD0227 TRANSPID DTD0227 DTD0227 GENENAME SLC26A1 DTD0227 PROTNAME Sulfate anion transporter 1 DTD0227 GENEDBID 10861 DTD0227 UNIPROID Q9H2B4 DTD0227 GENEPOLY rs6526342 SITEOFGP chrX:23781621 (GRCh38.p12) DTD0227 GENEPOLY rs6526342 GPD_TYPE SNP DTD0227 GENEPOLY rs6526342 ALLDBSNP A>C DTD0227 GENEPOLY rs6526342 MAFDBSNP A=0.2219/641 DTD0227 GENEPOLY rs6526342 Allele C N.A. Suicide and Psychiatric Disorders Correlated with the expression of transporter (compare with A) ad DTD0227 GENEPOLY rs6526342 Allele C N.A. Suicide and Psychiatric Disorders Correlated with the suicide and other psychiatric disorders (compare with A) ad DTD0230 TRANSPID DTD0230 DTD0230 GENENAME SLC26A2 DTD0230 PROTNAME Sulfate transporter DTD0230 GENEDBID 1836 DTD0230 UNIPROID P50443 DTD0231 TRANSPID DTD0231 DTD0231 GENENAME SLC26A3 DTD0231 PROTNAME Chloride anion exchanger DTD0231 GENEDBID 1811 DTD0231 UNIPROID P40879 DTD0231 GENEPOLY rs17154444 SITEOFGP chr7:107795423 (GRCh38.p12) DTD0231 GENEPOLY rs17154444 GPD_TYPE SNP DTD0231 GENEPOLY rs17154444 ALLDBSNP T>C DTD0231 GENEPOLY rs17154444 MAFDBSNP C=0.0411/184 DTD0231 GENEPOLY rs17154444 Allele C N.A. Ulcerative colitis Correlated with the risk of sever ulcerative colitis (compare with allele T) ad DTD0231 GENEPOLY rs17154444 Genotypes TC+CC N.A. Ulcerative colitis Correlated with the risk of sever ulcerative colitis (compare with genotype TT) ad DTD0231 GENEPOLY rs17154444, rs781093, rs7785539, rs2108225 SITEOFGP N.A. DTD0231 GENEPOLY rs17154444, rs781093, rs7785539, rs2108225 GPD_TYPE N.A. DTD0231 GENEPOLY rs17154444, rs781093, rs7785539, rs2108225 ALLDBSNP N.A. DTD0231 GENEPOLY rs17154444, rs781093, rs7785539, rs2108225 MAFDBSNP N.A. DTD0231 GENEPOLY rs17154444, rs781093, rs7785539, rs2108225 Haplotype T-A-G-G N.A. Ulcerative colitis Correlated with the decreased risk for sever ulcerative colitis (compare with other haplotype) ad DTD0231 GENEPOLY rs17154444, rs781093, rs7785539, rs2108225 Haplotype T-G-G-A N.A. Ulcerative colitis Correlated with the increased risk of sever ulcerative colitis (compare with other haplotype) ad DTD0231 GENEPOLY rs2108225 SITEOFGP chr7:107812658 (GRCh38.p12) DTD0231 GENEPOLY rs2108225 GPD_TYPE SNP DTD0231 GENEPOLY rs2108225 ALLDBSNP G>A / G>T DTD0231 GENEPOLY rs2108225 MAFDBSNP A=0.4186/1552 DTD0231 GENEPOLY rs2108225 Genotypes AG+GG N.A. Ulcerative colitis Correlated with the risk of sever ulcerative colitis (compare with genotype AA) ad DTD0231 GENEPOLY rs2108225 Allele G N.A. Ulcerative colitis Correlated with the risk of sever ulcerative colitis(compare with allele A) ad DTD0231 GENEPOLY rs7785539 SITEOFGP chr7:107809045 (GRCh38.p12) DTD0231 GENEPOLY rs7785539 GPD_TYPE SNP DTD0231 GENEPOLY rs7785539 ALLDBSNP G>C DTD0231 GENEPOLY rs7785539 MAFDBSNP C=0.0580/215 DTD0231 GENEPOLY rs7785539 Allele C N.A. Ulcerative colitis Correlated with the risk of sever ulcerative colitis (compare with allele G) ad DTD0231 GENEPOLY rs7785539 Genotypes GC+CC N.A. Ulcerative colitis Correlated with the risk of sever ulcerative colitis (compare with genotype GG) ad DTD0232 TRANSPID DTD0232 DTD0232 GENENAME SLC26A4 DTD0232 PROTNAME Sodium-independent chloride/iodide transporter DTD0232 GENEDBID 5172 DTD0232 UNIPROID O43511 DTD0232 GENEPOLY rs10234822 SITEOFGP chr7:107689044 (GRCh38.p12) DTD0232 GENEPOLY rs10234822 GPD_TYPE SNP DTD0232 GENEPOLY rs10234822 ALLDBSNP A>C DTD0232 GENEPOLY rs10234822 MAFDBSNP C=0.0003/1 DTD0232 GENEPOLY rs10234822 Allele C N.A. Autoimmune thyroid diseases Correlated with the significantly increased mRNA exoression of transporter (compare with allele A) ad DTD0232 GENEPOLY rs77944876 SITEOFGP chr7:107698037 (GRCh38.p12) DTD0232 GENEPOLY rs77944876 GPD_TYPE SNP DTD0232 GENEPOLY rs77944876 ALLDBSNP T>C / T>G DTD0232 GENEPOLY rs77944876 MAFDBSNP G=0.0000/0 DTD0232 GENEPOLY rs77944876 Allele G N.A. Autoimmune thyroid diseases Correlated with the transcripts increased 7 fold (compare with allele T) ad DTD0233 TRANSPID DTD0233 DTD0233 GENENAME SLC26A5 DTD0233 PROTNAME Prestin DTD0233 GENEDBID 375611 DTD0233 UNIPROID P58743 DTD0234 TRANSPID DTD0234 DTD0234 GENENAME SLC26A6 DTD0234 PROTNAME Anion exchange transporter DTD0234 GENEDBID 65010 DTD0234 UNIPROID Q9BXS9 DTD0234 GENEPOLY rs184187143 SITEOFGP chr3:48628699 (GRCh38.p12) DTD0234 GENEPOLY rs184187143 GPD_TYPE SNP DTD0234 GENEPOLY rs184187143 ALLDBSNP C>A / C>G DTD0234 GENEPOLY rs184187143 MAFDBSNP G=0.0004/2 DTD0234 GENEPOLY rs184187143 Allele C N.A. Kidney Stone Correlated with the kidney stones disease (compare with allele G) ad DTD0235 TRANSPID DTD0235 DTD0235 GENENAME SLC26A7 DTD0235 PROTNAME Anion exchange transporter DTD0235 GENEDBID 115111 DTD0235 UNIPROID Q8TE54 DTD0237 TRANSPID DTD0237 DTD0237 GENENAME SLC26A9 DTD0237 PROTNAME Anion transporter/exchanger protein 9 DTD0237 GENEDBID 115019 DTD0237 UNIPROID Q7LBE3 DTD0237 GENEPOLY rs7512462 SITEOFGP chr1:205930467 (GRCh38.p12) DTD0237 GENEPOLY rs7512462 GPD_TYPE SNP DTD0237 GENEPOLY rs7512462 ALLDBSNP T>C DTD0237 GENEPOLY rs7512462 MAFDBSNP C=0.3650/1828 DTD0237 GENEPOLY rs7512462 Genotypes CC + CT Ivacaftor Cystic Fibrosis Correlated with the increased drug response in patients (compare with Genotype TT) aa DTD0238 TRANSPID DTD0238 DTD0238 GENENAME SLC27A1 DTD0238 PROTNAME Fatty acid transport protein 1 DTD0238 GENEDBID 376497 DTD0238 UNIPROID Q6PCB7 DTD0239 TRANSPID DTD0239 DTD0239 GENENAME SLC27A2 DTD0239 PROTNAME Very long-chain acyl-CoA synthetase DTD0239 GENEDBID 11001 DTD0239 UNIPROID O14975 DTD0240 TRANSPID DTD0240 DTD0240 GENENAME SLC27A3 DTD0240 PROTNAME Long-chain fatty acid transport protein 3 DTD0240 GENEDBID 11000 DTD0240 UNIPROID Q5K4L6 DTD0241 TRANSPID DTD0241 DTD0241 GENENAME SLC27A4 DTD0241 PROTNAME Long-chain fatty acid transport protein 4 DTD0241 GENEDBID 10999 DTD0241 UNIPROID Q6P1M0 DTD0241 GENEPOLY g.1777G>A (EU703769) SITEOFGP N.A. DTD0241 GENEPOLY g.1777G>A (EU703769) GPD_TYPE N.A. DTD0241 GENEPOLY g.1777G>A (EU703769) ALLDBSNP N.A. DTD0241 GENEPOLY g.1777G>A (EU703769) MAFDBSNP N.A. DTD0241 GENEPOLY g.1777G>A (EU703769) Allele G N.A. Weight gain Correlated with the increased weight gain (compare with allele A) ad DTD0242 TRANSPID DTD0242 DTD0242 GENENAME SLC27A5 DTD0242 PROTNAME Bile acid-CoA ligase DTD0242 GENEDBID 10998 DTD0242 UNIPROID Q9Y2P5 DTD0243 TRANSPID DTD0243 DTD0243 GENENAME SLC27A6 DTD0243 PROTNAME Long-chain fatty acid transport protein 6 DTD0243 GENEDBID 28965 DTD0243 UNIPROID Q9Y2P4 DTD0244 TRANSPID DTD0244 DTD0244 GENENAME SLC28A1 DTD0244 PROTNAME Concentrative nucleoside transporter 1 DTD0244 GENEDBID 9154 DTD0244 UNIPROID O00337 DTD0244 GENEPOLY rs2242046 SITEOFGP chr15:84935498 (GRCh38.p12) DTD0244 GENEPOLY rs2242046 GPD_TYPE SNP DTD0244 GENEPOLY rs2242046 ALLDBSNP G>A / G>T DTD0244 GENEPOLY rs2242046 MAFDBSNP A=0.2081/1042 DTD0244 GENEPOLY rs2242046 Genotype GG Gemcitabine Non-Small-Cell Lung Carcinoma Correlated with the decreased hematologic toxicity risk in patients (compare with genotypes AA + AG) aa DTD0244 GENEPOLY rs2290271 SITEOFGP chr15:84904404 (GRCh38.p12) DTD0244 GENEPOLY rs2290271 GPD_TYPE SNP DTD0244 GENEPOLY rs2290271 ALLDBSNP A>C DTD0244 GENEPOLY rs2290271 MAFDBSNP C=0.4383/2195 DTD0244 GENEPOLY rs2290271 Allele C Daunorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele A) aa DTD0244 GENEPOLY rs2290271 Allele C Doxorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele A) aa DTD0244 GENEPOLY rs2290271 Allele C Anthracyclines Neoplasm Correlated with the decreased likelihood of cardiotoxicity in patients (compare with Allele A) ac DTD0244 GENEPOLY rs2305364 SITEOFGP chr15:84909044 (GRCh38.p12) DTD0244 GENEPOLY rs2305364 GPD_TYPE SNP DTD0244 GENEPOLY rs2305364 ALLDBSNP T>C DTD0244 GENEPOLY rs2305364 MAFDBSNP N.A. DTD0244 GENEPOLY rs2305364 Allele T Daunorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with allele C) aa DTD0244 GENEPOLY rs2305364 Allele T Doxorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with allele C) aa DTD0244 GENEPOLY rs2305364 Allele T Anthracyclines Neoplasm Correlated with the increased likelihood of cardiotoxicity in patients (compare with allele C) ac DTD0245 TRANSPID DTD0245 DTD0245 GENENAME SLC28A2 DTD0245 PROTNAME Concentrative nucleoside transporter 2 DTD0245 GENEDBID 9153 DTD0245 UNIPROID O43868 DTD0245 GENEPOLY rs1060896 SITEOFGP chr15:45262069 (GRCh38.p12) DTD0245 GENEPOLY rs1060896 GPD_TYPE SNP DTD0245 GENEPOLY rs1060896 ALLDBSNP C>A DTD0245 GENEPOLY rs1060896 MAFDBSNP A=0.3131/1568 DTD0245 GENEPOLY rs1060896 Genotype AA Gemcitabine Pancreatic Neoplasm Irrelevant to the increased drug response in patients (compare with genotypes AC + CC) aa DTD0245 GENEPOLY rs1060896 Genotype CC Gemcitabine Non-Small-Cell Lung Carcinoma Correlated with the decreased drug response in patients (compare with genotypes AA + AC); Correlated with the decreased hematologic toxicity risk in patients (compare with genotypes AA + AC) aa DTD0245 GENEPOLY rs11854484 SITEOFGP chr15:45253280 (GRCh38.p12) DTD0245 GENEPOLY rs11854484 GPD_TYPE SNP DTD0245 GENEPOLY rs11854484 ALLDBSNP C>T DTD0245 GENEPOLY rs11854484 MAFDBSNP T=0.3029/1517 DTD0245 GENEPOLY rs11854484 Genotype CC Gemcitabine Non-Small-Cell Lung Carcinoma Correlated with the decreased drug response in patients (compare with Genotypes CT + TT); Correlated with the decreased hematologic toxicity risk in patients (compare with Genotypes CT + TT) aa DTD0245 GENEPOLY rs11854484 Genotype TT Ribavirin Hepatitis C Correlated with the increased anemia risk in patients (compare with genotypes CC + CT) aa DTD0245 GENEPOLY rs11854484 Genotype TT Peginterferon alfa-2B Hepatitis C Correlated with the increased anemia risk in patients (compare with genotypes CC + CT) aa DTD0245 GENEPOLY rs11854484 Genotype TT Protease Inhibitors Hepatitis C Correlated with the increased anemia risk in patients (compare with genotypes CC + CT) ac DTD0246 TRANSPID DTD0246 DTD0246 GENENAME SLC28A3 DTD0246 PROTNAME Concentrative Na(+)-nucleoside cotransporter 3 DTD0246 GENEDBID 64078 DTD0246 UNIPROID Q9HAS3 DTD0246 GENEPOLY rs4877847 SITEOFGP chr9:84331502 (GRCh38.p12) DTD0246 GENEPOLY rs4877847 GPD_TYPE SNP DTD0246 GENEPOLY rs4877847 ALLDBSNP A>C DTD0246 GENEPOLY rs4877847 MAFDBSNP C=0.4860/2434 DTD0246 GENEPOLY rs4877847 Allele A Daunorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele C) aa DTD0246 GENEPOLY rs4877847 Allele A Doxorubicin Neoplasm Irrelevant to the likelihood of cardiotoxicity in patients (compare with Allele C) aa DTD0246 GENEPOLY rs4877847 Allele A Anthracyclines Neoplasm Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C) ac DTD0246 GENEPOLY rs7853758 SITEOFGP chr9:84286011 (GRCh38.p12) DTD0246 GENEPOLY rs7853758 GPD_TYPE SNP DTD0246 GENEPOLY rs7853758 ALLDBSNP G>A DTD0246 GENEPOLY rs7853758 MAFDBSNP A=0.2027/1015 DTD0246 GENEPOLY rs7853758 Allele A Daunorubicin Neoplasm Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C) aa DTD0246 GENEPOLY rs7853758 Allele A Doxorubicin Neoplasm Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C) aa DTD0246 GENEPOLY rs885004 SITEOFGP chr9:84294635 (GRCh38.p12) DTD0246 GENEPOLY rs885004 GPD_TYPE SNP DTD0246 GENEPOLY rs885004 ALLDBSNP G>A DTD0246 GENEPOLY rs885004 MAFDBSNP A=0.1320/661 DTD0246 GENEPOLY rs885004 Allele A Daunorubicin Neoplasm Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C) aa DTD0246 GENEPOLY rs885004 Allele A Doxorubicin Neoplasm Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C) aa DTD0246 GENEPOLY rs885004 Allele A Anthracyclines Neoplasm Correlated with the decreased likelihood of cardiotoxicity in patients (compare with allele C) ac DTD0247 TRANSPID DTD0247 DTD0247 GENENAME SLC29A1 DTD0247 PROTNAME Equilibrative nucleoside transporter 1 DTD0247 GENEDBID 2030 DTD0247 UNIPROID Q99808 DTD0247 GENEPOLY rs747199 SITEOFGP chr6:44226608 (GRCh38.p12) DTD0247 GENEPOLY rs747199 GPD_TYPE SNP DTD0247 GENEPOLY rs747199 ALLDBSNP G>C DTD0247 GENEPOLY rs747199 MAFDBSNP C=0.1478/740 DTD0247 GENEPOLY rs747199 Allele G Gemcitabine Breast Neoplasm Correlated with the decreased drug response in patients (compare with Allele C) aa DTD0247 GENEPOLY rs747199 Allele G Paclitaxel Breast Neoplasm Correlated with the decreased drug response in patients (compare with Allele C) aa DTD0247 GENEPOLY rs760370 SITEOFGP chr6:44233216 (GRCh38.p12) DTD0247 GENEPOLY rs760370 GPD_TYPE SNP DTD0247 GENEPOLY rs760370 ALLDBSNP A>G DTD0247 GENEPOLY rs760370 MAFDBSNP G=0.2997/1501 DTD0247 GENEPOLY rs760370 Allele A Gemcitabine Breast Neoplasm Correlated with the decreased drug response in patients (compare with allele G) aa DTD0247 GENEPOLY rs760370 Allele A Paclitaxel Breast Neoplasm Correlated with the decreased drug response in patients (compare with allele G) aa DTD0247 GENEPOLY rs760370 Genotype GG Gemcitabine Pancreatic Neoplasm Correlated with the decreased drug response in patients (compare with genotypes AA + AG) aa DTD0247 GENEPOLY rs760370 Genotype GG Ribavirin Chronic Hepatitis C Correlated with the increased drug response in patients (compare with genotypes AA + AG) aa DTD0247 GENEPOLY rs760370 Genotypes AG + GG Trifluridine Colorectal Neoplasm Correlated with the increased drug response in patients (compare with genotype AA) aa DTD0247 GENEPOLY rs760370 Genotype GG Peginterferon alfa-2A Chronic Hepatitis C Correlated with the increased drug response in patients (compare with genotypes AA + AG) aa DTD0247 GENEPOLY rs760370 Genotype GG Peginterferon alfa-2B Chronic Hepatitis C Correlated with the increased drug response in patients (compare with genotypes AA + AG) aa DTD0247 GENEPOLY rs760370 Genotypes AG + GG Tipiracil hydrochloride Colorectal Neoplasm Correlated with the increased drug response in patients (compare with genotype AA) ac DTD0247 GENEPOLY rs9394992 SITEOFGP chr6:44228255 (GRCh38.p12) DTD0247 GENEPOLY rs9394992 GPD_TYPE SNP DTD0247 GENEPOLY rs9394992 ALLDBSNP C>T DTD0247 GENEPOLY rs9394992 MAFDBSNP T=0.2973/1489 DTD0247 GENEPOLY rs9394992 Genotype CC Gemcitabine Pancreatic Neoplasm Irrelevant to the increased drug response in patients (compare with Genotypes CT + TT) aa DTD0247 GENEPOLY rs9394992 Genotypes CT + TT Trifluridine Colorectal Neoplasm Correlated with the increased drug response in patients (compare with genotype CC) aa DTD0247 GENEPOLY rs9394992 Genotypes CT + TT Gemcitabine Pancreatic Neoplasm Correlated with the increased neutropenia risk in patients (compare with genotype CC) aa DTD0247 GENEPOLY rs9394992 Genotypes CT + TT Tipiracil hydrochloride Colorectal Neoplasm Correlated with the increased drug response in patients (compare with genotype CC) ac DTD0248 TRANSPID DTD0248 DTD0248 GENENAME SLC29A2 DTD0248 PROTNAME Equilibrative nucleoside transporter 2 DTD0248 GENEDBID 3177 DTD0248 UNIPROID Q14542 DTD0249 TRANSPID DTD0249 DTD0249 GENENAME SLC29A3 DTD0249 PROTNAME Equilibrative nucleoside transporter 3 DTD0249 GENEDBID 55315 DTD0249 UNIPROID Q9BZD2 DTD0249 GENEPOLY rs780668 SITEOFGP chr10:71351651 (GRCh38.p12) DTD0249 GENEPOLY rs780668 GPD_TYPE SNP DTD0249 GENEPOLY rs780668 ALLDBSNP C>T DTD0249 GENEPOLY rs780668 MAFDBSNP T=0.4798/2403 DTD0249 GENEPOLY rs780668 Allele C Gemcitabine Non-Small-Cell Lung Carcinoma Irrelevant to the neutropenia and thrombocytopenia risk in patients (compare with Allele T) aa DTD0249 GENEPOLY rs780668 Genotypes CT + TT Gemcitabine Non-Small-Cell Lung Carcinoma Correlated with the increased overall survival in patients (compare with genotype CC); Irrelevant to the progression-free survival in patients (compare with genotype CC) aa DTD0250 TRANSPID DTD0250 DTD0250 GENENAME SLC29A4 DTD0250 PROTNAME Equilibrative nucleoside transporter 4 DTD0250 GENEDBID 222962 DTD0250 UNIPROID Q7RTT9 DTD0251 TRANSPID DTD0251 DTD0251 GENENAME SLC2A1 DTD0251 PROTNAME Glucose transporter type 1 DTD0251 GENEDBID 6513 DTD0251 UNIPROID P11166 DTD0251 GENEPOLY c.2841A>T SITEOFGP N.A. DTD0251 GENEPOLY c.2841A>T GPD_TYPE N.A. DTD0251 GENEPOLY c.2841A>T ALLDBSNP N.A. DTD0251 GENEPOLY c.2841A>T MAFDBSNP N.A. DTD0251 GENEPOLY c.2841A>T Allele T N.A. Human T-lymphotropic virus 1 infection Irrelevant to the Human T-lymphotropic virus 1 infection (compare with allele A) ad DTD0251 GENEPOLY c.2841A>T Allele T N.A. Human T-lymphotropic virus 1 infection Irrelevant to the genetic susceptibility of tropical spastic paraparesis in BrazilianHuman T-lymphotropic virus 1 infected individuals (compare with allele A) ad DTD0251 GENEPOLY g.15339T>C SITEOFGP N.A. DTD0251 GENEPOLY g.15339T>C GPD_TYPE N.A. DTD0251 GENEPOLY g.15339T>C ALLDBSNP N.A. DTD0251 GENEPOLY g.15339T>C MAFDBSNP N.A. DTD0251 GENEPOLY g.15339T>C Allele C N.A. Human T-lymphotropic virus 1 infection Irrelevant to the Human T-lymphotropic virus 1 infection (compare with allele T) ad DTD0251 GENEPOLY g.15339T>C Allele C N.A. Human T-lymphotropic virus 1 infection Irrelevant to the genetic susceptibility of tropical spastic paraparesis in BrazilianHuman T-lymphotropic virus 1 infected individuals (compare with allele T) ad DTD0251 GENEPOLY g.22999G>T SITEOFGP N.A. DTD0251 GENEPOLY g.22999G>T GPD_TYPE N.A. DTD0251 GENEPOLY g.22999G>T ALLDBSNP N.A. DTD0251 GENEPOLY g.22999G>T MAFDBSNP N.A. DTD0251 GENEPOLY g.22999G>T Allele T N.A. Human T-lymphotropic virus 1 infection Irrelevant to the Human T-lymphotropic virus 1 infection (compare with allele G) ad DTD0251 GENEPOLY g.22999G>T Allele T N.A. Human T-lymphotropic virus 1 infection Irrelevant to the genetic susceptibility of tropical spastic paraparesis in BrazilianHuman T-lymphotropic virus 1 infected individuals (compare with allele G) ad DTD0251 GENEPOLY rs710218 SITEOFGP chr1:42961547 (GRCh38.p12) DTD0251 GENEPOLY rs710218 GPD_TYPE SNP DTD0251 GENEPOLY rs710218 ALLDBSNP T>A DTD0251 GENEPOLY rs710218 MAFDBSNP A=0.2196/984 DTD0251 GENEPOLY rs710218 Genotype TT N.A. In-stent Restenosis Correlated with the higher risk for angiographically significant in-stent restenosis (comare with genotypes AA + AT) ad DTD0252 TRANSPID DTD0252 DTD0252 GENENAME SLC2A10 DTD0252 PROTNAME Glucose transporter type 10 DTD0252 GENEDBID 81031 DTD0252 UNIPROID O95528 DTD0252 GENEPOLY rs3092412, rs2425904, rs2235491, rs1059217 SITEOFGP N.A. DTD0252 GENEPOLY rs3092412, rs2425904, rs2235491, rs1059217 GPD_TYPE N.A. DTD0252 GENEPOLY rs3092412, rs2425904, rs2235491, rs1059217 ALLDBSNP N.A. DTD0252 GENEPOLY rs3092412, rs2425904, rs2235491, rs1059217 MAFDBSNP N.A. DTD0252 GENEPOLY rs3092412, rs2425904, rs2235491, rs1059217 Haplotype A-G-T-C N.A. Type 2 diabetes Correlated with the type 2 diabetes susceptibility (compare with wide type) ad DTD0253 TRANSPID DTD0253 DTD0253 GENENAME SLC2A11 DTD0253 PROTNAME Glucose transporter type 11 DTD0253 GENEDBID 66035 DTD0253 UNIPROID Q9BYW1 DTD0254 TRANSPID DTD0254 DTD0254 GENENAME SLC2A12 DTD0254 PROTNAME Glucose transporter type 12 DTD0254 GENEDBID 154091 DTD0254 UNIPROID Q8TD20 DTD0255 TRANSPID DTD0255 DTD0255 GENENAME SLC2A13 DTD0255 PROTNAME Proton myo-inositol cotransporter DTD0255 GENEDBID 114134 DTD0255 UNIPROID Q96QE2 DTD0256 TRANSPID DTD0256 DTD0256 GENENAME SLC2A14 DTD0256 PROTNAME Glucose transporter type 14 DTD0256 GENEDBID 144195 DTD0256 UNIPROID Q8TDB8 DTD0257 TRANSPID DTD0257 DTD0257 GENENAME SLC2A2 DTD0257 PROTNAME Glucose transporter type 2 DTD0257 GENEDBID 6514 DTD0257 UNIPROID P11168 DTD0257 GENEPOLY rs8192675 SITEOFGP chr3:171007094 (GRCh38.p12) DTD0257 GENEPOLY rs8192675 GPD_TYPE SNP DTD0257 GENEPOLY rs8192675 ALLDBSNP T>C DTD0257 GENEPOLY rs8192675 MAFDBSNP C=0.4123/2065 DTD0257 GENEPOLY rs8192675 Allele C Metformin Diabetes Mellitus Correlated with the increased drug response in patients (compare with Allele T) aa DTD0258 TRANSPID DTD0258 DTD0258 GENENAME SLC2A3 DTD0258 PROTNAME Glucose transporter type 3 DTD0258 GENEDBID 6515 DTD0258 UNIPROID P11169 DTD0258 GENEPOLY rs12842 SITEOFGP chr12:7919412 (GRCh38.p12) DTD0258 GENEPOLY rs12842 GPD_TYPE SNP DTD0258 GENEPOLY rs12842 ALLDBSNP T>C / T>G DTD0258 GENEPOLY rs12842 MAFDBSNP T=0.0938/470 DTD0258 GENEPOLY rs12842 Allele T N.A. Attention-deficit/hyperactivity disorder (ADHD) Correlated with the risk of attention-deficit/hyperactivity disorder (compare with C) ad DTD0262 TRANSPID DTD0262 DTD0262 GENENAME SLC2A4 DTD0262 PROTNAME Glucose transporter type 4 DTD0262 GENEDBID 6517 DTD0262 UNIPROID P14672 DTD0262 GENEPOLY rs8082645 SITEOFGP chr17:7287116 (GRCh38.p12) DTD0262 GENEPOLY rs8082645 GPD_TYPE SNP DTD0262 GENEPOLY rs8082645 ALLDBSNP T>G DTD0262 GENEPOLY rs8082645 MAFDBSNP T=0.4718/10217 DTD0262 GENEPOLY rs8082645 Allele T N.A. Type 2 diabetes Correlated with the expression of transport in visceral adipose tissue (compare with allele G) ad DTD0263 TRANSPID DTD0263 DTD0263 GENENAME SLC2A5 DTD0263 PROTNAME Glucose transporter type 5 DTD0263 GENEDBID 6518 DTD0263 UNIPROID P22732 DTD0264 TRANSPID DTD0264 DTD0264 GENENAME SLC2A6 DTD0264 PROTNAME Glucose transporter type 6 DTD0264 GENEDBID 11182 DTD0264 UNIPROID Q9UGQ3 DTD0265 TRANSPID DTD0265 DTD0265 GENENAME SLC2A7 DTD0265 PROTNAME Glucose transporter type 7 DTD0265 GENEDBID 155184 DTD0265 UNIPROID Q6PXP3 DTD0266 TRANSPID DTD0266 DTD0266 GENENAME SLC2A8 DTD0266 PROTNAME Glucose transporter type 8 DTD0266 GENEDBID 29988 DTD0266 UNIPROID Q9NY64 DTD0267 TRANSPID DTD0267 DTD0267 GENENAME SLC2A9 DTD0267 PROTNAME Glucose transporter type 9 DTD0267 GENEDBID 56606 DTD0267 UNIPROID Q9NRM0 DTD0267 GENEPOLY rs1014290 SITEOFGP chr4:10000237 (GRCh38.p12) DTD0267 GENEPOLY rs1014290 GPD_TYPE SNP DTD0267 GENEPOLY rs1014290 ALLDBSNP G>A DTD0267 GENEPOLY rs1014290 MAFDBSNP G=0.2281/1022 DTD0267 GENEPOLY rs1014290 Allele C N.A. Gout Correlated with the risk for gout (compare with allele T) ad DTD0267 GENEPOLY rs12510549 SITEOFGP chr4:10274843 (GRCh38.p12) DTD0267 GENEPOLY rs12510549 GPD_TYPE SNP DTD0267 GENEPOLY rs12510549 ALLDBSNP T>C DTD0267 GENEPOLY rs12510549 MAFDBSNP C=0.1673/838 DTD0267 GENEPOLY rs12510549 Allele C N.A. Gout Correlated with the protected against the development of gout (compare with allele T) ad DTD0267 GENEPOLY rs16890979 SITEOFGP chr4:9920543 (GRCh38.p12) DTD0267 GENEPOLY rs16890979 GPD_TYPE SNP DTD0267 GENEPOLY rs16890979 ALLDBSNP C>T DTD0267 GENEPOLY rs16890979 MAFDBSNP T=0.1855/831 DTD0267 GENEPOLY rs16890979 Allele T N.A. Gout Correlated with the risk for gout (compare with allele C) ad DTD0267 GENEPOLY rs3733591 SITEOFGP chr4:9920506 (GRCh38.p12) DTD0267 GENEPOLY rs3733591 GPD_TYPE SNP DTD0267 GENEPOLY rs3733591 ALLDBSNP C>T DTD0267 GENEPOLY rs3733591 MAFDBSNP T=0.1494/1943 DTD0267 GENEPOLY rs3733591 Allele C N.A. Gout Correlated with the increased gout susceptibility (compare with allele T) ad DTD0269 TRANSPID DTD0269 DTD0269 GENENAME SLC30A1 DTD0269 PROTNAME Zinc transporter 1 DTD0269 GENEDBID 7779 DTD0269 UNIPROID Q9Y6M5 DTD0270 TRANSPID DTD0270 DTD0270 GENENAME SLC30A10 DTD0270 PROTNAME Zinc transporter 10 DTD0270 GENEDBID 55532 DTD0270 UNIPROID Q6XR72 DTD0271 TRANSPID DTD0271 DTD0271 GENENAME SLC30A2 DTD0271 PROTNAME Zinc transporter 2 DTD0271 GENEDBID 7780 DTD0271 UNIPROID Q9BRI3 DTD0272 TRANSPID DTD0272 DTD0272 GENENAME SLC30A3 DTD0272 PROTNAME Zinc transporter 3 DTD0272 GENEDBID 7781 DTD0272 UNIPROID Q99726 DTD0273 TRANSPID DTD0273 DTD0273 GENENAME SLC30A4 DTD0273 PROTNAME Zinc transporter 4 DTD0273 GENEDBID 7782 DTD0273 UNIPROID O14863 DTD0274 TRANSPID DTD0274 DTD0274 GENENAME SLC30A5 DTD0274 PROTNAME Zinc transporter 5 DTD0274 GENEDBID 64924 DTD0274 UNIPROID Q8TAD4 DTD0275 TRANSPID DTD0275 DTD0275 GENENAME SLC30A6 DTD0275 PROTNAME Zinc transporter 6 DTD0275 GENEDBID 55676 DTD0275 UNIPROID Q6NXT4 DTD0276 TRANSPID DTD0276 DTD0276 GENENAME SLC30A7 DTD0276 PROTNAME Zinc transporter 7 DTD0276 GENEDBID 148867 DTD0276 UNIPROID Q8NEW0 DTD0277 TRANSPID DTD0277 DTD0277 GENENAME SLC30A9 DTD0277 PROTNAME Zinc transporter 9 DTD0277 GENEDBID 10463 DTD0277 UNIPROID Q6PML9 DTD0277 GENEPOLY rs1047626 SITEOFGP chr4:42001654 (GRCh38.p12) DTD0277 GENEPOLY rs1047626 GPD_TYPE SNP DTD0277 GENEPOLY rs1047626 ALLDBSNP A>C / A>G DTD0277 GENEPOLY rs1047626 MAFDBSNP A=0.3716/1861 DTD0277 GENEPOLY rs1047626 Allele A Aspirin Asthma Correlated with the decreased aspirin-induced asthma risk in patients (compare with allele G) aa DTD0278 TRANSPID DTD0278 DTD0278 GENENAME SLC31A1 DTD0278 PROTNAME High affinity copper uptake protein 1 DTD0278 GENEDBID 1317 DTD0278 UNIPROID O15431 DTD0278 GENEPOLY rs10759637 SITEOFGP chr9:113262744 (GRCh38.p12) DTD0278 GENEPOLY rs10759637 GPD_TYPE SNP DTD0278 GENEPOLY rs10759637 ALLDBSNP A>C DTD0278 GENEPOLY rs10759637 MAFDBSNP A=0.4908/2458 DTD0278 GENEPOLY rs10759637 Genotype AC Platinum compounds Non-Small-Cell Lung Carcinoma Correlated with the decreased likelihood of overall survival in patients (compare with genotypes AA + CC) ac DTD0278 GENEPOLY rs10759637 Genotype AC Platinum compounds Thrombocytopenia Correlated with the increased severity of thrombocytopenia in patients (compare with genotypes AA + CC) ac DTD0278 GENEPOLY rs10817464 SITEOFGP chr9:113230217 (GRCh38.p12) DTD0278 GENEPOLY rs10817464 GPD_TYPE SNP DTD0278 GENEPOLY rs10817464 ALLDBSNP T>A / T>C DTD0278 GENEPOLY rs10817464 MAFDBSNP C=0.0946/474 DTD0278 GENEPOLY rs10817464 Allele T Platinum compounds Non-Small-Cell Lung Carcinoma Irrelevant to the likelihood of overall survival and progression-free survival in patients (compare with allele C) ac DTD0278 GENEPOLY rs10817464 Genotypes CC + CT Platinum compounds Non-Small-Cell Lung Carcinoma Correlated with the increased severity of drug toxicity, hematologic diseases, leukopenia and thrombocytopenia in patients (compare with Genotype TT) ac DTD0278 GENEPOLY rs10981694 SITEOFGP chr9:113224129 (GRCh38.p12) DTD0278 GENEPOLY rs10981694 GPD_TYPE SNP DTD0278 GENEPOLY rs10981694 ALLDBSNP T>G DTD0278 GENEPOLY rs10981694 MAFDBSNP G=0.1160/581 DTD0278 GENEPOLY rs10981694 Allele G Cisplatin Testicular Neoplasm Irrelevant to the likelihood of ototoxicity in patients (compare with Allele T) aa DTD0278 GENEPOLY rs10981694 Genotypes GG + GT Cisplatin Non-Small-Cell Lung Carcinoma Correlated with the increased severity of ototoxicity in patients (compare with Genotype TT) aa DTD0278 GENEPOLY rs2233914 SITEOFGP chr9:113221260 (GRCh38.p12) DTD0278 GENEPOLY rs2233914 GPD_TYPE SNP DTD0278 GENEPOLY rs2233914 ALLDBSNP G>A DTD0278 GENEPOLY rs2233914 MAFDBSNP A=0.2015/1009 DTD0278 GENEPOLY rs2233914 Genotype AA Platinum compounds Non-Small-Cell Lung Carcinoma Correlated with the decreased severity of drug toxicity in patients (compare with Genotypes AG + GG); Correlated with the increased likelihood of overall survival in patients (compare with genotypes AG + GG) ac DTD0278 GENEPOLY rs4978536 SITEOFGP chr9:113220123 (GRCh38.p12) DTD0278 GENEPOLY rs4978536 GPD_TYPE SNP DTD0278 GENEPOLY rs4978536 ALLDBSNP A>G DTD0278 GENEPOLY rs4978536 MAFDBSNP G=0.3051/1528 DTD0278 GENEPOLY rs4978536 Genotypes AG + GG Platinum compounds Non-Small-Cell Lung Carcinoma Correlated with the increased severity of thrombocytopenia in patients (compare with genotype AA) ac DTD0278 GENEPOLY rs4979223 SITEOFGP chr9:113219836 (GRCh38.p12) DTD0278 GENEPOLY rs4979223 GPD_TYPE SNP DTD0278 GENEPOLY rs4979223 ALLDBSNP A>C DTD0278 GENEPOLY rs4979223 MAFDBSNP A=0.4718/2363 DTD0278 GENEPOLY rs4979223 Genotype AC Platinum compounds Non-Small-Cell Lung Carcinoma Correlated with the decreased likelihood of overall survival in patients (compare with genotypes AA + CC) ac DTD0278 GENEPOLY rs4979223 Genotype AC Platinum compounds Thrombocytopenia Correlated with the increased severity of thrombocytopenia in patients (compare with genotypes AA + CC) ac DTD0278 GENEPOLY rs7851395 SITEOFGP chr9:113240184 (GRCh38.p12) DTD0278 GENEPOLY rs7851395 GPD_TYPE SNP DTD0278 GENEPOLY rs7851395 ALLDBSNP A>G DTD0278 GENEPOLY rs7851395 MAFDBSNP A=0.4934/2471 DTD0278 GENEPOLY rs7851395 Genotype AA Cisplatin Non-Small-Cell Lung Carcinoma Correlated with the increased overall survival in patients (compare with genotypes AG + GG) aa DTD0278 GENEPOLY rs7851395 Genotype AA Carboplatin Non-Small-Cell Lung Carcinoma Correlated with the increased overall survival in patients (compare with genotypes AG + GG) aa DTD0280 TRANSPID DTD0280 DTD0280 GENENAME SLC31A2 DTD0280 PROTNAME Probable low affinity copper uptake protein 2 DTD0280 GENEDBID 1318 DTD0280 UNIPROID O15432 DTD0281 TRANSPID DTD0281 DTD0281 GENENAME SLC32A1 DTD0281 PROTNAME Vesicular inhibitory amino acid transporter DTD0281 GENEDBID 140679 DTD0281 UNIPROID Q9H598 DTD0282 TRANSPID DTD0282 DTD0282 GENENAME SLC33A1 DTD0282 PROTNAME Acetyl-coenzyme A transporter 1 DTD0282 GENEDBID 9197 DTD0282 UNIPROID O00400 DTD0284 TRANSPID DTD0284 DTD0284 GENENAME SLC34A1 DTD0284 PROTNAME Sodium-dependent phosphate transport protein 2A DTD0284 GENEDBID 6569 DTD0284 UNIPROID Q06495 DTD0285 TRANSPID DTD0285 DTD0285 GENENAME SLC34A2 DTD0285 PROTNAME Sodium-dependent phosphate transport protein 2B DTD0285 GENEDBID 10568 DTD0285 UNIPROID O95436 DTD0286 TRANSPID DTD0286 DTD0286 GENENAME SLC34A3 DTD0286 PROTNAME Sodium-dependent phosphate transport protein 2C DTD0286 GENEDBID 142680 DTD0286 UNIPROID Q8N130 DTD0287 TRANSPID DTD0287 DTD0287 GENENAME SLC35A1 DTD0287 PROTNAME CMP-sialic acid transporter DTD0287 GENEDBID 10559 DTD0287 UNIPROID P78382 DTD0288 TRANSPID DTD0288 DTD0288 GENENAME SLC35A2 DTD0288 PROTNAME UDP-galactose translocator DTD0288 GENEDBID 7355 DTD0288 UNIPROID P78381 DTD0289 TRANSPID DTD0289 DTD0289 GENENAME SLC35A3 DTD0289 PROTNAME UDP-N-acetylglucosamine transporter DTD0289 GENEDBID 23443 DTD0289 UNIPROID Q9Y2D2 DTD0290 TRANSPID DTD0290 DTD0290 GENENAME SLC35A4 DTD0290 PROTNAME Probable UDP-sugar transporter protein SLC35A4 DTD0290 GENEDBID 113829 DTD0290 UNIPROID Q96G79 DTD0291 TRANSPID DTD0291 DTD0291 GENENAME SLC35A5 DTD0291 PROTNAME Probable UDP-sugar transporter protein SLC35A5 DTD0291 GENEDBID 55032 DTD0291 UNIPROID Q9BS91 DTD0292 TRANSPID DTD0292 DTD0292 GENENAME SLC35B1 DTD0292 PROTNAME UDP-galactose transporter-related protein 1 DTD0292 GENEDBID 10237 DTD0292 UNIPROID P78383 DTD0293 TRANSPID DTD0293 DTD0293 GENENAME SLC35B2 DTD0293 PROTNAME Adenosine 3'-phospho 5'-phosphosulfate transporter 1 DTD0293 GENEDBID 347734 DTD0293 UNIPROID Q8TB61 DTD0294 TRANSPID DTD0294 DTD0294 GENENAME SLC35B3 DTD0294 PROTNAME Adenosine 3'-phospho 5'-phosphosulfate transporter 2 DTD0294 GENEDBID 51000 DTD0294 UNIPROID Q9H1N7 DTD0295 TRANSPID DTD0295 DTD0295 GENENAME SLC35B4 DTD0295 PROTNAME UDP-xylose and UDP-N-acetylglucosamine transporter DTD0295 GENEDBID 84912 DTD0295 UNIPROID Q969S0 DTD0296 TRANSPID DTD0296 DTD0296 GENENAME SLC35C1 DTD0296 PROTNAME GDP-fucose transporter 1 DTD0296 GENEDBID 55343 DTD0296 UNIPROID Q96A29 DTD0298 TRANSPID DTD0298 DTD0298 GENENAME SLC35D1 DTD0298 PROTNAME UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter DTD0298 GENEDBID 23169 DTD0298 UNIPROID Q9NTN3 DTD0299 TRANSPID DTD0299 DTD0299 GENENAME SLC35D2 DTD0299 PROTNAME UDP-N-acetylglucosamine/UDP-glucose/GDP-mannose transporter DTD0299 GENEDBID 11046 DTD0299 UNIPROID Q76EJ3 DTD0300 TRANSPID DTD0300 DTD0300 GENENAME SLC35D3 DTD0300 PROTNAME Fringe connection-like protein 1 DTD0300 GENEDBID 340146 DTD0300 UNIPROID Q5M8T2 DTD0305 TRANSPID DTD0305 DTD0305 GENENAME SLC35E4 DTD0305 PROTNAME Solute carrier family 35 member E4 DTD0305 GENEDBID 339665 DTD0305 UNIPROID Q6ICL7 DTD0308 TRANSPID DTD0308 DTD0308 GENENAME SLC35F3 DTD0308 PROTNAME Putative thiamine transporter SLC35F3 DTD0308 GENEDBID 148641 DTD0308 UNIPROID Q8IY50 DTD0311 TRANSPID DTD0311 DTD0311 GENENAME SLC35F6 DTD0311 PROTNAME ANT2-binding protein DTD0311 GENEDBID 54978 DTD0311 UNIPROID Q8N357 DTD0318 TRANSPID DTD0318 DTD0318 GENENAME SLC36A1 DTD0318 PROTNAME Proton-coupled amino acid transporter 1 DTD0318 GENEDBID 206358 DTD0318 UNIPROID Q7Z2H8 DTD0319 TRANSPID DTD0319 DTD0319 GENENAME SLC36A2 DTD0319 PROTNAME Proton-coupled amino acid transporter 2 DTD0319 GENEDBID 153201 DTD0319 UNIPROID Q495M3 DTD0320 TRANSPID DTD0320 DTD0320 GENENAME SLC36A3 DTD0320 PROTNAME Proton-coupled amino acid transporter 3 DTD0320 GENEDBID 285641 DTD0320 UNIPROID Q495N2 DTD0321 TRANSPID DTD0321 DTD0321 GENENAME SLC36A4 DTD0321 PROTNAME Proton-coupled amino acid transporter 4 DTD0321 GENEDBID 120103 DTD0321 UNIPROID Q6YBV0 DTD0322 TRANSPID DTD0322 DTD0322 GENENAME SLC37A1 DTD0322 PROTNAME Glycerol-3-phosphate permease DTD0322 GENEDBID 54020 DTD0322 UNIPROID P57057 DTD0323 TRANSPID DTD0323 DTD0323 GENENAME SLC37A2 DTD0323 PROTNAME Glucose-6-phosphate exchanger SLC37A2 DTD0323 GENEDBID 219855 DTD0323 UNIPROID Q8TED4 DTD0324 TRANSPID DTD0324 DTD0324 GENENAME SLC37A3 DTD0324 PROTNAME Sugar phosphate exchanger 3 DTD0324 GENEDBID 84255 DTD0324 UNIPROID Q8NCC5 DTD0325 TRANSPID DTD0325 DTD0325 GENENAME SLC37A4 DTD0325 PROTNAME Glucose-6-phosphate translocase DTD0325 GENEDBID 2542 DTD0325 UNIPROID O43826 DTD0326 TRANSPID DTD0326 DTD0326 GENENAME SLC38A1 DTD0326 PROTNAME Sodium-coupled neutral amino acid transporter 1 DTD0326 GENEDBID 81539 DTD0326 UNIPROID Q9H2H9 DTD0327 TRANSPID DTD0327 DTD0327 GENENAME SLC38A10 DTD0327 PROTNAME Putative sodium-coupled neutral amino acid transporter 10 DTD0327 GENEDBID 124565 DTD0327 UNIPROID Q9HBR0 DTD0328 TRANSPID DTD0328 DTD0328 GENENAME SLC38A11 DTD0328 PROTNAME Putative sodium-coupled neutral amino acid transporter 11 DTD0328 GENEDBID 151258 DTD0328 UNIPROID Q08AI6 DTD0329 TRANSPID DTD0329 DTD0329 GENENAME SLC38A2 DTD0329 PROTNAME Sodium-coupled neutral amino acid transporter 2 DTD0329 GENEDBID 54407 DTD0329 UNIPROID Q96QD8 DTD0329 GENEPOLY rs1799931 SITEOFGP chr8:18400860 (GRCh38.p12) DTD0329 GENEPOLY rs1799931 GPD_TYPE SNP DTD0329 GENEPOLY rs1799931 ALLDBSNP G>A DTD0329 GENEPOLY rs1799931 MAFDBSNP A=0.0197/76 DTD0329 GENEPOLY rs1799931 Allele A N.A. Acute myeloid leukemia Correlated with the decreased risk for acute myeloid leukemia (compare with allele G) ad DTD0330 TRANSPID DTD0330 DTD0330 GENENAME SLC38A3 DTD0330 PROTNAME Sodium-coupled neutral amino acid transporter 3 DTD0330 GENEDBID 10991 DTD0330 UNIPROID Q99624 DTD0331 TRANSPID DTD0331 DTD0331 GENENAME SLC38A4 DTD0331 PROTNAME Sodium-coupled neutral amino acid transporter 4 DTD0331 GENEDBID 55089 DTD0331 UNIPROID Q969I6 DTD0332 TRANSPID DTD0332 DTD0332 GENENAME SLC38A5 DTD0332 PROTNAME Sodium-coupled neutral amino acid transporter 5 DTD0332 GENEDBID 92745 DTD0332 UNIPROID Q8WUX1 DTD0333 TRANSPID DTD0333 DTD0333 GENENAME SLC38A6 DTD0333 PROTNAME Probable sodium-coupled neutral amino acid transporter 6 DTD0333 GENEDBID 145389 DTD0333 UNIPROID Q8IZM9 DTD0333 GENEPOLY 263 locus SITEOFGP N.A. DTD0333 GENEPOLY 263 locus GPD_TYPE N.A. DTD0333 GENEPOLY 263 locus ALLDBSNP N.A. DTD0333 GENEPOLY 263 locus MAFDBSNP T=0.1433/642 DTD0333 GENEPOLY 263 locus Genotypes AA + AG Salazosulfamide Ankylosing spondylitis Correlated with the drug sensitivity in patients (compare with genotype GG) ac DTD0334 TRANSPID DTD0334 DTD0334 GENENAME SLC38A7 DTD0334 PROTNAME Putative sodium-coupled neutral amino acid transporter 7 DTD0334 GENEDBID 55238 DTD0334 UNIPROID Q9NVC3 DTD0335 TRANSPID DTD0335 DTD0335 GENENAME SLC38A8 DTD0335 PROTNAME Putative sodium-coupled neutral amino acid transporter 8 DTD0335 GENEDBID 146167 DTD0335 UNIPROID A6NNN8 DTD0336 TRANSPID DTD0336 DTD0336 GENENAME SLC38A9 DTD0336 PROTNAME Sodium-coupled neutral amino acid transporter 9 DTD0336 GENEDBID 153129 DTD0336 UNIPROID Q8NBW4 DTD0337 TRANSPID DTD0337 DTD0337 GENENAME SLC39A1 DTD0337 PROTNAME Zrt- and Irt-like protein 1 DTD0337 GENEDBID 27173 DTD0337 UNIPROID Q9NY26 DTD0338 TRANSPID DTD0338 DTD0338 GENENAME SLC39A10 DTD0338 PROTNAME Zrt- and Irt-like protein 10 DTD0338 GENEDBID 57181 DTD0338 UNIPROID Q9ULF5 DTD0339 TRANSPID DTD0339 DTD0339 GENENAME SLC39A11 DTD0339 PROTNAME Zrt- and Irt-like protein 11 DTD0339 GENEDBID 201266 DTD0339 UNIPROID Q8N1S5 DTD0340 TRANSPID DTD0340 DTD0340 GENENAME SLC39A12 DTD0340 PROTNAME Zrt- and Irt-like protein 12 DTD0340 GENEDBID 221074 DTD0340 UNIPROID Q504Y0 DTD0341 TRANSPID DTD0341 DTD0341 GENENAME SLC39A13 DTD0341 PROTNAME Zrt- and Irt-like protein 13 DTD0341 GENEDBID 91252 DTD0341 UNIPROID Q96H72 DTD0342 TRANSPID DTD0342 DTD0342 GENENAME SLC39A14 DTD0342 PROTNAME Zrt- and Irt-like protein 14 DTD0342 GENEDBID 23516 DTD0342 UNIPROID Q15043 DTD0342 GENEPOLY rs17060812 SITEOFGP chr8:22371315 (GRCh38.p12) DTD0342 GENEPOLY rs17060812 GPD_TYPE SNP DTD0342 GENEPOLY rs17060812 ALLDBSNP C>T DTD0342 GENEPOLY rs17060812 MAFDBSNP T=0.1346/674 DTD0342 GENEPOLY rs17060812 Allele C Nortriptyline Depression Correlated with the increased drug response in patients (compare with Allele T) aa DTD0343 TRANSPID DTD0343 DTD0343 GENENAME SLC39A2 DTD0343 PROTNAME Zrt- and Irt-like protein 2 DTD0343 GENEDBID 29986 DTD0343 UNIPROID Q9NP94 DTD0344 TRANSPID DTD0344 DTD0344 GENENAME SLC39A3 DTD0344 PROTNAME Zrt- and Irt-like protein 3 DTD0344 GENEDBID 29985 DTD0344 UNIPROID Q9BRY0 DTD0345 TRANSPID DTD0345 DTD0345 GENENAME SLC39A4 DTD0345 PROTNAME Zrt- and Irt-like protein 4 DTD0345 GENEDBID 55630 DTD0345 UNIPROID Q6P5W5 DTD0346 TRANSPID DTD0346 DTD0346 GENENAME SLC39A5 DTD0346 PROTNAME Zrt- and Irt-like protein 5 DTD0346 GENEDBID 283375 DTD0346 UNIPROID Q6ZMH5 DTD0347 TRANSPID DTD0347 DTD0347 GENENAME SLC39A6 DTD0347 PROTNAME Zrt- and Irt-like protein 6 DTD0347 GENEDBID 25800 DTD0347 UNIPROID Q13433 DTD0348 TRANSPID DTD0348 DTD0348 GENENAME SLC39A7 DTD0348 PROTNAME Zrt- Irt-like protein 7 DTD0348 GENEDBID 7922 DTD0348 UNIPROID Q92504 DTD0349 TRANSPID DTD0349 DTD0349 GENENAME SLC39A8 DTD0349 PROTNAME Zrt- and Irt-like protein 8 DTD0349 GENEDBID 64116 DTD0349 UNIPROID Q9C0K1 DTD0350 TRANSPID DTD0350 DTD0350 GENENAME SLC39A9 DTD0350 PROTNAME Zrt- and Irt-like protein 9 DTD0350 GENEDBID 55334 DTD0350 UNIPROID Q9NUM3 DTD0351 TRANSPID DTD0351 DTD0351 GENENAME SLC3A1 DTD0351 PROTNAME Neutral and basic amino acid transport protein rBAT DTD0351 GENEDBID 6519 DTD0351 UNIPROID Q07837 DTD0352 TRANSPID DTD0352 DTD0352 GENENAME SLC3A2 DTD0352 PROTNAME Lymphocyte activation antigen 4F2 DTD0352 GENEDBID 6520 DTD0352 UNIPROID P08195 DTD0353 TRANSPID DTD0353 DTD0353 GENENAME SLC40A1 DTD0353 PROTNAME Iron-regulated transporter 1 DTD0353 GENEDBID 30061 DTD0353 UNIPROID Q9NP59 DTD0354 TRANSPID DTD0354 DTD0354 GENENAME SLC41A1 DTD0354 PROTNAME Magnesium transporter protein solute carrier family 41 member 1 DTD0354 GENEDBID 254428 DTD0354 UNIPROID Q8IVJ1 DTD0355 TRANSPID DTD0355 DTD0355 GENENAME SLC41A2 DTD0355 PROTNAME Magnesium transporter protein solute carrier family 41 member 2 DTD0355 GENEDBID 84102 DTD0355 UNIPROID Q96JW4 DTD0356 TRANSPID DTD0356 DTD0356 GENENAME SLC41A3 DTD0356 PROTNAME Magnesium transporter protein solute carrier family 41 member 3 DTD0356 GENEDBID 54946 DTD0356 UNIPROID Q96GZ6 DTD0358 TRANSPID DTD0358 DTD0358 GENENAME SLC42A2 DTD0358 PROTNAME Ammonium transporter Rh type B DTD0358 GENEDBID 57127 DTD0358 UNIPROID Q9H310 DTD0359 TRANSPID DTD0359 DTD0359 GENENAME SLC42A3 DTD0359 PROTNAME Ammonium transporter Rh type C DTD0359 GENEDBID 51458 DTD0359 UNIPROID Q9UBD6 DTD0360 TRANSPID DTD0360 DTD0360 GENENAME SLC43A1 DTD0360 PROTNAME L-type amino acid transporter 3 DTD0360 GENEDBID 8501 DTD0360 UNIPROID O75387 DTD0361 TRANSPID DTD0361 DTD0361 GENENAME SLC43A2 DTD0361 PROTNAME L-type amino acid transporter 4 DTD0361 GENEDBID 124935 DTD0361 UNIPROID Q8N370 DTD0362 TRANSPID DTD0362 DTD0362 GENENAME SLC43A3 DTD0362 PROTNAME Equilibrative nucleobase transporter 1 DTD0362 GENEDBID 29015 DTD0362 UNIPROID Q8NBI5 DTD0363 TRANSPID DTD0363 DTD0363 GENENAME SLC44A1 DTD0363 PROTNAME Choline transporter-like protein 1 DTD0363 GENEDBID 23446 DTD0363 UNIPROID Q8WWI5 DTD0363 GENEPOLY rs3199966 SITEOFGP chr9:105385482 (GRCh38.p12) DTD0363 GENEPOLY rs3199966 GPD_TYPE SNP DTD0363 GENEPOLY rs3199966 ALLDBSNP T>G DTD0363 GENEPOLY rs3199966 MAFDBSNP G=0.0725/325 DTD0363 GENEPOLY rs3199966 Allele G Choline Muscle dysfunction Correlated with the increased risk muscle damage (compare with allele T) aa DTD0363 GENEPOLY rs7873937 SITEOFGP chr9:105327040 (GRCh38.p12) DTD0363 GENEPOLY rs7873937 GPD_TYPE SNP DTD0363 GENEPOLY rs7873937 ALLDBSNP G>C DTD0363 GENEPOLY rs7873937 MAFDBSNP C=0.1100/493 DTD0363 GENEPOLY rs7873937 Allele C Choline Muscle dysfunction Correlated with the altered the distribution of dietary choline between the CDP-choline and phosphatidylethanolamine N-methyltransferase (PEMT) denovo pathway (compare with allele G) aa DTD0364 TRANSPID DTD0364 DTD0364 GENENAME SLC44A2 DTD0364 PROTNAME Choline transporter-like protein 2 DTD0364 GENEDBID 57153 DTD0364 UNIPROID Q8IWA5 DTD0366 TRANSPID DTD0366 DTD0366 GENENAME SLC44A4 DTD0366 PROTNAME Choline transporter-like protein 4 DTD0366 GENEDBID 80736 DTD0366 UNIPROID Q53GD3 DTD0367 TRANSPID DTD0367 DTD0367 GENENAME SLC44A5 DTD0367 PROTNAME Choline transporter-like protein 5 DTD0367 GENEDBID 204962 DTD0367 UNIPROID Q8NCS7 DTD0368 TRANSPID DTD0368 DTD0368 GENENAME SLC45A1 DTD0368 PROTNAME Proton-associated sugar transporter A DTD0368 GENEDBID 50651 DTD0368 UNIPROID Q9Y2W3 DTD0369 TRANSPID DTD0369 DTD0369 GENENAME SLC45A2 DTD0369 PROTNAME Membrane-associated transporter protein DTD0369 GENEDBID 51151 DTD0369 UNIPROID Q9UMX9 DTD0369 GENEPOLY rs185146 SITEOFGP chr5:33952001 (GRCh38.p12) DTD0369 GENEPOLY rs185146 GPD_TYPE SNP DTD0369 GENEPOLY rs185146 ALLDBSNP C>T DTD0369 GENEPOLY rs185146 MAFDBSNP C=0.0158/71 DTD0369 GENEPOLY rs185146 Allele C Melanin Skin cancers Correlated with the skin aging trait (compare with allele T) ac DTD0370 TRANSPID DTD0370 DTD0370 GENENAME SLC45A3 DTD0370 PROTNAME Solute carrier family 45 member 3 DTD0370 GENEDBID 85414 DTD0370 UNIPROID Q96JT2 DTD0371 TRANSPID DTD0371 DTD0371 GENENAME SLC45A4 DTD0371 PROTNAME Solute carrier family 45 member 4 DTD0371 GENEDBID 57210 DTD0371 UNIPROID Q5BKX6 DTD0372 TRANSPID DTD0372 DTD0372 GENENAME SLC46A1 DTD0372 PROTNAME Proton-coupled folate transporter DTD0372 GENEDBID 113235 DTD0372 UNIPROID Q96NT5 DTD0373 TRANSPID DTD0373 DTD0373 GENENAME SLC46A2 DTD0373 PROTNAME Thymic stromal cotransporter homolog DTD0373 GENEDBID 57864 DTD0373 UNIPROID Q9BY10 DTD0375 TRANSPID DTD0375 DTD0375 GENENAME SLC48A1 DTD0375 PROTNAME Heme transporter HRG1 DTD0375 GENEDBID 55652 DTD0375 UNIPROID Q6P1K1 DTD0376 TRANSPID DTD0376 DTD0376 GENENAME SLC49A1 DTD0376 PROTNAME Feline leukemia virus subgroup C receptor-related protein 1 DTD0376 GENEDBID 28982 DTD0376 UNIPROID Q9Y5Y0 DTD0377 TRANSPID DTD0377 DTD0377 GENENAME SLC49A2 DTD0377 PROTNAME Feline leukemia virus subgroup C receptor-related protein 2 DTD0377 GENEDBID 55640 DTD0377 UNIPROID Q9UPI3 DTD0380 TRANSPID DTD0380 DTD0380 GENENAME SLC4A1 DTD0380 PROTNAME Anion exchange protein 1 DTD0380 GENEDBID 6521 DTD0380 UNIPROID P02730 DTD0381 TRANSPID DTD0381 DTD0381 GENENAME SLC4A10 DTD0381 PROTNAME Sodium-driven chloride bicarbonate exchanger DTD0381 GENEDBID 57282 DTD0381 UNIPROID Q6U841 DTD0382 TRANSPID DTD0382 DTD0382 GENENAME SLC4A11 DTD0382 PROTNAME Sodium bicarbonate transporter-like protein 11 DTD0382 GENEDBID 83959 DTD0382 UNIPROID Q8NBS3 DTD0383 TRANSPID DTD0383 DTD0383 GENENAME SLC4A2 DTD0383 PROTNAME Anion exchange protein 2 DTD0383 GENEDBID 6522 DTD0383 UNIPROID P04920 DTD0384 TRANSPID DTD0384 DTD0384 GENENAME SLC4A3 DTD0384 PROTNAME Anion exchange protein 3 DTD0384 GENEDBID 6508 DTD0384 UNIPROID P48751 DTD0385 TRANSPID DTD0385 DTD0385 GENENAME SLC4A4 DTD0385 PROTNAME Electrogenic sodium bicarbonate cotransporter 1 DTD0385 GENEDBID 8671 DTD0385 UNIPROID Q9Y6R1 DTD0386 TRANSPID DTD0386 DTD0386 GENENAME SLC4A5 DTD0386 PROTNAME Electrogenic sodium bicarbonate cotransporter 4 DTD0386 GENEDBID 57835 DTD0386 UNIPROID Q9BY07 DTD0387 TRANSPID DTD0387 DTD0387 GENENAME SLC4A7 DTD0387 PROTNAME Sodium bicarbonate cotransporter 3 DTD0387 GENEDBID 9497 DTD0387 UNIPROID Q9Y6M7 DTD0388 TRANSPID DTD0388 DTD0388 GENENAME SLC4A8 DTD0388 PROTNAME Electroneutral sodium bicarbonate exchanger 1 DTD0388 GENEDBID 9498 DTD0388 UNIPROID Q2Y0W8 DTD0389 TRANSPID DTD0389 DTD0389 GENENAME SLC4A9 DTD0389 PROTNAME Anion exchange protein 4 DTD0389 GENEDBID 83697 DTD0389 UNIPROID Q96Q91 DTD0390 TRANSPID DTD0390 DTD0390 GENENAME SLC50A1 DTD0390 PROTNAME Sugar transporter SWEET1 DTD0390 GENEDBID 55974 DTD0390 UNIPROID Q9BRV3 DTD0391 TRANSPID DTD0391 DTD0391 GENENAME SLC51A DTD0391 PROTNAME Organic solute transporter subunit alpha DTD0391 GENEDBID 200931 DTD0391 UNIPROID Q86UW1 DTD0392 TRANSPID DTD0392 DTD0392 GENENAME SLC51B DTD0392 PROTNAME Organic solute transporter subunit beta DTD0392 GENEDBID 123264 DTD0392 UNIPROID Q86UW2 DTD0393 TRANSPID DTD0393 DTD0393 GENENAME SLC52A1 DTD0393 PROTNAME Riboflavin transporter 1 DTD0393 GENEDBID 55065 DTD0393 UNIPROID Q9NWF4 DTD0394 TRANSPID DTD0394 DTD0394 GENENAME SLC52A2 DTD0394 PROTNAME Riboflavin transporter 3 DTD0394 GENEDBID 79581 DTD0394 UNIPROID Q9HAB3 DTD0395 TRANSPID DTD0395 DTD0395 GENENAME SLC52A3 DTD0395 PROTNAME Riboflavin transporter 2 DTD0395 GENEDBID 113278 DTD0395 UNIPROID Q9NQ40 DTD0400 TRANSPID DTD0400 DTD0400 GENENAME SLC55A1 DTD0400 PROTNAME Mitochondrial proton/calcium exchanger protein DTD0400 GENEDBID 3954 DTD0400 UNIPROID O95202 DTD0403 TRANSPID DTD0403 DTD0403 GENENAME SLC56A1 DTD0403 PROTNAME Sideroflexin-1 DTD0403 GENEDBID 94081 DTD0403 UNIPROID Q9H9B4 DTD0406 TRANSPID DTD0406 DTD0406 GENENAME SLC56A4 DTD0406 PROTNAME Sideroflexin-4 DTD0406 GENEDBID 119559 DTD0406 UNIPROID Q6P4A7 DTD0408 TRANSPID DTD0408 DTD0408 GENENAME SLC57A1 DTD0408 PROTNAME Magnesium transporter NIPA1 DTD0408 GENEDBID 123606 DTD0408 UNIPROID Q7RTP0 DTD0409 TRANSPID DTD0409 DTD0409 GENENAME SLC57A2 DTD0409 PROTNAME Magnesium transporter NIPA2 DTD0409 GENEDBID 81614 DTD0409 UNIPROID Q8N8Q9 DTD0412 TRANSPID DTD0412 DTD0412 GENENAME SLC57A5 DTD0412 PROTNAME NIPA-like protein 3 DTD0412 GENEDBID 57185 DTD0412 UNIPROID Q6P499 DTD0414 TRANSPID DTD0414 DTD0414 GENENAME SLC58A1 DTD0414 PROTNAME Magnesium transporter protein 1 DTD0414 GENEDBID 84061 DTD0414 UNIPROID Q9H0U3 DTD0415 TRANSPID DTD0415 DTD0415 GENENAME SLC58A2 DTD0415 PROTNAME Tumor suppressor candidate 3 DTD0415 GENEDBID 7991 DTD0415 UNIPROID Q13454 DTD0416 TRANSPID DTD0416 DTD0416 GENENAME SLC59A1 DTD0416 PROTNAME Major facilitator superfamily domain-containing protein 2A DTD0416 GENEDBID 26227 DTD0416 UNIPROID Q8NA29 DTD0418 TRANSPID DTD0418 DTD0418 GENENAME SLC5A1 DTD0418 PROTNAME Sodium/glucose cotransporter 1 DTD0418 GENEDBID 6523 DTD0418 UNIPROID P13866 DTD0419 TRANSPID DTD0419 DTD0419 GENENAME SLC5A10 DTD0419 PROTNAME Sodium/glucose cotransporter 5 DTD0419 GENEDBID 125206 DTD0419 UNIPROID A0PJK1 DTD0420 TRANSPID DTD0420 DTD0420 GENENAME SLC5A11 DTD0420 PROTNAME Sodium/myo-inositol cotransporter 2 DTD0420 GENEDBID 115584 DTD0420 UNIPROID Q8WWX8 DTD0421 TRANSPID DTD0421 DTD0421 GENENAME SLC5A12 DTD0421 PROTNAME Sodium-coupled monocarboxylate transporter 2 DTD0421 GENEDBID 159963 DTD0421 UNIPROID Q1EHB4 DTD0422 TRANSPID DTD0422 DTD0422 GENENAME SLC5A2 DTD0422 PROTNAME Sodium/glucose cotransporter 2 DTD0422 GENEDBID 6524 DTD0422 UNIPROID P31639 DTD0423 TRANSPID DTD0423 DTD0423 GENENAME SLC5A3 DTD0423 PROTNAME Sodium/myo-inositol cotransporter DTD0423 GENEDBID 6526 DTD0423 UNIPROID P53794 DTD0424 TRANSPID DTD0424 DTD0424 GENENAME SLC5A4 DTD0424 PROTNAME Sodium/glucose cotransporter 3 DTD0424 GENEDBID 6527 DTD0424 UNIPROID Q9NY91 DTD0425 TRANSPID DTD0425 DTD0425 GENENAME SLC5A5 DTD0425 PROTNAME Sodium/iodide cotransporter DTD0425 GENEDBID 6528 DTD0425 UNIPROID Q92911 DTD0426 TRANSPID DTD0426 DTD0426 GENENAME SLC5A6 DTD0426 PROTNAME Sodium-dependent multivitamin transporter DTD0426 GENEDBID 8884 DTD0426 UNIPROID Q9Y289 DTD0427 TRANSPID DTD0427 DTD0427 GENENAME SLC5A7 DTD0427 PROTNAME High affinity choline transporter 1 DTD0427 GENEDBID 60482 DTD0427 UNIPROID Q9GZV3 DTD0428 TRANSPID DTD0428 DTD0428 GENENAME SLC5A8 DTD0428 PROTNAME Sodium-coupled monocarboxylate transporter 1 DTD0428 GENEDBID 160728 DTD0428 UNIPROID Q8N695 DTD0429 TRANSPID DTD0429 DTD0429 GENENAME SLC5A9 DTD0429 PROTNAME Sodium/glucose cotransporter 4 DTD0429 GENEDBID 200010 DTD0429 UNIPROID Q2M3M2 DTD0433 TRANSPID DTD0433 DTD0433 GENENAME SLC62A1 DTD0433 PROTNAME Progressive ankylosis protein homolog DTD0433 GENEDBID 56172 DTD0433 UNIPROID Q9HCJ1 DTD0435 TRANSPID DTD0435 DTD0435 GENENAME SLC63A2 DTD0435 PROTNAME Protein spinster homolog 2 DTD0435 GENEDBID 124976 DTD0435 UNIPROID Q8IVW8 DTD0439 TRANSPID DTD0439 DTD0439 GENENAME SLC65A2 DTD0439 PROTNAME Niemann-Pick C1-like protein 1 DTD0439 GENEDBID 29881 DTD0439 UNIPROID Q9UHC9 DTD0439 GENEPOLY rs2072183 SITEOFGP chr7:44539581 (GRCh38.p12) DTD0439 GENEPOLY rs2072183 GPD_TYPE SNP DTD0439 GENEPOLY rs2072183 ALLDBSNP G>A / G>C DTD0439 GENEPOLY rs2072183 MAFDBSNP C=0.2201/816 DTD0439 GENEPOLY rs2072183 Allele C Biliary cholesterol Gallstone Correlated with the increased gallstone risk in patients (compare with allele G) ac DTD0440 TRANSPID DTD0440 DTD0440 GENENAME SLC6A1 DTD0440 PROTNAME Sodium- and chloride-dependent GABA transporter 1 DTD0440 GENEDBID 6529 DTD0440 UNIPROID P30531 DTD0440 GENEPOLY SLC6A1 promoter insertion SITEOFGP N.A. DTD0440 GENEPOLY SLC6A1 promoter insertion GPD_TYPE Insertion DTD0440 GENEPOLY SLC6A1 promoter insertion ALLDBSNP N.A. DTD0440 GENEPOLY SLC6A1 promoter insertion MAFDBSNP N.A. DTD0440 GENEPOLY SLC6A1 promoter insertion Insertion N.A. Alcoholism Correlated with the risk of predicting or preventing alcoholism ad DTD0443 TRANSPID DTD0443 DTD0443 GENENAME SLC6A11 DTD0443 PROTNAME Sodium- and chloride-dependent GABA transporter 3 DTD0443 GENEDBID 6538 DTD0443 UNIPROID P48066 DTD0444 TRANSPID DTD0444 DTD0444 GENENAME SLC6A12 DTD0444 PROTNAME Na(+)/Cl(-) betaine/GABA transporter DTD0444 GENEDBID 6539 DTD0444 UNIPROID P48065 DTD0444 GENEPOLY rs557881 SITEOFGP chr12:209959 (GRCh38.p12) DTD0444 GENEPOLY rs557881 GPD_TYPE SNP DTD0444 GENEPOLY rs557881 ALLDBSNP A>G DTD0444 GENEPOLY rs557881 MAFDBSNP A=0.4750/2379 DTD0444 GENEPOLY rs557881 Allele G Aspirin Asthma Correlated with the increased likelihood of asthma in patients (compare with Allele A) aa DTD0445 TRANSPID DTD0445 DTD0445 GENENAME SLC6A13 DTD0445 PROTNAME Sodium- and chloride-dependent GABA transporter 2 DTD0445 GENEDBID 6540 DTD0445 UNIPROID Q9NSD5 DTD0446 TRANSPID DTD0446 DTD0446 GENENAME SLC6A14 DTD0446 PROTNAME Amino acid transporter ATB0+ DTD0446 GENEDBID 11254 DTD0446 UNIPROID Q9UN76 DTD0447 TRANSPID DTD0447 DTD0447 GENENAME SLC6A15 DTD0447 PROTNAME Sodium-dependent neutral amino acid transporter B(0)AT2 DTD0447 GENEDBID 55117 DTD0447 UNIPROID Q9H2J7 DTD0447 GENEPOLY rs1545843 SITEOFGP chr12:84170289 (GRCh38.p12) DTD0447 GENEPOLY rs1545843 GPD_TYPE SNP DTD0447 GENEPOLY rs1545843 ALLDBSNP G>A DTD0447 GENEPOLY rs1545843 MAFDBSNP A=0.3629/1626 DTD0447 GENEPOLY rs1545843 Genotype AA Cornu ammonis Parkinson's disease Correlated with the depression status in patients (compare with GG + AG) ac DTD0449 TRANSPID DTD0449 DTD0449 GENENAME SLC6A17 DTD0449 PROTNAME Sodium-dependent neurotransmitter transporter DTD0449 GENEDBID 388662 DTD0449 UNIPROID Q9H1V8 DTD0450 TRANSPID DTD0450 DTD0450 GENENAME SLC6A18 DTD0450 PROTNAME Sodium-dependent neutral amino acid transporter B(0)AT3 DTD0450 GENEDBID 348932 DTD0450 UNIPROID Q96N87 DTD0451 TRANSPID DTD0451 DTD0451 GENENAME SLC6A19 DTD0451 PROTNAME Sodium-dependent neutral amino acid transporter B(0)AT1 DTD0451 GENEDBID 340024 DTD0451 UNIPROID Q695T7 DTD0452 TRANSPID DTD0452 DTD0452 GENENAME SLC6A2 DTD0452 PROTNAME Sodium-dependent noradrenaline transporter DTD0452 GENEDBID 6530 DTD0452 UNIPROID P23975 DTD0452 GENEPOLY rs12708954 SITEOFGP chr16:55697687 (GRCh38.p12) DTD0452 GENEPOLY rs12708954 GPD_TYPE SNP DTD0452 GENEPOLY rs12708954 ALLDBSNP C>A DTD0452 GENEPOLY rs12708954 MAFDBSNP A=0.1853/928 DTD0452 GENEPOLY rs12708954 Allele A Atomoxetine Attention Deficit Disorder With Hyperactivity Correlated with the increased drug response in patients (compare with allele C) aa DTD0452 GENEPOLY rs1861647 SITEOFGP chr16:55694494 (GRCh38.p12) DTD0452 GENEPOLY rs1861647 GPD_TYPE SNP DTD0452 GENEPOLY rs1861647 ALLDBSNP G>A / G>C DTD0452 GENEPOLY rs1861647 MAFDBSNP A=0.2384/1194 DTD0452 GENEPOLY rs1861647 Genotype GG 3,4-Methylenedioxymethamphetamine Posttraumatic Stress Disorder Correlated with the increased drug response (compare with genotypes AA + AG) aa DTD0452 GENEPOLY rs2242446 SITEOFGP chr16:55656513 (GRCh38.p12) DTD0452 GENEPOLY rs2242446 GPD_TYPE SNP DTD0452 GENEPOLY rs2242446 ALLDBSNP C>A / C>T DTD0452 GENEPOLY rs2242446 MAFDBSNP C=0.2470/1237 DTD0452 GENEPOLY rs2242446 Genotype CC Venlafaxine Major Depressive Disorder Correlated with the increased drug response in patients (compare with Genotypes CT + TT) aa DTD0452 GENEPOLY rs2242446 Genotype TT 3,4-Methylenedioxymethamphetamine Posttraumatic Stress Disorder Correlated with the decreased drug response (compare with genotypes CC + CT) aa DTD0452 GENEPOLY rs36029 SITEOFGP chr16:55662844 (GRCh38.p12) DTD0452 GENEPOLY rs36029 GPD_TYPE SNP DTD0452 GENEPOLY rs36029 ALLDBSNP A>G DTD0452 GENEPOLY rs36029 MAFDBSNP G=0.3978/1992 DTD0452 GENEPOLY rs36029 Genotype AA 3,4-Methylenedioxymethamphetamine Posttraumatic Stress Disorder Correlated with the increased drug response in patients (compare with genotypes AG + GG) aa DTD0452 GENEPOLY rs3785143 SITEOFGP chr16:55661194 (GRCh38.p12) DTD0452 GENEPOLY rs3785143 GPD_TYPE SNP DTD0452 GENEPOLY rs3785143 ALLDBSNP C>T DTD0452 GENEPOLY rs3785143 MAFDBSNP T=0.1048/525 DTD0452 GENEPOLY rs3785143 Allele T Atomoxetine Attention Deficit Disorder With Hyperactivity Correlated with the decreased drug response in patients (compare with allele C) aa DTD0452 GENEPOLY rs5569 SITEOFGP chr16:55697923 (GRCh38.p12) DTD0452 GENEPOLY rs5569 GPD_TYPE SNP DTD0452 GENEPOLY rs5569 ALLDBSNP G>A / G>C DTD0452 GENEPOLY rs5569 MAFDBSNP A=0.2334/1169 DTD0452 GENEPOLY rs5569 Allele A Methylphenidate Attention Deficit Disorder With Hyperactivity Irrelevant to the drug response in patients (compare with Allele G) aa DTD0452 GENEPOLY rs5569 Genotype GG Methylphenidate Attention Deficit Disorder With Hyperactivity Correlated with the increased drug response in patients (compare with genotypes AA + AG) aa DTD0453 TRANSPID DTD0453 DTD0453 GENENAME SLC6A20 DTD0453 PROTNAME Sodium/imino-acid transporter 1 DTD0453 GENEDBID 54716 DTD0453 UNIPROID Q9NP91 DTD0453 GENEPOLY rs13062383 SITEOFGP chr3:45775122 (GRCh38.p12) DTD0453 GENEPOLY rs13062383 GPD_TYPE SNP DTD0453 GENEPOLY rs13062383 ALLDBSNP C>T DTD0453 GENEPOLY rs13062383 MAFDBSNP T=0.0752/2325 DTD0453 GENEPOLY rs13062383 Allele A N.A. Type 2 diabetes Correlated with the increased risk for Type 2 diabetes (compare with allele G) ad DTD0455 TRANSPID DTD0455 DTD0455 GENENAME SLC6A3 DTD0455 PROTNAME Sodium-dependent dopamine transporter DTD0455 GENEDBID 6531 DTD0455 UNIPROID Q01959 DTD0455 GENEPOLY rs2975226 SITEOFGP chr5:1445501 (GRCh38.p12) DTD0455 GENEPOLY rs2975226 GPD_TYPE SNP DTD0455 GENEPOLY rs2975226 ALLDBSNP A>T DTD0455 GENEPOLY rs2975226 MAFDBSNP T=0.3710/1858 DTD0455 GENEPOLY rs2975226 Allele A Clozapine Schizophrenia Correlated with the increased drug response in patients (compare with Allele T) aa DTD0455 GENEPOLY rs3836790 SITEOFGP chr5:1411740-1411741 (GRCh38.p12) DTD0455 GENEPOLY rs3836790 GPD_TYPE InsertionI DTD0455 GENEPOLY rs3836790 ALLDBSNP insACAT(AC)3TCAG(AC)3ATACCATGCA DTD0455 GENEPOLY rs3836790 MAFDBSNP N.A. DTD0455 GENEPOLY rs3836790 Genotype CACATACCATGCAACATACACACTCAGACA/CACATACCATGCAACATACACACTCAGACA Levodopa Parkinson Disease Correlated with the increased drug response in patients (compare with genotypes CACAtACCAtGCAACAtACACACtCAGACA/del + del/del) aa DTD0455 GENEPOLY rs3836790 Genotype CACATACCATGCAACATACACACTCAGACA/CACATACCATGCAACATACACACTCAGACA Methylphenidate Parkinson Disease Correlated with the increased drug response in patients (compare with genotypes CACAtACCAtGCAACAtACACACtCAGACA/del + del/del) aa DTD0455 GENEPOLY rs6350 SITEOFGP chr5:1443084 (GRCh38.p12) DTD0455 GENEPOLY rs6350 GPD_TYPE SNP DTD0455 GENEPOLY rs6350 ALLDBSNP G>A / G>C DTD0455 GENEPOLY rs6350 MAFDBSNP A=0.0455/228 DTD0455 GENEPOLY rs6350 Genotype AG Ethanol Intractable Chronic Pain; Cystitis Correlated with the increased alcoholism risk in patients (compare with genotype GG) aa DTD0456 TRANSPID DTD0456 DTD0456 GENENAME SLC6A4 DTD0456 PROTNAME Sodium-dependent serotonin transporter DTD0456 GENEDBID 6532 DTD0456 UNIPROID P31645 DTD0456 GENEPOLY rs25531 SITEOFGP chr17:30237328 (GRCh38.p12) DTD0456 GENEPOLY rs25531 GPD_TYPE SNP DTD0456 GENEPOLY rs25531 ALLDBSNP T>C DTD0456 GENEPOLY rs25531 MAFDBSNP C=0.1376/689 DTD0456 GENEPOLY rs25531 Allele C Citalopram Dementia Correlated with the increased likelihood of side effects in patients (compare with Allele T) aa DTD0456 GENEPOLY rs25531 Allele C Citalopram Depression Irrelevant to the drug response in patients (compare with Allele T) aa DTD0456 GENEPOLY rs25531 Allele C Citalopram Major Depressive Disorder Irrelevant to the increased likelihood of remission in patients (compare with Allele T) aa DTD0456 GENEPOLY rs25531 Allele C Fluoxetine Major Depressive Disorder Irrelevant to the drug response in patients (compare with Allele T) aa DTD0456 GENEPOLY rs25531 Genotypes CC + CT Fluoxetine Major Depressive Disorder Correlated with the increased reduced drug response risk in patients (compare with Genotype TT) aa DTD0456 GENEPOLY rs57098334 SITEOFGP chr17:30221569-30221577 (GRCh38.p12) DTD0456 GENEPOLY rs57098334 GPD_TYPE Indel Insertion and Deletion DTD0456 GENEPOLY rs57098334 ALLDBSNP ins(AGCCCACCC)8AGCCCACC / ins(AGCCCACCC)9AGCCCACC / ins(AGCCCACCC)11AGCCCACC DTD0456 GENEPOLY rs57098334 MAFDBSNP N.A. DTD0456 GENEPOLY rs57098334 (AGCCCACCC)12 Sertraline Major Depressive Disorder Irrelevant to the drug response in patients (compare with allele (AGCCCACCC)9) aa DTD0457 TRANSPID DTD0457 DTD0457 GENENAME SLC6A5 DTD0457 PROTNAME Sodium- and chloride-dependent glycine transporter 2 DTD0457 GENEDBID 9152 DTD0457 UNIPROID Q9Y345 DTD0457 GENEPOLY rs2298826 SITEOFGP chr11:20638211 (GRCh38.p12) DTD0457 GENEPOLY rs2298826 GPD_TYPE SNP DTD0457 GENEPOLY rs2298826 ALLDBSNP G>A DTD0457 GENEPOLY rs2298826 MAFDBSNP A=0.3522/1764 DTD0457 GENEPOLY rs2298826 Genotype AA Haloperidol Schizophrenia Correlated with the motor side effects in patients (compare with genotypes AG + GG) aa DTD0458 TRANSPID DTD0458 DTD0458 GENENAME SLC6A6 DTD0458 PROTNAME Sodium- and chloride-dependent taurine transporter DTD0458 GENEDBID 6533 DTD0458 UNIPROID P31641 DTD0459 TRANSPID DTD0459 DTD0459 GENENAME SLC6A7 DTD0459 PROTNAME Sodium-dependent proline transporter DTD0459 GENEDBID 6534 DTD0459 UNIPROID Q99884 DTD0460 TRANSPID DTD0460 DTD0460 GENENAME SLC6A8 DTD0460 PROTNAME Creatine transporter 1 DTD0460 GENEDBID 6535 DTD0460 UNIPROID P48029 DTD0461 TRANSPID DTD0461 DTD0461 GENENAME SLC6A9 DTD0461 PROTNAME Sodium- and chloride-dependent glycine transporter 1 DTD0461 GENEDBID 6536 DTD0461 UNIPROID P48067 DTD0462 TRANSPID DTD0462 DTD0462 GENENAME SLC7A1 DTD0462 PROTNAME High affinity cationic amino acid transporter 1 DTD0462 GENEDBID 6541 DTD0462 UNIPROID P30825 DTD0463 TRANSPID DTD0463 DTD0463 GENENAME SLC7A10 DTD0463 PROTNAME Asc-type amino acid transporter 1 DTD0463 GENEDBID 56301 DTD0463 UNIPROID Q9NS82 DTD0464 TRANSPID DTD0464 DTD0464 GENENAME SLC7A11 DTD0464 PROTNAME Cystine/glutamate transporter DTD0464 GENEDBID 23657 DTD0464 UNIPROID Q9UPY5 DTD0465 TRANSPID DTD0465 DTD0465 GENENAME SLC7A13 DTD0465 PROTNAME Sodium-independent aspartate/glutamate transporter 1 DTD0465 GENEDBID 157724 DTD0465 UNIPROID Q8TCU3 DTD0468 TRANSPID DTD0468 DTD0468 GENENAME SLC7A2 DTD0468 PROTNAME Cationic amino acid transporter 2 DTD0468 GENEDBID 6542 DTD0468 UNIPROID P52569 DTD0469 TRANSPID DTD0469 DTD0469 GENENAME SLC7A3 DTD0469 PROTNAME Cationic amino acid transporter 3 DTD0469 GENEDBID 84889 DTD0469 UNIPROID Q8WY07 DTD0471 TRANSPID DTD0471 DTD0471 GENENAME SLC7A5 DTD0471 PROTNAME L-type amino acid transporter 1 DTD0471 GENEDBID 8140 DTD0471 UNIPROID Q01650 DTD0471 GENEPOLY rs4240803 SITEOFGP chr16:87855597 (GRCh38.p12) DTD0471 GENEPOLY rs4240803 GPD_TYPE SNP DTD0471 GENEPOLY rs4240803 ALLDBSNP G>A / G>C / G>T DTD0471 GENEPOLY rs4240803 MAFDBSNP A=0.4615/2311 DTD0471 GENEPOLY rs4240803 Genotypes AA + AG Melphalan Multiple Myeloma Correlated with the decreased gastrointestinal toxicity risk in patients (compare with genotype GG) aa DTD0473 TRANSPID DTD0473 DTD0473 GENENAME SLC7A6 DTD0473 PROTNAME Y+L amino acid transporter 2 DTD0473 GENEDBID 9057 DTD0473 UNIPROID Q92536 DTD0474 TRANSPID DTD0474 DTD0474 GENENAME SLC7A7 DTD0474 PROTNAME Y+L amino acid transporter 1 DTD0474 GENEDBID 9056 DTD0474 UNIPROID Q9UM01 DTD0475 TRANSPID DTD0475 DTD0475 GENENAME SLC7A8 DTD0475 PROTNAME L-type amino acid transporter 2 DTD0475 GENEDBID 23428 DTD0475 UNIPROID Q9UHI5 DTD0476 TRANSPID DTD0476 DTD0476 GENENAME SLC7A9 DTD0476 PROTNAME Glycoprotein-associated amino acid transporter b0, +AT1 DTD0476 GENEDBID 11136 DTD0476 UNIPROID P82251 DTD0476 GENEPOLY rs11796 SITEOFGP chr6:31533435 (GRCh38.p12) DTD0476 GENEPOLY rs11796 GPD_TYPE SNP DTD0476 GENEPOLY rs11796 ALLDBSNP A>T DTD0476 GENEPOLY rs11796 MAFDBSNP T=0.3290/1474 DTD0476 GENEPOLY rs11796 Allele T N.A. Periodontitis Correlated with the periodontitis susceptibility (comare with wide type) ad DTD0476 GENEPOLY rs2239527 SITEOFGP chr6:31542002 (GRCh38.p12) DTD0476 GENEPOLY rs2239527 GPD_TYPE SNP DTD0476 GENEPOLY rs2239527 ALLDBSNP C>G DTD0476 GENEPOLY rs2239527 MAFDBSNP G=0.2462/2940 DTD0476 GENEPOLY rs2239527 Allele G N.A. Periodontitis Correlated with the periodontitis susceptibility (comare with wide type) ad DTD0476 GENEPOLY rs3130059 SITEOFGP chr6:31541507 (GRCh38.p12) DTD0476 GENEPOLY rs3130059 GPD_TYPE SNP DTD0476 GENEPOLY rs3130059 ALLDBSNP G>C DTD0476 GENEPOLY rs3130059 MAFDBSNP C=0.3283/1471 DTD0476 GENEPOLY rs3130059 Allele C N.A. Periodontitis Correlated with the periodontitis susceptibility (comare with wide type) ad DTD0477 TRANSPID DTD0477 DTD0477 GENENAME SLC8A1 DTD0477 PROTNAME Sodium/calcium exchanger 1 DTD0477 GENEDBID 6546 DTD0477 UNIPROID P32418 DTD0477 GENEPOLY rs13017968 SITEOFGP chr2:40347532 (GRCh38.p12) DTD0477 GENEPOLY rs13017968 GPD_TYPE SNP DTD0477 GENEPOLY rs13017968 ALLDBSNP G>T DTD0477 GENEPOLY rs13017968 MAFDBSNP T=0.2446/30717 DTD0477 GENEPOLY rs13017968 Allele A Calcium Kawasaki disease Correlated with the higher rates of coronary artery abnormalities (compare with C) ac DTD0478 TRANSPID DTD0478 DTD0478 GENENAME SLC8A2 DTD0478 PROTNAME Sodium/calcium exchanger 2 DTD0478 GENEDBID 6543 DTD0478 UNIPROID Q9UPR5 DTD0479 TRANSPID DTD0479 DTD0479 GENENAME SLC8A3 DTD0479 PROTNAME Sodium/calcium exchanger 3 DTD0479 GENEDBID 6547 DTD0479 UNIPROID P57103 DTD0480 TRANSPID DTD0480 DTD0480 GENENAME SLC8B1 DTD0480 PROTNAME Mitochondrial sodium/calcium exchanger protein DTD0480 GENEDBID 80024 DTD0480 UNIPROID Q6J4K2 DTD0481 TRANSPID DTD0481 DTD0481 GENENAME SLC9A1 DTD0481 PROTNAME Sodium/hydrogen exchanger 1 DTD0481 GENEDBID 6548 DTD0481 UNIPROID P19634 DTD0482 TRANSPID DTD0482 DTD0482 GENENAME SLC9A2 DTD0482 PROTNAME Sodium/hydrogen exchanger 2 DTD0482 GENEDBID 6549 DTD0482 UNIPROID Q9UBY0 DTD0483 TRANSPID DTD0483 DTD0483 GENENAME SLC9A3 DTD0483 PROTNAME Sodium/hydrogen exchanger 3 DTD0483 GENEDBID 6550 DTD0483 UNIPROID P48764 DTD0483 GENEPOLY rs2247114 SITEOFGP chr5:474989 (GRCh38.p12) DTD0483 GENEPOLY rs2247114 GPD_TYPE SNP DTD0483 GENEPOLY rs2247114 ALLDBSNP A>G / A>T DTD0483 GENEPOLY rs2247114 MAFDBSNP A=0.0915/410 DTD0483 GENEPOLY rs2247114 Allele G Electroneutral sodium Diarrheal diseases Irrelevant to the compromised function or abnormal regulation (compare with allele A) ac DTD0488 TRANSPID DTD0488 DTD0488 GENENAME SLC9A4 DTD0488 PROTNAME Sodium/hydrogen exchanger 4 DTD0488 GENEDBID 389015 DTD0488 UNIPROID Q6AI14 DTD0488 GENEPOLY c.1919G>A SITEOFGP N.A. DTD0488 GENEPOLY c.1919G>A GPD_TYPE N.A. DTD0488 GENEPOLY c.1919G>A ALLDBSNP N.A. DTD0488 GENEPOLY c.1919G>A MAFDBSNP N.A. DTD0488 GENEPOLY c.1919G>A Allele G N.A. Celiac disease Correlated with the risk for celiac disease risk (compare with allele A) ad DTD0489 TRANSPID DTD0489 DTD0489 GENENAME SLC9A5 DTD0489 PROTNAME Sodium/hydrogen exchanger 5 DTD0489 GENEDBID 6553 DTD0489 UNIPROID Q14940 DTD0490 TRANSPID DTD0490 DTD0490 GENENAME SLC9A6 DTD0490 PROTNAME Sodium/hydrogen exchanger 6 DTD0490 GENEDBID 10479 DTD0490 UNIPROID Q92581 DTD0491 TRANSPID DTD0491 DTD0491 GENENAME SLC9A7 DTD0491 PROTNAME Sodium/hydrogen exchanger 7 DTD0491 GENEDBID 84679 DTD0491 UNIPROID Q96T83 DTD0493 TRANSPID DTD0493 DTD0493 GENENAME SLC9A8 DTD0493 PROTNAME Sodium/hydrogen exchanger 8 DTD0493 GENEDBID 23315 DTD0493 UNIPROID Q9Y2E8 DTD0494 TRANSPID DTD0494 DTD0494 GENENAME SLC9A9 DTD0494 PROTNAME Sodium/hydrogen exchanger 9 DTD0494 GENEDBID 285195 DTD0494 UNIPROID Q8IVB4 DTD0494 GENEPOLY rs9828519 SITEOFGP chr3:143707136 (GRCh38.p12) DTD0494 GENEPOLY rs9828519 GPD_TYPE SNP DTD0494 GENEPOLY rs9828519 ALLDBSNP G>A / G>C / G>T DTD0494 GENEPOLY rs9828519 MAFDBSNP G=0.3150/1168 DTD0494 GENEPOLY rs9828519 Allele G Interferon-beta Multiple sclerosis Correlated with the significantly regulated transporter expression only in occipital cortex, intralobular white matter, and substantia nigra (compare with wide type) ac DTD0495 TRANSPID DTD0495 DTD0495 GENENAME SLC9B1 DTD0495 PROTNAME Sodium/hydrogen exchanger 9B1 DTD0495 GENEDBID 150159 DTD0495 UNIPROID Q4ZJI4 DTD0496 TRANSPID DTD0496 DTD0496 GENENAME SLC9B2 DTD0496 PROTNAME Sodium/hydrogen exchanger 9B2 DTD0496 GENEDBID 133308 DTD0496 UNIPROID Q86UD5 DTD0497 TRANSPID DTD0497 DTD0497 GENENAME SLC9C1 DTD0497 PROTNAME Sodium/hydrogen exchanger 10 DTD0497 GENEDBID 285335 DTD0497 UNIPROID Q4G0N8 DTD0498 TRANSPID DTD0498 DTD0498 GENENAME SLC9C2 DTD0498 PROTNAME Sodium/hydrogen exchanger 11 DTD0498 GENEDBID 284525 DTD0498 UNIPROID Q5TAH2 DTD0499 TRANSPID DTD0499 DTD0499 GENENAME SLCO1C1 DTD0499 PROTNAME Organic anion transporting polypeptide 1C1 DTD0499 GENEDBID 53919 DTD0499 UNIPROID Q9NYB5 DTD0499 GENEPOLY rs3794271 SITEOFGP chr12:20707159 (GRCh38.p12) DTD0499 GENEPOLY rs3794271 GPD_TYPE SNP DTD0499 GENEPOLY rs3794271 ALLDBSNP G>A DTD0499 GENEPOLY rs3794271 MAFDBSNP G=0.4243/2125 DTD0499 GENEPOLY rs3794271 Allele G Infliximab Rheumatoid Arthritis Correlated with the decreased drug response in patients (compare with Allele A) aa DTD0499 GENEPOLY rs3794271 Genotypes AG + GG Infliximab Psoriatic Arthritis Correlated with the decreased drug response in patients (compare with genotype AA) aa DTD0499 GENEPOLY rs3794271 Genotypes AG + GG Infliximab Psoriasis Correlated with the increased drug response in patients (compare with genotype AA) aa DTD0499 GENEPOLY rs3794271 Allele G Adalimumab Rheumatoid Arthritis Irrelevant to the decreased drug response in patients (compare with Allele A) aa DTD0499 GENEPOLY rs3794271 Allele G Etanercept Psoriatic Arthritis Correlated with the decreased drug response in patients (compare with Allele A) aa DTD0499 GENEPOLY rs3794271 Genotypes AG + GG Etanercept Psoriatic Arthritis Correlated with the decreased drug response in patients (compare with genotype AA) aa DTD0499 GENEPOLY rs3794271 Genotypes AG + GG Etanercept Psoriasis Correlated with the increased drug response to tumor necrosis factor alpha (tnF-alpha) inhibitors in patients (compare with genotype AA) aa DTD0499 GENEPOLY rs3794271 Allele G Tumor necrosis factor alpha (Tnf-Alpha) inhibitors Rheumatoid Arthritis Correlated with the decreased drug response in patients (compare with Allele A) ac DTD0499 GENEPOLY rs3794271 Genotypes AG + GG Tumor necrosis factor alpha (Tnf-Alpha) inhibitors Psoriatic Arthritis Correlated with the decreased drug response in patients (compare with genotype AA) ac DTD0499 GENEPOLY rs3794271 Genotypes AG + GG Tumor necrosis factor alpha (Tnf-Alpha) inhibitors Psoriasis Correlated with the increased drug response in patients (compare with genotype AA) ac DTD0500 TRANSPID DTD0500 DTD0500 GENENAME SLCO2A1 DTD0500 PROTNAME Organic anion transporting polypeptide 2A1 DTD0500 GENEDBID 6578 DTD0500 UNIPROID Q92959 DTD0500 GENEPOLY rs34550074 SITEOFGP chr3:133947365 (GRCh38.p12) DTD0500 GENEPOLY rs34550074 GPD_TYPE SNP DTD0500 GENEPOLY rs34550074 ALLDBSNP C>G / C>T DTD0500 GENEPOLY rs34550074 MAFDBSNP T=0.2837/1421 DTD0500 GENEPOLY rs34550074 Allele T Thiazides Hypertension Correlated with the increased likelihood of hyponatremia in patients (compare with allele C) ac DTD0501 TRANSPID DTD0501 DTD0501 GENENAME SLCO3A1 DTD0501 PROTNAME Organic anion transporting polypeptide 3A1 DTD0501 GENEDBID 28232 DTD0501 UNIPROID Q9UIG8 DTD0502 TRANSPID DTD0502 DTD0502 GENENAME SLCO4A1 DTD0502 PROTNAME Organic anion transporting polypeptide 4A1 DTD0502 GENEDBID 28231 DTD0502 UNIPROID Q96BD0 DTD0503 TRANSPID DTD0503 DTD0503 GENENAME SLCO4C1 DTD0503 PROTNAME Organic anion transporting polypeptide 4C1 DTD0503 GENEDBID 353189 DTD0503 UNIPROID Q6ZQN7 DTD0504 TRANSPID DTD0504 DTD0504 GENENAME SLCO5A1 DTD0504 PROTNAME Organic anion transporting polypeptide 5A1 DTD0504 GENEDBID 81796 DTD0504 UNIPROID Q9H2Y9 DTD0505 TRANSPID DTD0505 DTD0505 GENENAME SLCO6A1 DTD0505 PROTNAME Organic anion-transporting polypeptide 6A1 DTD0505 GENEDBID 133482 DTD0505 UNIPROID Q86UG4 DTD0505 GENEPOLY rs6878284 SITEOFGP chr5:102434022 (GRCh38.p12) DTD0505 GENEPOLY rs6878284 GPD_TYPE SNP DTD0505 GENEPOLY rs6878284 ALLDBSNP C>T DTD0505 GENEPOLY rs6878284 MAFDBSNP C=0.3007/1347 DTD0505 GENEPOLY rs6878284 Allele C N.A. Schizophrenia Irrelevant to the risk of schizophrenia (compare with wide type) ad DTD0505 GENEPOLY rs7734060 SITEOFGP chr5:102444775 (GRCh38.p12) DTD0505 GENEPOLY rs7734060 GPD_TYPE SNP DTD0505 GENEPOLY rs7734060 ALLDBSNP T>G DTD0505 GENEPOLY rs7734060 MAFDBSNP G=0.1767/885 DTD0505 GENEPOLY rs7734060 Allele G N.A. Major depressive disorder Correlated with the risk locus for major depressive disorder in the Han Chinese population (compare with wide type) ad DTD0510 TRANSPID DTD0510 DTD0510 GENENAME KCNH2 DTD0510 PROTNAME Voltage-gated potassium channel Kv11.1 DTD0510 GENEDBID 3757 DTD0510 UNIPROID Q12809 DTD0510 GENEPOLY rs1137617 SITEOFGP chr7:150951110 (GRCh38.p12) DTD0510 GENEPOLY rs1137617 GPD_TYPE SNP DTD0510 GENEPOLY rs1137617 ALLDBSNP A>C / A>G / A>T DTD0510 GENEPOLY rs1137617 MAFDBSNP A=0.2278/1141 DTD0510 GENEPOLY rs1137617 Genotype GG Candesartan Essential hypertension Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0510 GENEPOLY rs1137617 Genotype GG Irbesartan Essential hypertension Irrelevant to the drug response in patients (compare with genotypes AA + AG) aa DTD0510 GENEPOLY rs1137617 Genotype GG Imidapril Essential hypertension Irrelevant to the drug response in patients (compare with genotypes AA + AG) ac DTD0511 TRANSPID DTD0511 DTD0511 GENENAME KCNJ11 DTD0511 PROTNAME ATP-sensitive inward rectifier potassium channel 11 DTD0511 GENEDBID 3767 DTD0511 UNIPROID Q14654 DTD0511 GENEPOLY rs5215 SITEOFGP chr11:17387083 (GRCh38.p12) DTD0511 GENEPOLY rs5215 GPD_TYPE SNP DTD0511 GENEPOLY rs5215 ALLDBSNP C>T DTD0511 GENEPOLY rs5215 MAFDBSNP C=0.2680/3480 DTD0511 GENEPOLY rs5215 Allele T Sulfonamides Diabetes Mellitus Irrelevant to the drug response in patients (compare with allele C) aa DTD0512 TRANSPID DTD0512 DTD0512 GENENAME KCNMA1 DTD0512 PROTNAME Calcium-activated potassium channel subunit alpha-1 DTD0512 GENEDBID 3778 DTD0512 UNIPROID Q12960 DTD0512 GENEPOLY rs35793 SITEOFGP chr10:77423280 (GRCh38.p12) DTD0512 GENEPOLY rs35793 GPD_TYPE SNP DTD0512 GENEPOLY rs35793 ALLDBSNP C>G DTD0512 GENEPOLY rs35793 MAFDBSNP G=0.0739/285 DTD0512 GENEPOLY rs35793 Allele G Quetiapine Schizophrenia Correlated with the drug response in patients aa DTD0513 TRANSPID DTD0513 DTD0513 GENENAME KCNQ1 DTD0513 PROTNAME Voltage-gated potassium channel Kv7.1 DTD0513 GENEDBID 3784 DTD0513 UNIPROID P51787 DTD0513 GENEPOLY rs2237897 SITEOFGP chr11:2837316 (GRCh38.p12) DTD0513 GENEPOLY rs2237897 GPD_TYPE SNP DTD0513 GENEPOLY rs2237897 ALLDBSNP C>T DTD0513 GENEPOLY rs2237897 MAFDBSNP T=0.0378/140 DTD0513 GENEPOLY rs2237897 Allele T Gliclazide Diabetes Mellitus Irrelevant to the drug response in patients (compare with allele C) aa DTD0514 TRANSPID DTD0514 DTD0514 GENENAME ANXA11 DTD0514 PROTNAME Annexin A11 DTD0514 GENEDBID 311 DTD0514 UNIPROID P50995 DTD0514 GENEPOLY rs1049550 SITEOFGP chr10:80166946 (GRCh38.p12) DTD0514 GENEPOLY rs1049550 GPD_TYPE SNP DTD0514 GENEPOLY rs1049550 ALLDBSNP G>A / G>C DTD0514 GENEPOLY rs1049550 MAFDBSNP A=0.3392/4412 DTD0514 GENEPOLY rs1049550 Genotype AA Bevacizumab Colorectal Neoplasms Correlated with the increased drug response in patients (compare with genotypes AG + GG) ac DTD0515 TRANSPID DTD0515 DTD0515 GENENAME ATP10A DTD0515 PROTNAME Probable phospholipid-transporting ATPase VA DTD0515 GENEDBID 57194 DTD0515 UNIPROID O60312 DTD0515 GENEPOLY rs12595802 SITEOFGP chr15:25806438 (GRCh38.p12) DTD0515 GENEPOLY rs12595802 GPD_TYPE SNP DTD0515 GENEPOLY rs12595802 ALLDBSNP G>A / G>C DTD0515 GENEPOLY rs12595802 MAFDBSNP G=0.4294/1922 DTD0515 GENEPOLY rs12595802 Allele G Duloxetine N.A. Correlated with the decreased response to duloxetine in people with Depressive Disorder, Major (compare with allele A) ab DTD0516 TRANSPID DTD0516 DTD0516 GENENAME ATP2B1 DTD0516 PROTNAME Plasma membrane calcium-transporting ATPase 1 DTD0516 GENEDBID 490 DTD0516 UNIPROID P20020 DTD0516 GENEPOLY rs12817819 SITEOFGP chr12:89645549 (GRCh38.p12) DTD0516 GENEPOLY rs12817819 GPD_TYPE SNP DTD0516 GENEPOLY rs12817819 ALLDBSNP C>T DTD0516 GENEPOLY rs12817819 MAFDBSNP T=0.0731/366 DTD0516 GENEPOLY rs12817819 Genotypes CT + TT Antihypertensives Coronary Artery Disease; Hypertension Correlated with the increased drug resistance in patients (compare with genotype CC) ac DTD0517 TRANSPID DTD0517 DTD0517 GENENAME ATP5E DTD0517 PROTNAME ATP synthase subunit epsilon DTD0517 GENEDBID 514 DTD0517 UNIPROID P56381 DTD0517 GENEPOLY rs1059150 SITEOFGP chr20:59030384 (GRCh38.p12) DTD0517 GENEPOLY rs1059150 GPD_TYPE SNP DTD0517 GENEPOLY rs1059150 ALLDBSNP T>C / T>G DTD0517 GENEPOLY rs1059150 MAFDBSNP C=0.0000/1 DTD0517 GENEPOLY rs1059150 Genotype GG Methotrexate Rheumatoid Arthritis Correlated with the decreased drug response in patients (compare with genotype TT) aa DTD0517 GENEPOLY rs1059150 Genotype GG Infliximab Rheumatoid Arthritis Correlated with the decreased drug response in patients (compare with genotype TT) aa DTD0517 GENEPOLY rs1059150 Genotype GG Adalimumab Rheumatoid Arthritis Correlated with the decreased drug response in patients (compare with genotype TT) aa DTD0517 GENEPOLY rs1059150 Genotype GG Etanercept Rheumatoid Arthritis Correlated with the decreased drug response in patients (compare with genotype TT) aa DTD0517 GENEPOLY rs1059150 Genotype GG Certolizumab pegol Rheumatoid Arthritis Correlated with the decreased drug response in patients (compare with genotype TT) ac DTD0517 GENEPOLY rs1059150 Genotype GG Glucocorticoids Rheumatoid Arthritis Correlated with the decreased drug response in patients (compare with genotype TT) ac DTD0518 TRANSPID DTD0518 DTD0518 GENENAME CACNA1A DTD0518 PROTNAME Voltage-gated calcium channel alpha Cav2.1 DTD0518 GENEDBID 773 DTD0518 UNIPROID O00555 DTD0518 GENEPOLY rs2112460 SITEOFGP chr19:13479598 (GRCh38.p12) DTD0518 GENEPOLY rs2112460 GPD_TYPE SNP DTD0518 GENEPOLY rs2112460 ALLDBSNP G>A DTD0518 GENEPOLY rs2112460 MAFDBSNP A=0.4217/2112 DTD0518 GENEPOLY rs2112460 Allele A Antidepressants Major Depressive Disorder Correlated with the increased drug response in patients (compare with allele G) ac DTD0519 TRANSPID DTD0519 DTD0519 GENENAME CACNA1B DTD0519 PROTNAME Voltage-gated calcium channel alpha Cav2.2 DTD0519 GENEDBID 774 DTD0519 UNIPROID Q00975 DTD0519 GENEPOLY rs2229949 SITEOFGP chr9:138122079 (GRCh38.p12) DTD0519 GENEPOLY rs2229949 GPD_TYPE SNP DTD0519 GENEPOLY rs2229949 ALLDBSNP C>T DTD0519 GENEPOLY rs2229949 MAFDBSNP C=0.1375/510 DTD0519 GENEPOLY rs2229949 Genotype CC Antipsychotics Schizophrenia Correlated with the increased drug response in patients (compare with genotype TT) ac DTD0520 TRANSPID DTD0520 DTD0520 GENENAME CACNA1E DTD0520 PROTNAME Voltage-gated calcium channel alpha Cav2.3 DTD0520 GENEDBID 777 DTD0520 UNIPROID Q15878 DTD0520 GENEPOLY rs12060765 SITEOFGP chr1:181490624 (GRCh38.p12) DTD0520 GENEPOLY rs12060765 GPD_TYPE SNP DTD0520 GENEPOLY rs12060765 ALLDBSNP G>T DTD0520 GENEPOLY rs12060765 MAFDBSNP T=0.0136/61 DTD0520 GENEPOLY rs12060765 Genotype TT Antipsychotics Schizophrenia Correlated with the increased drug response in patients (compare with genotype GG) ac DTD0521 TRANSPID DTD0521 DTD0521 GENENAME CACNA2D3 DTD0521 PROTNAME Voltage-dependent calcium channel alpha-2/delta-3 DTD0521 GENEDBID 55799 DTD0521 UNIPROID Q9NY16 DTD0521 GENEPOLY rs7427395 SITEOFGP chr3:54365581 (GRCh38.p12) DTD0521 GENEPOLY rs7427395 GPD_TYPE SNP DTD0521 GENEPOLY rs7427395 ALLDBSNP T>C DTD0521 GENEPOLY rs7427395 MAFDBSNP T=0.1305/503 DTD0521 GENEPOLY rs7427395 Genotype CC Antipsychotics Schizophrenia Correlated with the increased drug response in patients (compare with genotype TT) ac DTD0522 TRANSPID DTD0522 DTD0522 GENENAME CACNB4 DTD0522 PROTNAME Voltage-dependent L-type calcium channel beta-4 DTD0522 GENEDBID 785 DTD0522 UNIPROID O00305 DTD0522 GENEPOLY rs3768652 SITEOFGP chr2:151869423 (GRCh38.p12) DTD0522 GENEPOLY rs3768652 GPD_TYPE SNP DTD0522 GENEPOLY rs3768652 ALLDBSNP C>A DTD0522 GENEPOLY rs3768652 MAFDBSNP A=0.0893/344 DTD0522 GENEPOLY rs3768652 Genotypes AA + AC Antipsychotics Schizophrenia Correlated with the increased drug response in patients (compare with genotype CC) ac DTD0523 TRANSPID DTD0523 DTD0523 GENENAME CACNG2 DTD0523 PROTNAME Voltage-dependent calcium channel gamma-2 DTD0523 GENEDBID 10369 DTD0523 UNIPROID Q9Y698 DTD0523 GENEPOLY rs2284018 SITEOFGP chr22:36701519 (GRCh38.p12) DTD0523 GENEPOLY rs2284018 GPD_TYPE SNP DTD0523 GENEPOLY rs2284018 ALLDBSNP C>G / C>T DTD0523 GENEPOLY rs2284018 MAFDBSNP T=0.2338/901 DTD0523 GENEPOLY rs2284018 Genotype TT Lithium Bipolar Disorder Correlated with the decreased drug response in patients (compare with genotypes CC + CT) ac DTD0524 TRANSPID DTD0524 DTD0524 GENENAME CACNG3 DTD0524 PROTNAME Voltage-dependent calcium channel gamma-3 DTD0524 GENEDBID 10368 DTD0524 UNIPROID O60359 DTD0524 GENEPOLY rs1859204 SITEOFGP chr16:24324351 (GRCh38.p12) DTD0524 GENEPOLY rs1859204 GPD_TYPE SNP DTD0524 GENEPOLY rs1859204 ALLDBSNP T>C DTD0524 GENEPOLY rs1859204 MAFDBSNP T=0.2430/1217 DTD0524 GENEPOLY rs1859204 Genotype TT Antipsychotics Schizophrenia Correlated with the increased drug response in patients (compare with genotype CC) ac DTD0525 TRANSPID DTD0525 DTD0525 GENENAME KCNJ6 DTD0525 PROTNAME Inward rectifier K(+) channel Kir3.2 DTD0525 GENEDBID 3763 DTD0525 UNIPROID P48051 DTD0525 GENEPOLY rs2835859 SITEOFGP chr21:37645860 (GRCh38.p12) DTD0525 GENEPOLY rs2835859 GPD_TYPE SNP DTD0525 GENEPOLY rs2835859 ALLDBSNP T>C DTD0525 GENEPOLY rs2835859 MAFDBSNP C=0.0433/194 DTD0525 GENEPOLY rs2835859 Genotype TT Fentanyl Postoperative Pain Correlated with the increased drug dose in patients (compare with genotypes CC + CT) aa DTD0526 TRANSPID DTD0526 DTD0526 GENENAME SCN1A DTD0526 PROTNAME Voltage-gated sodium channel alpha Nav1.1 DTD0526 GENEDBID 6323 DTD0526 UNIPROID P35498 DTD0526 GENEPOLY rs2298771 SITEOFGP chr2:166036278 (GRCh38.p12) DTD0526 GENEPOLY rs2298771 GPD_TYPE SNP DTD0526 GENEPOLY rs2298771 ALLDBSNP C>T DTD0526 GENEPOLY rs2298771 MAFDBSNP C=0.2115/1059 DTD0526 GENEPOLY rs2298771 Allele C Lamotrigine Epilepsy Correlated with the increased drug response in patients (compare with allele T) aa DTD0526 GENEPOLY rs2298771 Allele C Levetiracetam Epilepsy Correlated with the increased drug response in patients (compare with allele T) aa DTD0526 GENEPOLY rs2298771 Allele C Carbamazepine Epilepsy Correlated with the increased drug response in patients (compare with allele T) aa DTD0526 GENEPOLY rs2298771 Allele C Valproic acid Epilepsy Correlated with the increased drug response in patients (compare with allele T) aa DTD0526 GENEPOLY rs2298771 Allele C Oxcarbazepine Epilepsy Correlated with the increased drug response in patients (compare with allele T) aa DTD0526 GENEPOLY rs2298771 Allele C Clobazam Epilepsy Correlated with the increased drug response in patients (compare with allele T) ac DTD0526 GENEPOLY rs2298771 Allele C Ethosuximide Epilepsy Correlated with the increased drug response in patients (compare with allele T) ac DTD0527 TRANSPID DTD0527 DTD0527 GENENAME SCN4A DTD0527 PROTNAME Voltage-gated sodium channel alpha Nav1.4 DTD0527 GENEDBID 6329 DTD0527 UNIPROID P35499 DTD0527 GENEPOLY rs80338792 SITEOFGP chr17:63943846 (GRCh38.p12) DTD0527 GENEPOLY rs80338792 GPD_TYPE SNP DTD0527 GENEPOLY rs80338792 ALLDBSNP C>A / C>G / C>T DTD0527 GENEPOLY rs80338792 MAFDBSNP G=0.0000/1 DTD0527 GENEPOLY rs80338792 Allele T Flecainide Myotonia Correlated with the increased drug response in patients (compare with allele C) aa DTD0528 TRANSPID DTD0528 DTD0528 GENENAME SCN8A DTD0528 PROTNAME Voltage-gated sodium channel alpha Nav1.6 DTD0528 GENEDBID 6334 DTD0528 UNIPROID O95788 DTD0528 GENEPOLY rs4512905 SITEOFGP chr12:51657346 (GRCh38.p12) DTD0528 GENEPOLY rs4512905 GPD_TYPE SNP DTD0528 GENEPOLY rs4512905 ALLDBSNP T>C DTD0528 GENEPOLY rs4512905 MAFDBSNP T=0.1951/874 DTD0528 GENEPOLY rs4512905 Genotype TT Lithium Bipolar Disorder Irrelevant to the increased drug response in patients (compare with genotype CC) ac DTD0529 TRANSPID DTD0529 DTD0529 GENENAME SCN9A DTD0529 PROTNAME Voltage-gated sodium channel alpha Nav1.7 DTD0529 GENEDBID 6335 DTD0529 UNIPROID Q15858 DTD0529 GENEPOLY rs6746030 SITEOFGP chr2:166242648 (GRCh38.p12) DTD0529 GENEPOLY rs6746030 GPD_TYPE SNP DTD0529 GENEPOLY rs6746030 ALLDBSNP A>G DTD0529 GENEPOLY rs6746030 MAFDBSNP A=0.0978/438 DTD0529 GENEPOLY rs6746030 Genotypes AA + AG Propofol N.A. Correlated with the increased drug response (compare with genotype GG) ab DTD0530 TRANSPID DTD0530 DTD0530 GENENAME CACNA1H DTD0530 PROTNAME Voltage-gated calcium channel alpha Cav3.2 DTD0530 GENEDBID 8912 DTD0530 UNIPROID O95180 DTD0530 GENEPOLY rs1054645 SITEOFGP chr16:1220162 (GRCh38.p12) DTD0530 GENEPOLY rs1054645 GPD_TYPE SNP DTD0530 GENEPOLY rs1054645 ALLDBSNP G>A DTD0530 GENEPOLY rs1054645 MAFDBSNP G=0.2993/1499 DTD0530 GENEPOLY rs1054645 Allele A Antiepileptics Epilepsy Irrelevant to the drug resistance in patients (compare with allele G) ac DTD0531 TRANSPID DTD0531 DTD0531 GENENAME KCNH7 DTD0531 PROTNAME Voltage-gated potassium channel Kv11.3 DTD0531 GENEDBID 90134 DTD0531 UNIPROID Q9NS40 DTD0531 GENEPOLY rs17716942 SITEOFGP chr2:162404181 (GRCh38.p12) DTD0531 GENEPOLY rs17716942 GPD_TYPE SNP DTD0531 GENEPOLY rs17716942 ALLDBSNP T>C DTD0531 GENEPOLY rs17716942 MAFDBSNP C=0.0505/253 DTD0531 GENEPOLY rs17716942 Genotype CC Ustekinumab Psoriasis Irrelevant to the drug response in patients (compare with genotype TT) ac DTD0532 TRANSPID DTD0532 DTD0532 GENENAME KCNT1 DTD0532 PROTNAME Potassium channel subfamily T member 1 DTD0532 GENEDBID 57582 DTD0532 UNIPROID Q9P2C5 DTD0532 GENEPOLY rs10776850 SITEOFGP chr9:135785692 (GRCh38.p12) DTD0532 GENEPOLY rs10776850 GPD_TYPE SNP DTD0532 GENEPOLY rs10776850 ALLDBSNP T>A DTD0532 GENEPOLY rs10776850 MAFDBSNP A=0.1809/906 DTD0532 GENEPOLY rs10776850 Allele A Antiepileptics Epilepsy Irrelevant to the drug response in patients (compare with allele T) ac DTD0533 TRANSPID DTD0533 DTD0533 GENENAME ATP7B DTD0533 PROTNAME Copper-transporting ATPase 2 DTD0533 GENEDBID 540 DTD0533 UNIPROID P35670 DTD0533 GENEPOLY rs9535828 SITEOFGP chr13:51999286 (GRCh38.p12) DTD0533 GENEPOLY rs9535828 GPD_TYPE SNP DTD0533 GENEPOLY rs9535828 ALLDBSNP G>A / G>C / G>T DTD0533 GENEPOLY rs9535828 MAFDBSNP A=0.3652/1829 DTD0533 GENEPOLY rs9535828 Allele A Platinum compounds Lung Neoplasms Correlated with the increased drug response in patients (compare with allele G) ac DTD0534 TRANSPID DTD0534 DTD0534 GENENAME CACNA1C DTD0534 PROTNAME Voltage-gated calcium channel alpha Cav1.2 DTD0534 GENEDBID 775 DTD0534 UNIPROID Q13936 DTD0534 GENEPOLY rs2238087 SITEOFGP chr12:2504550 (GRCh38.p12) DTD0534 GENEPOLY rs2238087 GPD_TYPE SNP DTD0534 GENEPOLY rs2238087 ALLDBSNP C>G / C>T DTD0534 GENEPOLY rs2238087 MAFDBSNP T=0.0531/238 DTD0534 GENEPOLY rs2238087 Genotype CC Antipsychotics Schizophrenia Correlated with the increased drug response in patients (compare with genotype TT) ac DTD0535 TRANSPID DTD0535 DTD0535 GENENAME CACNB2 DTD0535 PROTNAME Voltage-dependent L-type calcium channel beta-2 DTD0535 GENEDBID 783 DTD0535 UNIPROID Q08289 DTD0535 GENEPOLY rs4237348 SITEOFGP chr10:18509274 (GRCh38.p12) DTD0535 GENEPOLY rs4237348 GPD_TYPE SNP DTD0535 GENEPOLY rs4237348 ALLDBSNP T>C DTD0535 GENEPOLY rs4237348 MAFDBSNP C=0.4720/1750 DTD0535 GENEPOLY rs4237348 Genotype CC Antipsychotics Schizophrenia Correlated with the increased drug response in patients (compare with genotype CT) ac DTD0537 TRANSPID DTD0537 DTD0537 GENENAME RALBP1 DTD0537 PROTNAME RalBP1-associated Eps domain-containing protein 2 DTD0537 GENEDBID 10928 DTD0537 UNIPROID Q8NFH8 DTD0540 TRANSPID DTD0540 DTD0540 GENENAME ATP12A DTD0540 PROTNAME Potassium-transporting ATPase alpha chain 2 DTD0540 GENEDBID 479 DTD0540 UNIPROID P54707 DTD0541 TRANSPID DTD0541 DTD0541 GENENAME CACNA1G DTD0541 PROTNAME Voltage-gated calcium channel subunit alpha Cav3.1 DTD0541 GENEDBID 8913 DTD0541 UNIPROID O43497 DTD0542 TRANSPID DTD0542 DTD0542 GENENAME ANXA2 DTD0542 PROTNAME Annexin A2 DTD0542 GENEDBID 302 DTD0542 UNIPROID P07355 DTD0543 TRANSPID DTD0543 DTD0543 GENENAME KCNN1 DTD0543 PROTNAME Small conductance calcium-activated potassium channel protein 1 DTD0543 GENEDBID 3780 DTD0543 UNIPROID Q92952 DTD0544 TRANSPID DTD0544 DTD0544 GENENAME KCNA5 DTD0544 PROTNAME Voltage-gated potassium channel subunit Kv1.5 DTD0544 GENEDBID 3741 DTD0544 UNIPROID P22460 DTD0545 TRANSPID DTD0545 DTD0545 GENENAME KCNK2 DTD0545 PROTNAME Potassium channel subfamily K member 2 DTD0545 GENEDBID 3776 DTD0545 UNIPROID O95069 DTD0546 TRANSPID DTD0546 DTD0546 GENENAME KCNK9 DTD0546 PROTNAME Potassium channel subfamily K member 9 DTD0546 GENEDBID 51305 DTD0546 UNIPROID Q9NPC2 DTD0547 TRANSPID DTD0547 DTD0547 GENENAME KCNK4 DTD0547 PROTNAME Potassium channel subfamily K member 4 DTD0547 GENEDBID 50801 DTD0547 UNIPROID Q9NYG8 DTD0648 TRANSPID DTD0648 DTD0648 GENENAME ATP7A DTD0648 PROTNAME Copper-transporting ATPase 1 DTD0648 GENEDBID 538 DTD0648 UNIPROID Q04656