General Information of Drug Transporter (DT)
DT ID DTD0002 Transporter Info
Gene Name ABCC2
Transporter Name Multidrug resistance-associated protein 2
Gene ID
1244
UniProt ID
Q92887
Epigenetic Regulations of This DT (ERD)
Epigenetic Phenomenon Methylation of ABCC2 in pancretic ductal adenocarcinoma [1]
Location 5'UTR (cg10264188)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.13E+00 Statistic Test p-value: 2.32E-07; Z-score: 1.27E+00
Methylation in Case 5.65E-01 (Median) Methylation in Control 5.00E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in bladder cancer [2]
Location TSS1500 (cg05914069)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 1.00E-03; Z-score: -2.28E+00
Methylation in Case 7.39E-01 (Median) Methylation in Control 7.83E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in breast cancer [3]
Location TSS1500 (cg00826767)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.08E+00 Statistic Test p-value: 3.34E-07; Z-score: -1.85E+00
Methylation in Case 7.28E-01 (Median) Methylation in Control 7.89E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in colorectal cancer [4]
Location TSS1500 (cg00826767)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 2.40E-05; Z-score: -9.89E-01
Methylation in Case 8.99E-01 (Median) Methylation in Control 9.17E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in colorectal cancer [4]
Location TSS1500 (cg16377144)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 4.26E-05; Z-score: -1.18E+00
Methylation in Case 9.03E-01 (Median) Methylation in Control 9.24E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in colorectal cancer [4]
Location TSS1500 (cg05914069)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 1.54E-04; Z-score: -7.53E-01
Methylation in Case 8.88E-01 (Median) Methylation in Control 9.05E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in hepatocellular carcinoma [5]
Location TSS1500 (cg05914069)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 1.26E-03; Z-score: -4.21E-01
Methylation in Case 7.48E-01 (Median) Methylation in Control 7.59E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in HIV infection [6]
Location TSS1500 (cg05914069)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 7.08E-04; Z-score: -1.46E+00
Methylation in Case 8.21E-01 (Median) Methylation in Control 8.57E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in HIV infection [6]
Location TSS1500 (cg16377144)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 3.75E-03; Z-score: -1.02E+00
Methylation in Case 8.10E-01 (Median) Methylation in Control 8.37E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in lung adenocarcinoma [7]
Location TSS1500 (cg00826767)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 3.52E-03; Z-score: 1.22E+00
Methylation in Case 8.42E-01 (Median) Methylation in Control 7.99E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in lung adenocarcinoma [7]
Location TSS1500 (cg16377144)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 1.98E-02; Z-score: 1.32E+00
Methylation in Case 7.81E-01 (Median) Methylation in Control 7.43E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in pancretic ductal adenocarcinoma [1]
Location TSS1500 (cg09177518)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 3.22E+00 Statistic Test p-value: 4.10E-24; Z-score: 4.91E+00
Methylation in Case 2.67E-01 (Median) Methylation in Control 8.30E-02 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in pancretic ductal adenocarcinoma [1]
Location TSS1500 (cg14208112)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.63E+00 Statistic Test p-value: 3.05E-17; Z-score: 3.28E+00
Methylation in Case 1.14E-01 (Median) Methylation in Control 7.02E-02 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in pancretic ductal adenocarcinoma [1]
Location TSS1500 (cg15623519)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.30E+00 Statistic Test p-value: 6.60E-07; Z-score: -2.16E+00
Methylation in Case 2.83E-01 (Median) Methylation in Control 3.69E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in papillary thyroid cancer [8]
Location TSS1500 (cg05914069)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 3.54E-02; Z-score: -2.16E-01
Methylation in Case 7.84E-01 (Median) Methylation in Control 7.90E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in prostate cancer [9]
Location TSS1500 (cg07337598)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.03E+00 Statistic Test p-value: 2.65E-02; Z-score: 2.69E+00
Methylation in Case 8.79E-01 (Median) Methylation in Control 8.51E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in systemic lupus erythematosus [10]
Location TSS1500 (cg16377144)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 9.52E-03; Z-score: -2.64E-01
Methylation in Case 8.51E-01 (Median) Methylation in Control 8.59E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in systemic lupus erythematosus [10]
Location TSS1500 (cg05914069)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 3.41E-02; Z-score: -2.01E-01
Methylation in Case 8.53E-01 (Median) Methylation in Control 8.61E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in bladder cancer [2]
Location TSS200 (cg09448875)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.31E+00 Statistic Test p-value: 1.24E-05; Z-score: -2.28E+01
Methylation in Case 6.29E-01 (Median) Methylation in Control 8.27E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in breast cancer [3]
Location TSS200 (cg09448875)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.13E+00 Statistic Test p-value: 2.55E-08; Z-score: -2.20E+00
Methylation in Case 6.99E-01 (Median) Methylation in Control 7.86E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in HIV infection [6]
Location TSS200 (cg09448875)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 1.70E-02; Z-score: -6.37E-01
Methylation in Case 9.44E-01 (Median) Methylation in Control 9.55E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in pancretic ductal adenocarcinoma [1]
Location TSS200 (cg06210630)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.05E+00 Statistic Test p-value: 1.52E-04; Z-score: -7.42E-01
Methylation in Case 5.45E-01 (Median) Methylation in Control 5.71E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in pancretic ductal adenocarcinoma [1]
Location TSS200 (cg21378238)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.03E+00 Statistic Test p-value: 3.61E-03; Z-score: 1.86E-01
Methylation in Case 2.97E-01 (Median) Methylation in Control 2.87E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in papillary thyroid cancer [8]
Location TSS200 (cg09448875)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.02E+00 Statistic Test p-value: 5.11E-03; Z-score: 7.78E-01
Methylation in Case 9.14E-01 (Median) Methylation in Control 8.94E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in pancretic ductal adenocarcinoma [1]
Location 1stExon (cg24173049)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -2.52E+00 Statistic Test p-value: 5.09E-05; Z-score: -1.22E+00
Methylation in Case 1.14E-01 (Median) Methylation in Control 2.88E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in atypical teratoid rhabdoid tumor [11]
Location Body (cg00706648)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.13E+00 Statistic Test p-value: 3.37E-05; Z-score: -1.13E+00
Methylation in Case 7.43E-01 (Median) Methylation in Control 8.39E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in atypical teratoid rhabdoid tumor [11]
Location Body (cg02672229)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.10E+00 Statistic Test p-value: 1.99E-04; Z-score: -9.80E-01
Methylation in Case 7.26E-01 (Median) Methylation in Control 7.95E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in atypical teratoid rhabdoid tumor [11]
Location Body (cg03381359)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 2.97E-04; Z-score: 5.67E-01
Methylation in Case 9.40E-01 (Median) Methylation in Control 8.98E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in atypical teratoid rhabdoid tumor [11]
Location Body (cg05403832)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.66E+00 Statistic Test p-value: 1.45E-03; Z-score: -8.63E-01
Methylation in Case 1.53E-01 (Median) Methylation in Control 2.55E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in atypical teratoid rhabdoid tumor [11]
Location Body (cg05916255)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -2.41E+00 Statistic Test p-value: 1.82E-03; Z-score: -4.43E-01
Methylation in Case 4.40E-02 (Median) Methylation in Control 1.06E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in atypical teratoid rhabdoid tumor [11]
Location Body (cg07520093)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.06E+00 Statistic Test p-value: 4.03E-03; Z-score: 1.98E-01
Methylation in Case 3.25E-01 (Median) Methylation in Control 3.06E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in atypical teratoid rhabdoid tumor [11]
Location Body (cg08720365)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.15E+00 Statistic Test p-value: 7.81E-03; Z-score: 1.23E+00
Methylation in Case 8.31E-01 (Median) Methylation in Control 7.25E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in atypical teratoid rhabdoid tumor [11]
Location Body (cg12673726)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 2.86E-02; Z-score: 4.19E-01
Methylation in Case 1.04E-01 (Median) Methylation in Control 9.91E-02 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in atypical teratoid rhabdoid tumor [11]
Location Body (cg13617376)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.01E+00 Statistic Test p-value: 3.76E-02; Z-score: 7.52E-02
Methylation in Case 1.14E-01 (Median) Methylation in Control 1.13E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in atypical teratoid rhabdoid tumor [11]
Location Body (cg14303526)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.03E+00 Statistic Test p-value: 4.45E-02; Z-score: 4.23E-01
Methylation in Case 8.53E-01 (Median) Methylation in Control 8.28E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in bladder cancer [2]
Location Body (cg17044311)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.92E+00 Statistic Test p-value: 3.57E-13; Z-score: -1.45E+01
Methylation in Case 4.06E-01 (Median) Methylation in Control 7.78E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in bladder cancer [2]
Location Body (cg13617376)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.77E+00 Statistic Test p-value: 2.90E-11; Z-score: -1.73E+01
Methylation in Case 4.73E-01 (Median) Methylation in Control 8.38E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in bladder cancer [2]
Location Body (cg02672229)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.88E+00 Statistic Test p-value: 1.09E-08; Z-score: -2.14E+01
Methylation in Case 4.49E-01 (Median) Methylation in Control 8.46E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in bladder cancer [2]
Location Body (cg00706648)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 1.61E-06; Z-score: -7.42E+00
Methylation in Case 7.31E-01 (Median) Methylation in Control 7.94E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in bladder cancer [2]
Location Body (cg14303526)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.12E+00 Statistic Test p-value: 1.40E-04; Z-score: -2.97E+00
Methylation in Case 7.31E-01 (Median) Methylation in Control 8.15E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in bladder cancer [2]
Location Body (cg05916255)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 1.41E-02; Z-score: -1.95E+00
Methylation in Case 7.40E-01 (Median) Methylation in Control 7.86E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in bladder cancer [2]
Location Body (cg08720365)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 2.42E-02; Z-score: -6.97E-01
Methylation in Case 7.62E-01 (Median) Methylation in Control 7.80E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in breast cancer [3]
Location Body (cg00706648)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.08E+00 Statistic Test p-value: 3.52E-10; Z-score: -2.13E+00
Methylation in Case 7.26E-01 (Median) Methylation in Control 7.85E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in breast cancer [3]
Location Body (cg14303526)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.16E+00 Statistic Test p-value: 1.28E-07; Z-score: -1.52E+00
Methylation in Case 6.53E-01 (Median) Methylation in Control 7.60E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in breast cancer [3]
Location Body (cg19378330)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 2.33E+00 Statistic Test p-value: 4.65E-07; Z-score: 1.65E+00
Methylation in Case 9.35E-02 (Median) Methylation in Control 4.01E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in breast cancer [3]
Location Body (cg02672229)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.17E+00 Statistic Test p-value: 3.30E-05; Z-score: -1.28E+00
Methylation in Case 7.06E-01 (Median) Methylation in Control 8.23E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in breast cancer [3]
Location Body (cg12673726)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.38E+00 Statistic Test p-value: 5.66E-05; Z-score: 1.06E+00
Methylation in Case 5.37E-02 (Median) Methylation in Control 3.89E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in breast cancer [3]
Location Body (cg25290633)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 9.35E-05; Z-score: -8.82E-01
Methylation in Case 8.52E-01 (Median) Methylation in Control 8.83E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in breast cancer [3]
Location Body (cg05916255)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.11E+00 Statistic Test p-value: 9.11E-04; Z-score: -7.14E-01
Methylation in Case 7.52E-01 (Median) Methylation in Control 8.38E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in breast cancer [3]
Location Body (cg16201095)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 4.02E-03; Z-score: -4.81E-01
Methylation in Case 9.58E-01 (Median) Methylation in Control 9.68E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in breast cancer [3]
Location Body (cg17044311)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 1.43E-02; Z-score: -7.52E-01
Methylation in Case 7.89E-01 (Median) Methylation in Control 8.34E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in colorectal cancer [4]
Location Body (cg00706648)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.07E+00 Statistic Test p-value: 8.51E-12; Z-score: -2.74E+00
Methylation in Case 7.66E-01 (Median) Methylation in Control 8.18E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in colorectal cancer [4]
Location Body (cg02672229)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.08E+00 Statistic Test p-value: 2.68E-09; Z-score: -2.86E+00
Methylation in Case 8.39E-01 (Median) Methylation in Control 9.04E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in colorectal cancer [4]
Location Body (cg17044311)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.08E+00 Statistic Test p-value: 3.35E-09; Z-score: -3.22E+00
Methylation in Case 8.61E-01 (Median) Methylation in Control 9.26E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in colorectal cancer [4]
Location Body (cg13617376)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 6.36E-08; Z-score: -1.99E+00
Methylation in Case 8.56E-01 (Median) Methylation in Control 9.11E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in colorectal cancer [4]
Location Body (cg19604369)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 6.49E-06; Z-score: -1.11E+00
Methylation in Case 9.16E-01 (Median) Methylation in Control 9.27E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in colorectal cancer [4]
Location Body (cg19378330)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.19E+00 Statistic Test p-value: 1.64E-04; Z-score: 3.41E-01
Methylation in Case 1.28E-01 (Median) Methylation in Control 1.08E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in colorectal cancer [4]
Location Body (cg12673726)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 4.10E-03; Z-score: -1.58E-01
Methylation in Case 1.02E-01 (Median) Methylation in Control 1.12E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in colorectal cancer [4]
Location Body (cg05916255)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 1.33E-02; Z-score: -1.50E+00
Methylation in Case 8.75E-01 (Median) Methylation in Control 8.98E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in colorectal cancer [4]
Location Body (cg07520093)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.07E+00 Statistic Test p-value: 2.73E-02; Z-score: -2.90E-01
Methylation in Case 7.10E-02 (Median) Methylation in Control 7.62E-02 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in hepatocellular carcinoma [5]
Location Body (cg14645545)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 2.09E+00 Statistic Test p-value: 1.52E-18; Z-score: 3.28E+00
Methylation in Case 4.51E-01 (Median) Methylation in Control 2.16E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in hepatocellular carcinoma [5]
Location Body (cg19708984)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -2.20E+00 Statistic Test p-value: 2.19E-18; Z-score: -4.26E+00
Methylation in Case 3.12E-01 (Median) Methylation in Control 6.87E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in hepatocellular carcinoma [5]
Location Body (cg10333311)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.37E+00 Statistic Test p-value: 7.44E-14; Z-score: -4.94E+00
Methylation in Case 5.00E-01 (Median) Methylation in Control 6.87E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in hepatocellular carcinoma [5]
Location Body (cg04558907)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.49E+00 Statistic Test p-value: 5.18E-13; Z-score: -3.81E+00
Methylation in Case 4.96E-01 (Median) Methylation in Control 7.41E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in hepatocellular carcinoma [5]
Location Body (cg19715414)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 2.08E+00 Statistic Test p-value: 1.82E-11; Z-score: 3.10E+00
Methylation in Case 3.47E-01 (Median) Methylation in Control 1.67E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in hepatocellular carcinoma [5]
Location Body (cg13617376)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.35E+00 Statistic Test p-value: 2.29E-09; Z-score: -1.42E+00
Methylation in Case 4.54E-01 (Median) Methylation in Control 6.15E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in hepatocellular carcinoma [5]
Location Body (cg12673726)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.48E+00 Statistic Test p-value: 5.80E-08; Z-score: 1.72E+00
Methylation in Case 4.31E-01 (Median) Methylation in Control 2.91E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in hepatocellular carcinoma [5]
Location Body (cg16201095)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 2.75E-07; Z-score: -1.24E+00
Methylation in Case 9.38E-01 (Median) Methylation in Control 9.57E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in hepatocellular carcinoma [5]
Location Body (cg14303526)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 6.29E-07; Z-score: -1.62E+00
Methylation in Case 7.12E-01 (Median) Methylation in Control 7.75E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in hepatocellular carcinoma [5]
Location Body (cg07520093)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.30E+00 Statistic Test p-value: 3.75E-05; Z-score: 7.74E-01
Methylation in Case 6.19E-02 (Median) Methylation in Control 4.76E-02 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in HIV infection [6]
Location Body (cg17044311)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.26E+00 Statistic Test p-value: 2.88E-23; Z-score: 3.42E+00
Methylation in Case 8.68E-01 (Median) Methylation in Control 6.87E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in HIV infection [6]
Location Body (cg14303526)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.21E+00 Statistic Test p-value: 5.25E-22; Z-score: 3.19E+00
Methylation in Case 8.63E-01 (Median) Methylation in Control 7.13E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in HIV infection [6]
Location Body (cg03381359)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.21E+00 Statistic Test p-value: 2.52E-18; Z-score: 3.77E+00
Methylation in Case 8.95E-01 (Median) Methylation in Control 7.40E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in HIV infection [6]
Location Body (cg19604369)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.11E+00 Statistic Test p-value: 3.99E-16; Z-score: 2.21E+00
Methylation in Case 8.78E-01 (Median) Methylation in Control 7.90E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in HIV infection [6]
Location Body (cg19378330)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.77E+00 Statistic Test p-value: 5.17E-07; Z-score: 2.08E+00
Methylation in Case 6.80E-02 (Median) Methylation in Control 3.85E-02 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in HIV infection [6]
Location Body (cg02672229)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.06E+00 Statistic Test p-value: 1.38E-05; Z-score: 6.75E-01
Methylation in Case 7.69E-01 (Median) Methylation in Control 7.27E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in HIV infection [6]
Location Body (cg12673726)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.75E+00 Statistic Test p-value: 4.33E-05; Z-score: 2.23E+00
Methylation in Case 5.89E-02 (Median) Methylation in Control 3.36E-02 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in HIV infection [6]
Location Body (cg05403832)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 4.05E-02; Z-score: -5.39E-01
Methylation in Case 6.04E-01 (Median) Methylation in Control 6.25E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in lung adenocarcinoma [7]
Location Body (cg08720365)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.05E+00 Statistic Test p-value: 3.81E-05; Z-score: -2.85E+00
Methylation in Case 7.92E-01 (Median) Methylation in Control 8.29E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in lung adenocarcinoma [7]
Location Body (cg00706648)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.05E+00 Statistic Test p-value: 3.88E-03; Z-score: -2.14E+00
Methylation in Case 7.50E-01 (Median) Methylation in Control 7.90E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in lung adenocarcinoma [7]
Location Body (cg05916255)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 1.54E-02; Z-score: -1.73E+00
Methylation in Case 8.09E-01 (Median) Methylation in Control 8.36E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in lung adenocarcinoma [7]
Location Body (cg13617376)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 3.05E-02; Z-score: -1.69E+00
Methylation in Case 8.44E-01 (Median) Methylation in Control 8.73E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in pancretic ductal adenocarcinoma [1]
Location Body (cg09283154)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.87E+00 Statistic Test p-value: 8.12E-16; Z-score: 2.76E+00
Methylation in Case 3.94E-01 (Median) Methylation in Control 2.10E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in pancretic ductal adenocarcinoma [1]
Location Body (cg15889012)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.37E+00 Statistic Test p-value: 6.34E-08; Z-score: -2.06E+00
Methylation in Case 1.61E-01 (Median) Methylation in Control 2.21E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in pancretic ductal adenocarcinoma [1]
Location Body (cg11201401)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.10E+00 Statistic Test p-value: 7.04E-04; Z-score: 7.93E-01
Methylation in Case 5.28E-01 (Median) Methylation in Control 4.78E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in pancretic ductal adenocarcinoma [1]
Location Body (cg11805188)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.13E+00 Statistic Test p-value: 2.70E-02; Z-score: 7.94E-01
Methylation in Case 4.88E-01 (Median) Methylation in Control 4.30E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in panic disorder [12]
Location Body (cg12673726)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -9.76E-01 Statistic Test p-value: 1.52E-02; Z-score: -4.21E-01
Methylation in Case -4.77E+00 (Median) Methylation in Control -4.65E+00 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in panic disorder [12]
Location Body (cg03381359)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.17E+00 Statistic Test p-value: 1.92E-02; Z-score: -5.68E-01
Methylation in Case 1.29E+00 (Median) Methylation in Control 1.51E+00 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in papillary thyroid cancer [8]
Location Body (cg00706648)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 5.10E-08; Z-score: -1.28E+00
Methylation in Case 7.45E-01 (Median) Methylation in Control 7.64E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in papillary thyroid cancer [8]
Location Body (cg03381359)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 5.04E-05; Z-score: -7.06E-01
Methylation in Case 9.28E-01 (Median) Methylation in Control 9.38E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in papillary thyroid cancer [8]
Location Body (cg14303526)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 6.17E-05; Z-score: 7.22E-01
Methylation in Case 8.58E-01 (Median) Methylation in Control 8.18E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in papillary thyroid cancer [8]
Location Body (cg07520093)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.15E+00 Statistic Test p-value: 1.75E-03; Z-score: -5.30E-01
Methylation in Case 3.86E-02 (Median) Methylation in Control 4.43E-02 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in papillary thyroid cancer [8]
Location Body (cg08720365)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 2.24E-03; Z-score: -6.77E-01
Methylation in Case 8.59E-01 (Median) Methylation in Control 8.76E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in papillary thyroid cancer [8]
Location Body (cg25290633)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 3.49E-03; Z-score: -4.69E-01
Methylation in Case 9.10E-01 (Median) Methylation in Control 9.19E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in papillary thyroid cancer [8]
Location Body (cg13617376)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 7.84E-03; Z-score: -4.76E-01
Methylation in Case 9.11E-01 (Median) Methylation in Control 9.22E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in systemic lupus erythematosus [10]
Location Body (cg05916255)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 2.47E-02; Z-score: -1.70E-01
Methylation in Case 8.36E-01 (Median) Methylation in Control 8.39E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in systemic lupus erythematosus [10]
Location Body (cg02672229)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 3.41E-02; Z-score: -4.79E-02
Methylation in Case 7.58E-01 (Median) Methylation in Control 7.60E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in atypical teratoid rhabdoid tumor [11]
Location 3'UTR (cg10841077)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 4.01E-12; Z-score: -4.80E+00
Methylation in Case 9.03E-01 (Median) Methylation in Control 9.83E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in bladder cancer [2]
Location 3'UTR (cg10841077)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 8.61E-03; Z-score: -2.36E+00
Methylation in Case 8.94E-01 (Median) Methylation in Control 9.17E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in breast cancer [3]
Location 3'UTR (cg10841077)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 1.75E-03; Z-score: -5.33E-01
Methylation in Case 9.08E-01 (Median) Methylation in Control 9.18E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in hepatocellular carcinoma [5]
Location 3'UTR (cg10841077)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 1.40E-03; Z-score: -5.05E-01
Methylation in Case 8.98E-01 (Median) Methylation in Control 9.07E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in HIV infection [6]
Location 3'UTR (cg10841077)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.02E+00 Statistic Test p-value: 2.09E-04; Z-score: 8.29E-01
Methylation in Case 9.45E-01 (Median) Methylation in Control 9.31E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC2 in prostate cancer [9]
Location 3'UTR (cg07551022)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.02E+00 Statistic Test p-value: 4.47E-02; Z-score: 1.74E+00
Methylation in Case 9.43E-01 (Median) Methylation in Control 9.20E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon High expression of miR-297 in colorectal cancer (compare to oxaliplatin-resistance counterpart cell) [13]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCC2 Experiment Method RT-qPCR
miRNA Stemloop ID miR-297 miRNA Mature ID miR-297
miRNA Sequence AUGUAUGUGUGCAUGUGCAUG
miRNA Target Type Direct
Studied Phenotype Colorectal carcinoma [ICD-11: 2B91.Z]
Experimental Material Patient tissue samples, Multiple cell lines of human
Additional Notes miR-297 modulates multidrug resistance in human colorectal carcinoma by down-regulating MRP-2.
Epigenetic Phenomenon High expression of miR-490-3p in ovarian cancer (compare to multidrug-resistance counterpart cell) [14]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCC2 Experiment Method Immunohistochemical staining
miRNA Stemloop ID miR-490 miRNA Mature ID miR-490-3p
miRNA Sequence CAACCUGGAGGACUCCAUGCUG
miRNA Target Type Direct
Studied Phenotype Ovarian cancer [ICD-11: 2C73]
Experimental Material Multiple cell lines of human
Additional Notes miR-490-3p overexpression may increase the sensitivity of ovarian cancer cells to cisplatin by targeting ABCC2.
Epigenetic Phenomenon Low expression of miR-379 in HCC (compare with rifampicin treatment counterpart cells) [15]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCC2 Experiment Method Western Blot
miRNA Stemloop ID miR-379 miRNA Mature ID miR-379-5p
miRNA Sequence UGGUAGACUAUGGAACGUAGG
miRNA Target Type Direct
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Human hepatocellular carcinoma cells line (HepG2)
Additional Notes Down-regulation of ABCC2 protein expression in HepG2 cells after rifampicin treatment is mediated by microRNA-379
Epigenetic Phenomenon miR-205-5p downregulate ABCC2 expression [16]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCC2 Experiment Method Western Blot
miRNA Stemloop ID miR-205 miRNA Mature ID miR-205-5p
miRNA Sequence UCCUUCAUUCCACCGGAGUCUG
miRNA Target Type Direct
Studied Phenotype Chronic myeloid leukemia [ICD-11: 2B33.1]
Experimental Material Chronic myelocytic leukemia cell line (K562)
Additional Notes miR-205-5p overexpression may increase the sensitivity of chronic myeloid leukemia cells to imatinib by targeting ABCC2.
Epigenetic Phenomenon miR-490 directly targets ABCC2 [14]
Epigenetic Type microRNA Experiment Method Immunohistochemistry//Luciferase reporter assay//qRT-PCR//Western blot
miRNA Stemloop ID miR-490 miRNA Mature ID miR-490-3p
miRNA Sequence CAACCUGGAGGACUCCAUGCUG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13 miR-297 modulates multidrug resistance in human colorectal carcinoma by down-regulating MRP-2. Biochem J. 2012 Sep 1;446(2):291-300.
14 MiR-490-3p sensitizes ovarian cancer cells to cisplatin by directly targeting ABCC2. Am J Transl Res. 2017 Mar 15;9(3):1127-1138. eCollection 2017.
15 Down-regulation of ATP-binding cassette C2 protein expression in HepG2 cells after rifampicin treatment is mediated by microRNA-379. Mol Pharmacol. 2011 Aug;80(2):314-20.
16 LncRNA SNHG5 regulates imatinib resistance in chronic myeloid leukemia via acting as a CeRNA against MiR-205-5p. Am J Cancer Res. 2017 Aug 1;7(8):1704-1713. eCollection 2017.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.