General Information of Drug Transporter (DT)
DT ID DTD0001 Transporter Info
Gene Name ABCC1
Transporter Name Multidrug resistance-associated protein 1
Gene ID
4363
UniProt ID
P33527
Epigenetic Regulations of This DT (ERD)
Epigenetic Phenomenon Hypomethylation of ABCC1 in cystic fibrosis [1]
Location Promoter (-612 to -317 bp)
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Related Molecular Changes Up regulation of ABCC1 Experiment Method RT-qPCR
Studied Phenotype Cystic fibrosis [ICD-11: CA25]
Experimental Material Multiple cell lines of human
Additional Notes Histone modifications rather than DNA methylation may play a role in regulating ABCC1 expression.
Epigenetic Phenomenon Hypomethylation of ABCC1 in pancreatic cancer [2]
Location Promoter
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Related Molecular Changes Up regulation of ABCC1 Experiment Method RT-qPCR
Studied Phenotype Pancreatic cancer [ICD-11: 2C10]
Experimental Material Multiple cell lines of human
Additional Notes The expression of ABCC1 in human pancreatic cancer cells was not correlated with promoter demethylation.
Epigenetic Phenomenon Higher expression of miR-134 in breast cancer (compare to doxorubicin-resistance counterpart cells) [3]
Epigenetic Type microRNA Experiment Method .
Related Molecular Changes Down regulation of ABCC1 Experiment Method RT-qPCR
miRNA Stemloop ID miR-134 miRNA Mature ID miR-134-3p
miRNA Sequence CCUGUGGGCCACCUAGUCACCAA
miRNA Target Type Direct
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Additional Notes MicroRNA-134 modulates resistance to doxorubicin in breast cancer cells by downregulating the expression of ABCC1.
Epigenetic Phenomenon Higher expression of miR-7 in small cell lung cancer (compare with drug-resistant counterpart cells) [4]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCC1 Experiment Method RT-qPCR
miRNA Stemloop ID miR-7 miRNA Mature ID miR-7-5p
miRNA Sequence UGGAAGACUAGUGAUUUUGUUGUU
miRNA Target Type Direct
Studied Phenotype Small cell lung cancer [ICD-11: 2C25.1]
Experimental Material Patient tissue samples
Additional Notes miR-7 modulates chemoresistance of small cell lung cancer by repressing MRP1/ABCC1.
Epigenetic Phenomenon miR-133a regulates ABCA1 expression [5]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCC1 Experiment Method RT-qPCR
miRNA Stemloop ID miR-133a miRNA Mature ID miR-133a-5p
miRNA Sequence AGCUGGUAAAAUGGAACCAAAU
miRNA Target Type Direct
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Human hepatocellular carcinoma cell line (HepG2)
Additional Notes The involvement of miR-133a in MDR is mediated by ABCC1 in hepatocellular carcinoma cell line HepG2 and suggested that miR-133a may be efficient agents for preventing and reversing ADM resistance in cancer cells.
Epigenetic Phenomenon miR-133a regulates ABCA1 expression [5]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCC1 Experiment Method Western Blot
miRNA Stemloop ID miR-133a miRNA Mature ID miR-133a-5p
miRNA Sequence AGCUGGUAAAAUGGAACCAAAU
miRNA Target Type Direct
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Human hepatocellular carcinoma cell line (HepG2)
Additional Notes The involvement of miR-133a in MDR is mediated by ABCC1 in hepatocellular carcinoma cell line HepG2 and suggested that miR-133a may be efficient agents for preventing and reversing ADM resistance in cancer cells.
Epigenetic Phenomenon miR-326 regulates ABCA1 expression [5]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCC1 Experiment Method Western Blot
miRNA Stemloop ID miR-326 miRNA Mature ID miR-326
miRNA Sequence CCUCUGGGCCCUUCCUCCAG
miRNA Target Type Direct
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Human hepatocellular carcinoma cell line (HepG2)
Additional Notes The involvement of miR-326 in MDR is mediated by ABCC1 in hepatocellular carcinoma cell line HepG2 and suggested that miR-326 may be efficient agents for preventing and reversing ADM resistance in cancer cells.
Epigenetic Phenomenon let-7b directly targets ABCC1 [6]
Epigenetic Type microRNA Experiment Method Proteomics
miRNA Stemloop ID let-7b miRNA Mature ID let-7b-5p
miRNA Sequence UGAGGUAGUAGGUUGUGUGGUU
miRNA Target Type Direct
Experimental Material Human cervical cancer cell line (Hela)
Epigenetic Phenomenon miR-1 directly targets ABCC1 [7]
Epigenetic Type microRNA Experiment Method Proteomics;Microarray
miRNA Stemloop ID miR-1 miRNA Mature ID miR-1-3p
miRNA Sequence UGGAAUGUAAAGAAGUAUGUAU
miRNA Target Type Direct
Experimental Material Human cervical cancer cell line (Hela)
Epigenetic Phenomenon miR-125b directly targets ABCC1 [8]
Epigenetic Type microRNA Experiment Method CLASH
miRNA Stemloop ID miR-125b miRNA Mature ID miR-125b-5p
miRNA Sequence UCCCUGAGACCCUAACUUGUGA
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-1323 directly targets ABCC1 [9]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-1323 miRNA Mature ID miR-1323
miRNA Sequence UCAAAACUGAGGGGCAUUUUCU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-16 directly targets ABCC1 [8]
Epigenetic Type microRNA Experiment Method CLASH
miRNA Stemloop ID miR-16 miRNA Mature ID miR-16-5p
miRNA Sequence UAGCAGCACGUAAAUAUUGGCG
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-1825 directly targets ABCC1 [9]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-1825 miRNA Mature ID miR-1825
miRNA Sequence UCCAGUGCCCUCCUCUCC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-199a directly targets ABCC1 [9]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-199a miRNA Mature ID miR-199a-5p
miRNA Sequence CCCAGUGUUCAGACUACCUGUUC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-199b directly targets ABCC1 [9]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-199b miRNA Mature ID miR-199b-5p
miRNA Sequence CCCAGUGUUUAGACUAUCUGUUC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-224 directly targets ABCC1 [9]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-224 miRNA Mature ID miR-224-5p
miRNA Sequence UCAAGUCACUAGUGGUUCCGUUUAG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-23b directly targets ABCC1 [8]
Epigenetic Type microRNA Experiment Method CLASH
miRNA Stemloop ID miR-23b miRNA Mature ID miR-23b-3p
miRNA Sequence AUCACAUUGCCAGGGAUUACCAC
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-3180 directly targets ABCC1 [9]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-3180 miRNA Mature ID miR-3180-5p
miRNA Sequence CUUCCAGACGCUCCGCCCCACGUCG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-339 directly targets ABCC1 [8]
Epigenetic Type microRNA Experiment Method CLASH
miRNA Stemloop ID miR-339 miRNA Mature ID miR-339-5p
miRNA Sequence UCCCUGUCCUCCAGGAGCUCACG
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-361 directly targets ABCC1 [9]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-361 miRNA Mature ID miR-361-3p
miRNA Sequence UCCCCCAGGUGUGAUUCUGAUUU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-5195 directly targets ABCC1 [9]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-5195 miRNA Mature ID miR-5195-3p
miRNA Sequence AUCCAGUUCUCUGAGGGGGCU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-520d directly targets ABCC1 [9]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-520d miRNA Mature ID miR-520d-5p
miRNA Sequence CUACAAAGGGAAGCCCUUUC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-524 directly targets ABCC1 [9]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-524 miRNA Mature ID miR-524-5p
miRNA Sequence CUACAAAGGGAAGCACUUUCUC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-548o directly targets ABCC1 [9]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-548o miRNA Mature ID miR-548o-3p
miRNA Sequence CCAAAACUGCAGUUACUUUUGC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-5582 directly targets ABCC1 [9]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-5582 miRNA Mature ID miR-5582-3p
miRNA Sequence UAAAACUUUAAGUGUGCCUAGG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-615 directly targets ABCC1 [8]
Epigenetic Type microRNA Experiment Method CLASH
miRNA Stemloop ID miR-615 miRNA Mature ID miR-615-3p
miRNA Sequence UCCGAGCCUGGGUCUCCCUCUU
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-7-5p directly targets ABCC1 [4]
Epigenetic Type microRNA Experiment Method Immunohistochemistry//Luciferase reporter assay//qRT-PCR
miRNA Stemloop ID miR-7-5p miRNA Mature ID miR-7-5p
miRNA Sequence UGGAAGACUAGUGAUUUUGUUGUU
miRNA Target Type Direct
Experimental Material Patient tissue samples
Epigenetic Phenomenon miR-98 directly targets ABCC1 [10]
Epigenetic Type microRNA Experiment Method Microarray
miRNA Stemloop ID miR-98 miRNA Mature ID miR-98-5p
miRNA Sequence UGAGGUAGUAAGUUGUAUUGUU
miRNA Target Type Direct
Experimental Material Human cervical cancer cell line (Hela)
References
1 Increased Expression of Plasma-Induced ABCC1 mRNA in Cystic Fibrosis. Int J Mol Sci. 2017 Aug 11;18(8). pii: E1752.
2 Expression and promoter methylation analysis of ATP-binding cassette genes in pancreatic cancer. Oncol Rep. 2012 Jan;27(1):265-9.
3 MicroRNA-134 modulates resistance to doxorubicin in human breast cancer cells by downregulating ABCC1. Biotechnol Lett. 2015 Dec;37(12):2387-94.
4 miR-7 modulates chemoresistance of small cell lung cancer by repressing MRP1/ABCC1. Int J Exp Pathol. 2015 Aug;96(4):240-7.
5 Involvement of miR-133a and miR-326 in ADM resistance of HepG2 through modulating expression of ABCC1. J Drug Target. 2015;23(6):519-24.
6 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
7 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
8 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
9 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
10 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.