General Information of Drug Transporter (DT)
DT ID DTD0003 Transporter Info
Gene Name ABCB1
Transporter Name P-glycoprotein 1
Gene ID
5243
UniProt ID
P08183
Epigenetic Regulations of This DT (ERD)
Epigenetic Phenomenon Hypomethylation of ABCB1 in hematologic malignancies [1]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Related Molecular Changes Up regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Hematologic malignancies [ICD-11: 2B33.Y]
Frequency 56% of the studied samples
Experimental Material Patient tissue samples
Additional Notes MDR1 promoter Hypomethylation conferred its up-regulation and indicated poor prognosis in patients with and without bone marrow transplantation.
Epigenetic Phenomenon Hypomethylation of ABCB1 in invasive ductal breast carcinoma [2]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Related Molecular Changes Up regulation of ABCB1 Experiment Method Immunohistochemistry
Studied Phenotype Invasive ductal breast carcinoma [ICD-11: 2C61.0]
Frequency 47 (47%) out of the 100 studied tumor samples
Experimental Material Patient tissue samples
Additional Notes Breast cancer patients with hypomethylated MDR1 promoter in tumors revealed shorter median overall survival (OS) (median OS = 18 months) as compared to patients having methylated MDR1 promoter.
Epigenetic Phenomenon Hypermethylation of ABCB1 in lung adenocarcinoma [3]
Location Downstream promoter
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Related Molecular Changes Up regulation of ABCB1 Experiment Method Western Blot
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Human lung adenocarcinoma cell line (A549)
Additional Notes Hypermethylation of the ABCB1 gene correlated with increased ABCB1 gene expression and that increased ABCB1 gene expression and methylation were associated with the acquisition of resistance to the cisplatin analogue.
Epigenetic Phenomenon Hypermethylation of ABCB1 in lung adenocarcinoma [3]
Location Downstream promoter
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Related Molecular Changes Up regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Human lung adenocarcinoma cell line (A549)
Additional Notes Hypermethylation of the ABCB1 gene correlated with increased ABCB1 gene expression and that increased ABCB1 gene expression and methylation were associated with the acquisition of resistance to the cisplatin analogue.
Epigenetic Phenomenon Hypomethylation of ABCB1 in cervical cancer [4]
Location Promoter (13 CpG sites)
Epigenetic Type Methylation Experiment Method MALDI-TOF MS
Related Molecular Changes Up regulation of ABCB1 Experiment Method Immunohistochemistry
Studied Phenotype Cervical cancer [ICD-11: 2C77.Z]
Experimental Material Patient tissue samples
Additional Notes The methylation rate of CpG_2, 3, and 4 loci before chemotherapy in patients with effective chemotherapy was higher than patients with ineffective chemotherapy, and there was no difference in the methylation rate among the other CpG loci (P>0.05).
Epigenetic Phenomenon Hypomethylation of ABCB1 in malaria [5]
Location Downstream promoter (+245 to +679 bp)
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Related Molecular Changes Up regulation of ABCB1 Experiment Method Western Blot
Studied Phenotype Malaria [ICD-11: 1F40]
Experimental Material Patient tissue samples
Additional Notes Hypomethylation of downstream promoter region of ABCB1 results higher expression of ABCB1 protein in complicated malarial group.
Epigenetic Phenomenon Hypomethylation of ABCB1 in pancreatic cancer [6]
Location Promoter
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Related Molecular Changes Up regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Pancreatic cancer [ICD-11: 2C10]
Experimental Material Multiple cell lines of human
Additional Notes ABCB1 expression correlated with pancreatic cancer tumorigenesis and drug resistance in a mechanism that is independent of promoter methylation.
Epigenetic Phenomenon Hypermethylation of ABCB1 in adult acute lymphocytic leukemia [7]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Related Molecular Changes Down regulation of ABCB1 Experiment Method Immunohistochemistry
Studied Phenotype Adult acute lymphocytic leukemia [ICD-11: 2A82]
Frequency 16% of the studied tumor samples
Experimental Material Patient tissue samples
Additional Notes There is an excellent correlation between ABCB1 methylation and ABCB1 protein expression.
Epigenetic Phenomenon Hypermethylation of ABCB1 in breast cancer [8]
Location Promoter
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Frequency 70% of the studied tumor samples
Experimental Material Patient tissue samples
Additional Notes Methylation at the ABCB1 promoter improved overall survival probably due to prolonged availability and activity of the drug in the cell.
Epigenetic Phenomenon Hypermethylation of ABCB1 in breast cancer [9]
Location Promoter
Epigenetic Type Methylation Experiment Method Bisulfite pyrosequencing
Related Molecular Changes Down regulation of ABCB1 Experiment Method Microarrays
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Frequency >75% of the studied tumor samples
Experimental Material Patient tissue samples
Additional Notes The ABCB1 promoter was more frequently methylated in tumor tissues than in tumor-adjacent and tumor-distant tissues.
Epigenetic Phenomenon Hypermethylation of ABCB1 in Invasive ductal carcinoma of breast [10]
Location Promoter
Epigenetic Type Methylation Experiment Method Bisulfite pyrosequencing
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-PCR
Studied Phenotype Invasive ductal carcinoma of breast [ICD-11: 2C61.0]
Frequency 40% of the studied tumor samples
Experimental Material Patient tissue samples
Additional Notes DNA methylation levels of ABCB1 was higher in oestrogen receptor (ER) positive vs. ER negative tumours; whereas methylation levels of ABCB1 was lower in tumours with a TP53 mutation.
Epigenetic Phenomenon Hypermethylation of ABCB1 in prostate cancer [11]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Frequency 72% of the studied tumor samples
Experimental Material Patient tissue samples
Additional Notes Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p < 0.001).
Epigenetic Phenomenon Hypermethylation of ABCB1 in breast cancer [12]
Location Promoter (-100 to +500 bp)
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Additional Notes ABCB1 promoter Hypermethylation is association with ABCB1 low expression in MCF-7 cell line.
Epigenetic Phenomenon Hypermethylation of ABCB1 in newborns with tetralogy of fallot [13]
Location cg25477497
Epigenetic Type Methylation Experiment Method HumanMethylation450 BeadChip
Related Molecular Changes Down regulation of ABCB1 Experiment Method GDAC database
Studied Phenotype Newborns with tetralogy of fallot [ICD-11: LA88.2]
Experimental Material Patient tissue samples
Additional Notes ABCB1 is differentially methylated in the blood DNA of newborns with TOF compared with controls.
Epigenetic Phenomenon Hypermethylation of ABCB1 in glioblastoma multiforme [14]
Location Promoter
Epigenetic Type Methylation Experiment Method Bisulfite pyrosequencing
Related Molecular Changes level of ABCB1 Unchanged Experiment Method RT-qPCR
Studied Phenotype Glioblastoma multiforme [ICD-11: 2A00.00]
Experimental Material Patient tissue samples
Additional Notes No association between ABCB1 promoter methylation and ABCB1 expression or overall survival was seen.
Epigenetic Phenomenon Methylation of ABCB1 in atypical teratoid rhabdoid tumor [15]
Location 5'UTR (cg00141548)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.15E+00 Statistic Test p-value: 3.99E-09; Z-score: -1.49E+00
Methylation in Case 6.88E-01 (Median) Methylation in Control 7.91E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in atypical teratoid rhabdoid tumor [15]
Location 5'UTR (cg00862116)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.10E+00 Statistic Test p-value: 6.82E-09; Z-score: -1.38E+00
Methylation in Case 5.18E-01 (Median) Methylation in Control 5.68E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in atypical teratoid rhabdoid tumor [15]
Location 5'UTR (cg04099454)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.28E+00 Statistic Test p-value: 2.59E-08; Z-score: 1.54E+00
Methylation in Case 8.14E-01 (Median) Methylation in Control 6.34E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in atypical teratoid rhabdoid tumor [15]
Location 5'UTR (cg06562372)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 6.25E-08; Z-score: -1.67E+00
Methylation in Case 8.34E-01 (Median) Methylation in Control 8.71E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in atypical teratoid rhabdoid tumor [15]
Location 5'UTR (cg09105881)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.12E+00 Statistic Test p-value: 1.59E-07; Z-score: -1.24E+00
Methylation in Case 7.86E-01 (Median) Methylation in Control 8.82E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in atypical teratoid rhabdoid tumor [15]
Location 5'UTR (cg12270822)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.22E+00 Statistic Test p-value: 3.67E-07; Z-score: 1.01E+00
Methylation in Case 8.66E-01 (Median) Methylation in Control 7.07E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in atypical teratoid rhabdoid tumor [15]
Location 5'UTR (cg15759056)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.54E+00 Statistic Test p-value: 1.59E-06; Z-score: 1.30E+00
Methylation in Case 6.25E-01 (Median) Methylation in Control 4.05E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in atypical teratoid rhabdoid tumor [15]
Location 5'UTR (cg16288248)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.89E+00 Statistic Test p-value: 1.74E-06; Z-score: -1.17E+00
Methylation in Case 1.91E-01 (Median) Methylation in Control 3.61E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in atypical teratoid rhabdoid tumor [15]
Location 5'UTR (cg16772035)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 1.84E-06; Z-score: -9.22E-01
Methylation in Case 8.39E-01 (Median) Methylation in Control 8.89E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in atypical teratoid rhabdoid tumor [15]
Location 5'UTR (cg22899422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.18E+00 Statistic Test p-value: 6.55E-06; Z-score: -6.93E-01
Methylation in Case 5.25E-01 (Median) Methylation in Control 6.18E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in atypical teratoid rhabdoid tumor [15]
Location 5'UTR (cg27507700)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 1.40E-05; Z-score: -9.46E-01
Methylation in Case 7.40E-01 (Median) Methylation in Control 8.08E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location 5'UTR (cg04099454)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -2.25E+00 Statistic Test p-value: 3.97E-11; Z-score: -5.54E+01
Methylation in Case 4.11E-01 (Median) Methylation in Control 9.24E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location 5'UTR (cg22899422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.57E+00 Statistic Test p-value: 1.65E-07; Z-score: -2.74E+01
Methylation in Case 5.21E-01 (Median) Methylation in Control 8.16E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location 5'UTR (cg16772035)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.90E+00 Statistic Test p-value: 1.62E-04; Z-score: 9.95E+00
Methylation in Case 1.39E-01 (Median) Methylation in Control 7.32E-02 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location 5'UTR (cg16288248)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.47E+00 Statistic Test p-value: 6.46E-04; Z-score: 2.76E+00
Methylation in Case 8.15E-02 (Median) Methylation in Control 5.53E-02 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location 5'UTR (cg00141548)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.40E+00 Statistic Test p-value: 8.47E-04; Z-score: 3.64E+00
Methylation in Case 1.64E-01 (Median) Methylation in Control 1.17E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location 5'UTR (cg09105881)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.50E+00 Statistic Test p-value: 1.62E-03; Z-score: 4.85E+00
Methylation in Case 1.38E-01 (Median) Methylation in Control 9.19E-02 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location 5'UTR (cg27507700)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.53E+00 Statistic Test p-value: 2.28E-03; Z-score: 6.16E+00
Methylation in Case 8.75E-02 (Median) Methylation in Control 5.72E-02 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location 5'UTR (cg15759056)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.90E+00 Statistic Test p-value: 4.36E-03; Z-score: 7.20E+00
Methylation in Case 5.76E-02 (Median) Methylation in Control 3.03E-02 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location 5'UTR (cg12270822)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.38E+00 Statistic Test p-value: 5.21E-03; Z-score: 2.21E+00
Methylation in Case 1.23E-01 (Median) Methylation in Control 8.91E-02 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location 5'UTR (cg06562372)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 8.22E-03; Z-score: -2.73E-01
Methylation in Case 1.56E-01 (Median) Methylation in Control 1.58E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location 5'UTR (cg00862116)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.25E+00 Statistic Test p-value: 1.20E-02; Z-score: 1.76E+00
Methylation in Case 9.22E-02 (Median) Methylation in Control 7.35E-02 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location 5'UTR (cg12270822)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.42E+00 Statistic Test p-value: 4.58E-09; Z-score: 1.28E+00
Methylation in Case 1.22E-01 (Median) Methylation in Control 8.60E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location 5'UTR (cg06562372)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.21E+00 Statistic Test p-value: 7.58E-09; Z-score: 1.27E+00
Methylation in Case 1.51E-01 (Median) Methylation in Control 1.25E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location 5'UTR (cg27507700)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.53E+00 Statistic Test p-value: 9.74E-09; Z-score: 1.81E+00
Methylation in Case 8.47E-02 (Median) Methylation in Control 5.54E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location 5'UTR (cg09105881)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.36E+00 Statistic Test p-value: 1.38E-08; Z-score: 1.52E+00
Methylation in Case 1.25E-01 (Median) Methylation in Control 9.21E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location 5'UTR (cg00862116)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.46E+00 Statistic Test p-value: 2.67E-08; Z-score: 1.14E+00
Methylation in Case 9.86E-02 (Median) Methylation in Control 6.76E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location 5'UTR (cg16772035)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.32E+00 Statistic Test p-value: 2.13E-07; Z-score: 1.24E+00
Methylation in Case 8.59E-02 (Median) Methylation in Control 6.50E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location 5'UTR (cg00141548)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.26E+00 Statistic Test p-value: 2.75E-07; Z-score: 1.28E+00
Methylation in Case 1.43E-01 (Median) Methylation in Control 1.13E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location 5'UTR (cg15759056)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.54E+00 Statistic Test p-value: 6.17E-07; Z-score: 1.03E+00
Methylation in Case 4.38E-02 (Median) Methylation in Control 2.86E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location 5'UTR (cg16288248)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.24E+00 Statistic Test p-value: 1.10E-05; Z-score: 8.79E-01
Methylation in Case 6.53E-02 (Median) Methylation in Control 5.24E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location 5'UTR (cg22899422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 8.70E-05; Z-score: -7.35E-01
Methylation in Case 7.48E-01 (Median) Methylation in Control 7.78E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in clear cell renal cell carcinoma [18]
Location 5'UTR (cg00141548)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.58E+00 Statistic Test p-value: 5.64E-04; Z-score: -7.53E-01
Methylation in Case 6.12E-02 (Median) Methylation in Control 9.65E-02 (Median)
Studied Phenotype Clear cell renal cell carcinoma [ICD-11: 2C90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location 5'UTR (cg04099454)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.25E+00 Statistic Test p-value: 2.79E-09; Z-score: -3.46E+00
Methylation in Case 6.58E-01 (Median) Methylation in Control 8.23E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location 5'UTR (cg09105881)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.09E+00 Statistic Test p-value: 1.54E-04; Z-score: 3.66E-01
Methylation in Case 1.27E-01 (Median) Methylation in Control 1.16E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location 5'UTR (cg27507700)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.16E+00 Statistic Test p-value: 1.75E-04; Z-score: 5.19E-01
Methylation in Case 8.79E-02 (Median) Methylation in Control 7.60E-02 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location 5'UTR (cg22899422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 2.19E-04; Z-score: -1.36E+00
Methylation in Case 8.80E-01 (Median) Methylation in Control 9.17E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location 5'UTR (cg06562372)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.12E+00 Statistic Test p-value: 3.39E-04; Z-score: 5.07E-01
Methylation in Case 8.65E-02 (Median) Methylation in Control 7.74E-02 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location 5'UTR (cg12270822)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.07E+00 Statistic Test p-value: 4.08E-04; Z-score: 2.20E-01
Methylation in Case 1.06E-01 (Median) Methylation in Control 9.90E-02 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location 5'UTR (cg00141548)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.21E+00 Statistic Test p-value: 4.10E-04; Z-score: 6.59E-01
Methylation in Case 1.51E-01 (Median) Methylation in Control 1.25E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location 5'UTR (cg16288248)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 2.17E-03; Z-score: -8.40E-02
Methylation in Case 1.07E-01 (Median) Methylation in Control 1.09E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location 5'UTR (cg15759056)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 2.34E-03; Z-score: -1.50E-01
Methylation in Case 2.16E-02 (Median) Methylation in Control 2.34E-02 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location 5'UTR (cg00862116)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 2.73E-03; Z-score: -4.18E-02
Methylation in Case 9.36E-02 (Median) Methylation in Control 9.54E-02 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location 5'UTR (cg16772035)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.01E+00 Statistic Test p-value: 3.28E-03; Z-score: 3.76E-02
Methylation in Case 1.08E-01 (Median) Methylation in Control 1.07E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in depression [20]
Location 5'UTR (cg00862116)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.09E+00 Statistic Test p-value: 4.70E-02; Z-score: 5.25E-01
Methylation in Case 5.23E-02 (Median) Methylation in Control 4.80E-02 (Median)
Studied Phenotype Depression [ICD-11: 6A8Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location 5'UTR (cg00141548)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.20E+00 Statistic Test p-value: 1.21E-07; Z-score: -1.16E+00
Methylation in Case 9.07E-02 (Median) Methylation in Control 1.09E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location 5'UTR (cg12270822)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.12E+00 Statistic Test p-value: 8.63E-04; Z-score: -5.36E-01
Methylation in Case 6.11E-02 (Median) Methylation in Control 6.86E-02 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location 5'UTR (cg27507700)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.13E+00 Statistic Test p-value: 2.34E-03; Z-score: -8.69E-01
Methylation in Case 5.26E-02 (Median) Methylation in Control 5.92E-02 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location 5'UTR (cg00862116)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.15E+00 Statistic Test p-value: 2.53E-03; Z-score: -4.81E-01
Methylation in Case 5.88E-02 (Median) Methylation in Control 6.78E-02 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location 5'UTR (cg04099454)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 4.73E-03; Z-score: -1.96E-01
Methylation in Case 8.50E-01 (Median) Methylation in Control 8.74E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location 5'UTR (cg22899422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 3.59E-02; Z-score: -1.66E-01
Methylation in Case 8.09E-01 (Median) Methylation in Control 8.15E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in HIV infection [22]
Location 5'UTR (cg00862116)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.30E+00 Statistic Test p-value: 6.15E-05; Z-score: 1.14E+00
Methylation in Case 5.53E-02 (Median) Methylation in Control 4.25E-02 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in HIV infection [22]
Location 5'UTR (cg16772035)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.31E+00 Statistic Test p-value: 5.48E-03; Z-score: 1.64E+00
Methylation in Case 8.79E-02 (Median) Methylation in Control 6.73E-02 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in HIV infection [22]
Location 5'UTR (cg22899422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 3.31E-02; Z-score: -9.71E-01
Methylation in Case 9.07E-01 (Median) Methylation in Control 9.28E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in HIV infection [22]
Location 5'UTR (cg09105881)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.11E+00 Statistic Test p-value: 4.24E-02; Z-score: 6.62E-01
Methylation in Case 9.70E-02 (Median) Methylation in Control 8.75E-02 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in HIV infection [22]
Location 5'UTR (cg15759056)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.79E+00 Statistic Test p-value: 4.30E-02; Z-score: 8.28E-01
Methylation in Case 9.18E-03 (Median) Methylation in Control 5.12E-03 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in lung adenocarcinoma [23]
Location 5'UTR (cg15759056)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.89E+00 Statistic Test p-value: 2.88E-02; Z-score: 4.86E+00
Methylation in Case 8.57E-02 (Median) Methylation in Control 4.54E-02 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in lung adenocarcinoma [23]
Location 5'UTR (cg22899422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 3.19E-02; Z-score: -1.46E+00
Methylation in Case 7.95E-01 (Median) Methylation in Control 8.29E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in lung adenocarcinoma [23]
Location 5'UTR (cg00862116)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.59E+00 Statistic Test p-value: 3.57E-02; Z-score: 7.32E+00
Methylation in Case 2.08E-01 (Median) Methylation in Control 1.31E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in lung adenocarcinoma [23]
Location 5'UTR (cg12270822)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 2.32E+00 Statistic Test p-value: 3.65E-02; Z-score: 1.85E+00
Methylation in Case 2.59E-01 (Median) Methylation in Control 1.12E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in lung adenocarcinoma [23]
Location 5'UTR (cg09105881)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.31E+00 Statistic Test p-value: 4.17E-02; Z-score: 3.36E+00
Methylation in Case 1.85E-01 (Median) Methylation in Control 1.42E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in pancretic ductal adenocarcinoma [24]
Location 5'UTR (cg13765368)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.49E+00 Statistic Test p-value: 3.85E-15; Z-score: 2.17E+00
Methylation in Case 1.26E-01 (Median) Methylation in Control 8.46E-02 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in panic disorder [25]
Location 5'UTR (cg04099454)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.33E+00 Statistic Test p-value: 1.67E-02; Z-score: -4.72E-01
Methylation in Case 5.42E-01 (Median) Methylation in Control 7.22E-01 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in panic disorder [25]
Location 5'UTR (cg22899422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.11E+00 Statistic Test p-value: 4.18E-02; Z-score: -3.26E-01
Methylation in Case 1.08E+00 (Median) Methylation in Control 1.20E+00 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in papillary thyroid cancer [26]
Location 5'UTR (cg22899422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.05E+00 Statistic Test p-value: 4.89E-08; Z-score: -1.58E+00
Methylation in Case 8.63E-01 (Median) Methylation in Control 9.05E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in papillary thyroid cancer [26]
Location 5'UTR (cg16772035)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.20E+00 Statistic Test p-value: 4.41E-03; Z-score: 7.40E-01
Methylation in Case 8.02E-02 (Median) Methylation in Control 6.70E-02 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in papillary thyroid cancer [26]
Location 5'UTR (cg09105881)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.08E+00 Statistic Test p-value: 3.23E-02; Z-score: 4.29E-01
Methylation in Case 9.18E-02 (Median) Methylation in Control 8.54E-02 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in systemic lupus erythematosus [27]
Location 5'UTR (cg22899422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 4.14E-02; Z-score: -2.60E-01
Methylation in Case 8.92E-01 (Median) Methylation in Control 9.02E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location TSS1500 (cg13362272)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.18E+00 Statistic Test p-value: 6.67E-11; Z-score: -4.26E+00
Methylation in Case 7.56E-01 (Median) Methylation in Control 8.94E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location TSS1500 (cg20038225)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.18E+00 Statistic Test p-value: 7.98E-11; Z-score: -3.31E+00
Methylation in Case 6.83E-01 (Median) Methylation in Control 8.05E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in pancretic ductal adenocarcinoma [24]
Location TSS1500 (cg23099740)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.09E+00 Statistic Test p-value: 2.70E-09; Z-score: 1.36E+00
Methylation in Case 6.57E-01 (Median) Methylation in Control 6.05E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in pancretic ductal adenocarcinoma [24]
Location TSS1500 (cg10017118)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.03E+00 Statistic Test p-value: 2.43E-02; Z-score: 3.37E-01
Methylation in Case 5.79E-01 (Median) Methylation in Control 5.62E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in prostate cancer [28]
Location TSS1500 (cg22844229)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.82E+00 Statistic Test p-value: 1.43E-02; Z-score: -1.77E+00
Methylation in Case 2.42E-01 (Median) Methylation in Control 4.40E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in prostate cancer [28]
Location TSS1500 (cg22117918)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.46E+00 Statistic Test p-value: 3.71E-02; Z-score: -4.52E+00
Methylation in Case 1.69E-01 (Median) Methylation in Control 2.48E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in prostate cancer [28]
Location TSS1500 (cg02322908)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.75E+00 Statistic Test p-value: 4.52E-02; Z-score: 4.67E+00
Methylation in Case 2.28E-01 (Median) Methylation in Control 1.30E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in pancretic ductal adenocarcinoma [24]
Location TSS200 (cg11960629)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 2.10E+00 Statistic Test p-value: 1.05E-20; Z-score: 3.72E+00
Methylation in Case 1.82E-01 (Median) Methylation in Control 8.65E-02 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in pancretic ductal adenocarcinoma [24]
Location TSS200 (cg08074851)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 2.79E+00 Statistic Test p-value: 2.91E-18; Z-score: 3.35E+00
Methylation in Case 3.99E-01 (Median) Methylation in Control 1.43E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in pancretic ductal adenocarcinoma [24]
Location TSS200 (cg13052102)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.06E+00 Statistic Test p-value: 2.11E-02; Z-score: 2.83E-01
Methylation in Case 5.30E-02 (Median) Methylation in Control 5.02E-02 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location 1stExon (cg12501142)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.16E+00 Statistic Test p-value: 2.97E-10; Z-score: -5.15E+00
Methylation in Case 7.32E-01 (Median) Methylation in Control 8.50E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in atypical teratoid rhabdoid tumor [15]
Location Body (cg14319793)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 4.49E-02; Z-score: -3.72E-01
Methylation in Case 9.01E-01 (Median) Methylation in Control 9.29E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location Body (cg14319793)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.26E+00 Statistic Test p-value: 1.29E-06; Z-score: -6.15E+00
Methylation in Case 6.92E-01 (Median) Methylation in Control 8.73E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location Body (cg19861260)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.91E+00 Statistic Test p-value: 8.55E-06; Z-score: -8.13E+00
Methylation in Case 2.33E-01 (Median) Methylation in Control 4.45E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location Body (cg24138422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.14E+00 Statistic Test p-value: 2.26E-03; Z-score: -6.38E+00
Methylation in Case 7.15E-01 (Median) Methylation in Control 8.17E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location Body (cg25477497)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.17E+00 Statistic Test p-value: 9.48E-03; Z-score: -2.09E+00
Methylation in Case 5.29E-01 (Median) Methylation in Control 6.20E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in bladder cancer [16]
Location Body (cg23479988)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.05E+00 Statistic Test p-value: 1.18E-02; Z-score: -1.76E+00
Methylation in Case 7.49E-01 (Median) Methylation in Control 7.90E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location Body (cg19861260)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.56E+00 Statistic Test p-value: 1.35E-12; Z-score: -2.40E+00
Methylation in Case 4.10E-01 (Median) Methylation in Control 6.39E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location Body (cg14319793)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.11E+00 Statistic Test p-value: 1.08E-08; Z-score: -1.80E+00
Methylation in Case 7.58E-01 (Median) Methylation in Control 8.40E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location Body (cg25477497)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.15E+00 Statistic Test p-value: 7.48E-05; Z-score: -9.95E-01
Methylation in Case 5.40E-01 (Median) Methylation in Control 6.21E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location Body (cg24138422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 4.42E-02; Z-score: -3.26E-01
Methylation in Case 8.09E-01 (Median) Methylation in Control 8.53E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in breast cancer [17]
Location Body (cg23479988)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 4.87E-02; Z-score: -5.53E-01
Methylation in Case 7.74E-01 (Median) Methylation in Control 8.41E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in clear cell renal cell carcinoma [18]
Location Body (cg25477497)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.24E+00 Statistic Test p-value: 3.97E-04; Z-score: -2.29E+00
Methylation in Case 4.99E-01 (Median) Methylation in Control 6.19E-01 (Median)
Studied Phenotype Clear cell renal cell carcinoma [ICD-11: 2C90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in clear cell renal cell carcinoma [18]
Location Body (cg19861260)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.39E+00 Statistic Test p-value: 4.16E-03; Z-score: -1.64E+00
Methylation in Case 3.36E-01 (Median) Methylation in Control 4.69E-01 (Median)
Studied Phenotype Clear cell renal cell carcinoma [ICD-11: 2C90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colon adenocarcinoma [29]
Location Body (cg24474319)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.16E+00 Statistic Test p-value: 9.45E-05; Z-score: -2.54E+00
Methylation in Case 4.82E-01 (Median) Methylation in Control 5.60E-01 (Median)
Studied Phenotype Colon adenocarcinoma [ICD-11: 2B90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colon adenocarcinoma [29]
Location Body (cg10860553)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.24E+00 Statistic Test p-value: 1.26E-04; Z-score: -3.46E+00
Methylation in Case 4.74E-01 (Median) Methylation in Control 5.89E-01 (Median)
Studied Phenotype Colon adenocarcinoma [ICD-11: 2B90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colon adenocarcinoma [29]
Location Body (cg16793755)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.15E+00 Statistic Test p-value: 6.76E-04; Z-score: -2.17E+00
Methylation in Case 6.13E-01 (Median) Methylation in Control 7.07E-01 (Median)
Studied Phenotype Colon adenocarcinoma [ICD-11: 2B90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location Body (cg25477497)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.80E+00 Statistic Test p-value: 2.90E-08; Z-score: -2.04E+00
Methylation in Case 4.10E-01 (Median) Methylation in Control 7.37E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location Body (cg19861260)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.96E+00 Statistic Test p-value: 6.91E-06; Z-score: -1.70E+00
Methylation in Case 2.34E-01 (Median) Methylation in Control 4.59E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location Body (cg23479988)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 3.57E-04; Z-score: -1.53E+00
Methylation in Case 8.75E-01 (Median) Methylation in Control 9.10E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in colorectal cancer [19]
Location Body (cg24138422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 6.68E-03; Z-score: -1.71E-01
Methylation in Case 9.21E-01 (Median) Methylation in Control 9.25E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location Body (cg23260105)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.19E+00 Statistic Test p-value: 3.23E-11; Z-score: -1.15E+01
Methylation in Case 8.18E-01 (Median) Methylation in Control 9.75E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location Body (cg25477497)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.30E+00 Statistic Test p-value: 1.15E-04; Z-score: -1.05E+00
Methylation in Case 2.27E-01 (Median) Methylation in Control 2.95E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location Body (cg19861260)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.40E+00 Statistic Test p-value: 7.57E-04; Z-score: -1.41E+00
Methylation in Case 1.65E-01 (Median) Methylation in Control 2.31E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in HIV infection [22]
Location Body (cg24138422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.03E+00 Statistic Test p-value: 3.40E-05; Z-score: 9.93E-01
Methylation in Case 9.20E-01 (Median) Methylation in Control 8.96E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in HIV infection [22]
Location Body (cg25477497)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.27E+00 Statistic Test p-value: 1.76E-04; Z-score: 1.20E+00
Methylation in Case 8.33E-02 (Median) Methylation in Control 6.55E-02 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in HIV infection [22]
Location Body (cg19861260)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.39E+00 Statistic Test p-value: 3.60E-03; Z-score: 1.13E+00
Methylation in Case 1.27E-01 (Median) Methylation in Control 9.12E-02 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in HIV infection [22]
Location Body (cg14319793)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 1.18E-02; Z-score: -5.41E-01
Methylation in Case 9.09E-01 (Median) Methylation in Control 9.36E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in pancretic ductal adenocarcinoma [24]
Location Body (cg24334149)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.24E+00 Statistic Test p-value: 3.97E-07; Z-score: -1.56E+00
Methylation in Case 4.58E-01 (Median) Methylation in Control 5.70E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in pancretic ductal adenocarcinoma [24]
Location Body (cg05207973)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.10E+00 Statistic Test p-value: 5.44E-07; Z-score: 8.56E-01
Methylation in Case 6.96E-01 (Median) Methylation in Control 6.32E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in panic disorder [25]
Location Body (cg25477497)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 8.60E-01 Statistic Test p-value: 2.38E-06; Z-score: 8.27E-01
Methylation in Case -2.53E+00 (Median) Methylation in Control -2.94E+00 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in panic disorder [25]
Location Body (cg24138422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.91E+00 Statistic Test p-value: 2.54E-04; Z-score: -8.53E-01
Methylation in Case 5.17E-01 (Median) Methylation in Control 9.85E-01 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in panic disorder [25]
Location Body (cg23479988)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -6.21E-01 Statistic Test p-value: 3.15E-02; Z-score: -4.69E-01
Methylation in Case -4.38E-01 (Median) Methylation in Control -2.72E-01 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in papillary thyroid cancer [26]
Location Body (cg25477497)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 4.92E-03; Z-score: -4.57E-01
Methylation in Case 8.08E-01 (Median) Methylation in Control 8.42E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in prostate cancer [28]
Location Body (cg16614288)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.23E+00 Statistic Test p-value: 3.88E-02; Z-score: 1.81E+00
Methylation in Case 8.33E-01 (Median) Methylation in Control 6.78E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in prostate cancer [28]
Location Body (cg27005847)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.33E+00 Statistic Test p-value: 4.00E-02; Z-score: -1.52E+00
Methylation in Case 4.31E-01 (Median) Methylation in Control 5.73E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in prostate cancer [28]
Location Body (cg16374080)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.09E+00 Statistic Test p-value: 4.14E-02; Z-score: 1.64E+00
Methylation in Case 8.63E-01 (Median) Methylation in Control 7.90E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in systemic lupus erythematosus [27]
Location Body (cg25477497)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.07E+00 Statistic Test p-value: 2.74E-02; Z-score: 1.95E-01
Methylation in Case 9.84E-02 (Median) Methylation in Control 9.23E-02 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in systemic lupus erythematosus [27]
Location Body (cg24138422)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 4.61E-02; Z-score: -1.99E-01
Methylation in Case 9.15E-01 (Median) Methylation in Control 9.20E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in hepatocellular carcinoma [21]
Location 3'UTR (cg23533270)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.45E+00 Statistic Test p-value: 1.26E-11; Z-score: -1.65E+00
Methylation in Case 4.39E-01 (Median) Methylation in Control 6.37E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB1 in prostate cancer [28]
Location 3'UTR (cg24042313)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.48E+00 Statistic Test p-value: 4.03E-02; Z-score: 6.93E+00
Methylation in Case 6.32E-01 (Median) Methylation in Control 4.26E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Hypoacetylation of ABCB1 in acute myeloid leukemia (compare with valproate-treatment counterpart AML cells) [30]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Acute myeloid leukemia [ICD-11: 2A60]
Experimental Material Multiple cell lines of human
Additional Notes Chromatin immunoprecipitation revealed the hyperacetylation of histone proteins in the promoter regions of MDR1 on valproate treatment.
Epigenetic Phenomenon Hypoacetylation of ABCB1 in AML (compare with valproate treatment counterpart cells) [30]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCB1 Experiment Method Western Blot
Studied Phenotype Acute myeloid leukemia [ICD-11: 2A60]
Experimental Material Multiple cell lines of human
Additional Notes Hyperacetylation of histone proteins in the promoter regions of MDR1 on valproate treatment.
Epigenetic Phenomenon Hypoacetylation of ABCB1 in breast cancer (compare with doxorubicin-resistant counterpart cells) [31]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Multiple cell lines of human
Additional Notes Elevated level of lysine 9-acetylated histone H3 at the MDR1 promoter in doxorubicinresistant MCF-7 cells.
Epigenetic Phenomenon Hypoacetylation of ABCB1 in lymphoid tumour (compare with etoposide-resistant counterpart cells) [32]
Location Exon 1
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Lymphoma [ICD-11: 2A80]
Experimental Material Multiple cell lines of human
Additional Notes Histone H3 acetylation in the same CpG island was significantly increased in drug-resistant cell line.
Epigenetic Phenomenon Hypoacetylation of ABCB1 in sarcoma (compare with multidrug-resistant counterpart cells) [33]
Location 968 bp upstream of exon 1
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Sarcoma [ICD-11: 2A60.39]
Experimental Material Multiple cell lines of human
Additional Notes The chromatin structure of the ABCB1 upstream promoter is changed via acetylation of histone H3 initiating ABCB1 activation.
Epigenetic Phenomenon Hypoacetylation of ABCB1 in SCLC (compare with etoposide-resistant counterpart cells) [34]
Location Distal promoter (-981 to -817)
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Small cell lung cancer [ICD-11: 2C25.1]
Experimental Material Human small cell lung carcinoma cell line (H69)
Additional Notes High acetylation level of histone H3 of ABCB1 in etoposide-resistant small cell lung carcinoma associated with higher ABCB1 expression.
Epigenetic Phenomenon Hypoacetylation of ABCB1 in SCLC (compare with etoposide-resistant counterpart cells) [34]
Location Promoter (-981 to -817 and -222 to +37)
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Small cell lung cancer [ICD-11: 2C25.1]
Experimental Material Multiple cell lines of human
Additional Notes TSA induces downregulation of ABCB1 expression in drug-resistant SCLC cell line, independently of promoter methylation, and MBD1 or PCAF recruitment.
Epigenetic Phenomenon Hypoacetylation of ABCB1 in SCLC (compare with etoposide-resistant counterpart cells) [34]
Location Promoter (-981 to -817 and -222 to +37)
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Small cell lung cancer [ICD-11: 2C25.1]
Experimental Material Multiple cell lines of human
Additional Notes TSA induces downregulation of ABCB1 expression in drug-resistant SCLC cell line, independently of promoter methylation, and MBD1 or PCAF recruitment.
Epigenetic Phenomenon Hypoacetylation of ABCB1 in SCLC (compare with etoposide-resistant counterpart cells) [34]
Location Proximal promoter (+292 to +591)
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Small cell lung cancer [ICD-11: 2C25.1]
Experimental Material Human small cell lung carcinoma cell line (H69)
Additional Notes High acetylation level of histone H3 of ABCB1 in etoposide-resistant small cell lung carcinoma associated with higher ABCB1 expression.
Epigenetic Phenomenon Hypoacetylation of ABCB1 in SCLC (compare with etoposide-resistant counterpart cells) [34]
Location Proximal promoter (+292 to +591)
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Small cell lung cancer [ICD-11: 2C25.1]
Experimental Material Human small cell lung carcinoma cell line (H69)
Additional Notes High acetylation level of histone H4 of ABCB1 in etoposide-resistant small cell lung carcinoma associated with higher ABCB1 expression.
Epigenetic Phenomenon Hypoacetylation of ABCB1 in promyeloblastic leukemia (compare with valproate-treatment counterpart AML cells) [35]
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
Studied Phenotype Promyeloblastic leukemia [ICD-11: 2A60.0]
Experimental Material Human leukemia stem cell-like cell line (KG-1a)
Additional Notes Exposure of promyeloblastic leukemia cells for 24 h to 2 mM of the weak histone deacetylase inhibitor phenylbutyrate resulted in enhanced and marked expression of P-glycoprotein.
Epigenetic Phenomenon Higher expression of miR-129-5p in gastric cancer (compare with cisplatin-resistant counterpart cells) [36]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCB1 Experiment Method Western Blot
miRNA Stemloop ID miR-129 miRNA Mature ID miR-129-5p
miRNA Sequence CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type Direct
Studied Phenotype Gastric cancer [ICD-11: 2B72]
Experimental Material Patient tissue samples
Additional Notes miR-129 enhances chemosensitivity to cisplatin by suppressing P-gp protein in GC cells.
Epigenetic Phenomenon Higher expression of miR-137 in breast cancer (compare with multidrug-resistant counterpart cells) [37]
Epigenetic Type microRNA Experiment Method Dual-luciferase reporter assay
Related Molecular Changes Down regulation of ABCB1 Experiment Method Western Blot
miRNA Stemloop ID miR-137 miRNA Mature ID Unclear
miRNA Target Type Indirect(YB-1;ABCB1)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Additional Notes miR-137 was involved in MDR in cancer through modulation of P-gp by targeting YB-1.
Epigenetic Phenomenon Higher expression of miR-186 in ovarian cancer (compare with cisplatin-resistant counterpart cells) [38]
Epigenetic Type microRNA Experiment Method Dual-luciferase reporter assay
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
miRNA Stemloop ID miR-186 miRNA Mature ID miR-186-5p
miRNA Sequence CAAAGAAUUCUCCUUUUGGGCU
miRNA Target Type Direct
Studied Phenotype Ovarian cancer [ICD-11: 2C73]
Experimental Material Multiple cell lines of human
Additional Notes miR-186 overexpression may increase the sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1.
Epigenetic Phenomenon Higher expression of miR-186 in ovarian cancer (compare with cisplatin-resistant counterpart cells) [38]
Epigenetic Type microRNA Experiment Method Dual-luciferase reporter assay
Related Molecular Changes Down regulation of ABCB1 Experiment Method Western Blot
miRNA Stemloop ID miR-186 miRNA Mature ID miR-186-5p
miRNA Sequence CAAAGAAUUCUCCUUUUGGGCU
miRNA Target Type Direct
Studied Phenotype Ovarian cancer [ICD-11: 2C73]
Experimental Material Multiple cell lines of human
Additional Notes miR-186 overexpression may increase the sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1.
Epigenetic Phenomenon Higher expression of miR-214 in CML (compare with imatinib mesylate resistant counterpart cells) [39]
Epigenetic Type microRNA Experiment Method Dual-luciferase reporter assay
Related Molecular Changes Down regulation of ABCB1 Experiment Method Western Blot
miRNA Stemloop ID miR-214 miRNA Mature ID miR-214-5p
miRNA Sequence UGCCUGUCUACACUUGCUGUGC
miRNA Target Type Direct
Studied Phenotype Chronic myeloid leukemia [ICD-11: 2B33.1]
Experimental Material Patient tissue samples
Additional Notes Decreased expression of microRNA-214 contributes to imatinib mesylate resistance of chronic myeloid leukemia patients by upregulating ABCB1 gene expression.
Epigenetic Phenomenon Higher expression of miR-223 in HCC (compare with multidrug resistance counterpart cells) [40]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCB1 Experiment Method Western Blot
miRNA Stemloop ID miR-223 miRNA Mature ID miR-223-3p
miRNA Sequence UGUCAGUUUGUCAAAUACCCCA
miRNA Target Type Direct
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Multiple cell lines of human
Additional Notes miR-223 modulates multidrug resistance via downregulation of ABCB1 in hepatocellular carcinoma cells
Epigenetic Phenomenon Higher expression of miR-508-5p in gastric cancer (compare to multidrug resistance counterpart cells) [41]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCB1 Experiment Method Western Blot
miRNA Stemloop ID miR-508 miRNA Mature ID miR-508-5p
miRNA Sequence UACUCCAGAGGGCGUCACUCAUG
miRNA Target Type Direct
Studied Phenotype Gastric cancer [ICD-11: 2B72]
Experimental Material Multiple cell lines of human
Additional Notes By targeting ABCB1 and ZNRD1, miR-508-5p overexpression decreases the intracellular concentration of chemotherapeutics and promotes drug-induced apoptosis in MDR gastric cancer cells.
Epigenetic Phenomenon Higher expression of miR-9 in CML (compare with adriamycin resistant counterpart cells) [42]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCB1 Experiment Method Western Blot
miRNA Stemloop ID miR-9 miRNA Mature ID miR-9-3p
miRNA Sequence AUAAAGCUAGAUAACCGAAAGU
miRNA Target Type Direct
Studied Phenotype Chronic myeloid leukemia [ICD-11: 2B33.1]
Experimental Material Patient tissue samples, Multiple cell lines of human
Additional Notes miR-9 and P-glycoprotein (P-gp) had a negative correlation in the CML patients, and the expression of miR-9 was increased in the CML.
Epigenetic Phenomenon Lower expression of miR-491-3p in colorectal cancer (compare to atorvastatin treatment cells) [43]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCB1 Experiment Method RT-qPCR
miRNA Stemloop ID miR-491 miRNA Mature ID miR-491-3p
miRNA Sequence CUUAUGCAAGAUUCCCUUCUAC
miRNA Target Type Direct
Studied Phenotype Colorectal adenocarcinoma [ICD-11: 2B91.0]
Experimental Material Human epithelial colorectal adenocarcinoma cell line(Caco-2)
Additional Notes Atorvastatin attenuation of ABCB1 expression is mediated by microRNA miR-491-3p in Caco-2 cells.
Epigenetic Phenomenon miR-1-3p downregulates of ABCB1 in acute myeloid leukemia [44]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCB1 Experiment Method Western Blot
miRNA Stemloop ID miR-1 miRNA Mature ID miR-1-3p
miRNA Sequence UGGAAUGUAAAGAAGUAUGUAU
miRNA Target Type Direct
Studied Phenotype Acute myeloid leukemia [ICD-11: 2A60]
Experimental Material Multiple cell lines of human
Additional Notes PI3K/mTOR dual inhibitor BEZ235 effectively chemosensitizes AML cells via increasing miR-1-3p and subsequently down-regulating BAG4, EDN1 and ABCB1.
Epigenetic Phenomenon miR-129-5p downregulates of ABCB1 in gastric cancer [45]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCB1 Experiment Method Western Blot
miRNA Stemloop ID miR-129 miRNA Mature ID miR-129-5p
miRNA Sequence CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type Direct
Studied Phenotype Gastric cancer [ICD-11: 2B72]
Experimental Material Human gastric adenocarcinoma cell line (SGC7901)
Additional Notes miR-129-5p reduces ABCB1 expression in vivo at the post-transcriptional level.
Epigenetic Phenomenon Hypermethylation of ABCB1 in adult acute myeloid leukemia [46]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-sensitive melting curve analysis
Studied Phenotype Adult acute myeloid leukemia [ICD-11: 2A60]
Frequency 11 (4%) out of the 287 studied tumor samples
Experimental Material Patient tissue samples
Additional Notes There is a difference of methylation of ABCB1 between childhood and adult AML.
Epigenetic Phenomenon Hypermethylation of ABCB1 in childhood acute myeloid leukemia [46]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-sensitive melting curve analysis
Studied Phenotype Childhood acute myeloid leukemia [ICD-11: 2A60]
Frequency 5 (8%) out of the 66 studied tumor samples
Experimental Material Patient tissue samples
Additional Notes No significant impact on prognosis was seen for promoter Hypermethylation in ABCB1.
Epigenetic Phenomenon Hypermethylation of ABCB1 in colorectal cancer [47]
Location Promoter
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Frequency 69% of the studied tumor samples
Experimental Material Korean patient tissue samples
Additional Notes The Hypermethylation of ABCB1 in cancer tissues was not significantly associated with any clinical parameters.
Epigenetic Phenomenon Hypermethylation of ABCB1 in gastric carcinogenesis [48]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Studied Phenotype Gastric cancer [ICD-11: 2B72]
Frequency 31% of the studied tumor samples
Experimental Material Patient tissue samples
Additional Notes The methylation ratio (MR) of the cancer lesions (31.3 +/- 20.5) was significantly higher than that of non non-neoplastic mucosa (20.9 +/- 31.3, p = 0.0004).
Epigenetic Phenomenon Hypermethylation of ABCB1 in non-small cell lung cancer [49]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Studied Phenotype Non-small cell lung cancer [ICD-11: 2C25]
Frequency 31 (24%) out of the 124 studied tumor samples
Experimental Material Chinese patient tissue samples
Additional Notes The frequency of methylation of ABCB1 is disparity between the mainland of China and the United States in the NSCLC populations.
Epigenetic Phenomenon Hypomethylation of ABCB1 in intracranial artery stenosis [50]
Location Promoter
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Studied Phenotype Intracranial artery stenosis [ICD-11: BD55]
Experimental Material Chinese patient tissue samples
Additional Notes ABCB1 promoter methylation is association with aspirin exposure, platelet function, and clinical outcomes in Chinese intracranial artery stenosis patients.
Epigenetic Phenomenon miR-1 directly targets ABCB1 [44]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay//qRT-PCR
miRNA Stemloop ID miR-1 miRNA Mature ID miR-1-3p
miRNA Sequence UGGAAUGUAAAGAAGUAUGUAU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-129 directly targets ABCB1 [36]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay//qRT-PCR//Western blot
miRNA Stemloop ID miR-129 miRNA Mature ID miR-129-5p
miRNA Sequence CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type Direct
Experimental Material Patient tissue samples
Epigenetic Phenomenon miR-186 directly targets ABCB1 [38]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
miRNA Stemloop ID miR-186 miRNA Mature ID miR-186-5p
miRNA Sequence CAAAGAAUUCUCCUUUUGGGCU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-223 directly targets ABCB1 [40]
Epigenetic Type microRNA Experiment Method GFP reporter assay//qRT-PCR//Western blot
miRNA Stemloop ID miR-223 miRNA Mature ID miR-223-3p
miRNA Sequence UGUCAGUUUGUCAAAUACCCCA
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-491 directly targets ABCB1 [43]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay//qRT-PCR//Western blot
miRNA Stemloop ID miR-491 miRNA Mature ID miR-491-3p
miRNA Sequence CUUAUGCAAGAUUCCCUUCUAC
miRNA Target Type Direct
Experimental Material Human epithelial colorectal adenocarcinoma cell line(Caco-2)
Epigenetic Phenomenon miR-508 directly targets ABCB1 [41]
Epigenetic Type microRNA Experiment Method Immunohistochemistry//In situ hybridization//Luciferase reporter assay//Microarray//qRT-PCR//Western blot
miRNA Stemloop ID miR-508 miRNA Mature ID miR-508-5p
miRNA Sequence UACUCCAGAGGGCGUCACUCAUG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-9 directly targets ABCB1 [42]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
miRNA Stemloop ID miR-9 miRNA Mature ID miR-9-3p
miRNA Sequence AUAAAGCUAGAUAACCGAAAGU
miRNA Target Type Direct
Experimental Material Patient tissue samples, Multiple cell lines of human
References
1 Up-regulation of ABCB1/P-glycoprotein by escaping promoter hypermethylation indicates poor prognosis in hematologic malignancy patients with and without bone marrow transplantation. Leuk Res. 2011 Jan;35(1):73-9.
2 CpG hypomethylation of MDR1 gene in tumor and serum of invasive ductal breast carcinoma patients. Clin Biochem. 2010 Mar;43(4-5):373-9.
3 Hypermethylation of ATP-binding cassette B1 (ABCB1) multidrug resistance 1 (MDR1) is associated with cisplatin resistance in the A549 lung adenocarcinoma cell line. Int J Exp Pathol. 2016 Dec;97(6):412-421.
4 Influence of MDR1 methylation on the curative effect of interventional embolism chemotherapy for cervical cancer. Ther Clin Risk Manag. 2016 Feb 15;12:217-23.
5 Genetic and epigenetic changes in host ABCB1 influences malaria susceptibility to Plasmodium falciparum. PLoS One. 2017 Apr 19;12(4):e0175702.
6 Expression and promoter methylation analysis of ATP-binding cassette genes in pancreatic cancer. Oncol Rep. 2012 Jan;27(1):265-9.
7 DNA methylation patterns at relapse in adult acute lymphocytic leukemia. Clin Cancer Res. 2002 Jun;8(6):1897-903.
8 DNA methylation profiling in doxorubicin treated primary locally advanced breast tumours identifies novel genes associated with survival and treatment response. Mol Cancer. 2010 Mar 25;9:68.
9 Promoter methylation patterns of ABCB1, ABCC1 and ABCG2 in human cancer cell lines, multidrug-resistant cell models and tumor, tumor-adjacent and tumor-distant tissues from breast cancer patients. Oncotarget. 2016 Nov 8;7(45):73347-73369.
10 Frequent aberrant DNA methylation of ABCB1, FOXC1, PPP2R2B and PTEN in ductal carcinoma in situ and early invasive breast cancer. Breast Cancer Res. 2010;12(1):R3.
11 Frequent down-regulation of ABC transporter genes in prostate cancer. BMC Cancer. 2015 Oct 12;15:683.
12 MDR1 promoter hypermethylation in MCF-7 human breast cancer cells: changes in chromatin structure induced by treatment with 5-Aza-cytidine. Cancer Biol Ther. 2004 Jun;3(6):540-8.
13 Newborn blood DNA epigenetic variations and signaling pathway genes associated with Tetralogy of Fallot (TOF). PLoS One. 2018 Sep 13;13(9):e0203893.
14 Epigenetic modulation of the drug resistance genes MGMT, ABCB1 and ABCG2 in glioblastoma multiforme. BMC Cancer. 2013 Dec 31;13:617.
15 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
16 DNA Methylation Dynamics in Urological Tumors.
17 Genome-wide Scan for Methylation Profiles in Breast Cancer
18 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
19 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
20 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
21 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
22 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
23 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
24 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
25 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
26 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
27 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
28 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
29 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
30 Histone deacetylase inhibitors induce a very broad, pleiotropic anticancer drug resistance phenotype in acute myeloid leukemia cells by modulation of multiple ABC transporter genes. Clin Cancer Res. 2009 Jun 1;15(11):3705-15.
31 Elevated level of lysine 9-acetylated histone H3 at the MDR1 promoter in multidrug-resistant cells. Cancer Sci. 2012 Apr;103(4):659-69.
32 Epigenetic regulation of the ABCB1 gene in drug-sensitive and drug-resistant lymphoid tumour cell lines obtained from canine patients. Vet J. 2014 Jan;199(1):103-9.
33 Genetic and epigenetic modeling of the origins of multidrug-resistant cells in a human sarcoma cell line. Cancer Res. 2005 Oct 15;65(20):9388-97.
34 The histone deacetylase inhibitor trichostatin A downregulates human MDR1 (ABCB1) gene expression by a transcription-dependent mechanism in a drug-resistant small cell lung carcinoma cell line model. Br J Cancer. 2007 Aug 20;97(4):562-73.
35 Salinomycin overcomes ABC transporter-mediated multidrug and apoptosis resistance in human leukemia stem cell-like KG-1a cells. Biochem Biophys Res Commun. 2010 Apr 16;394(4):1098-104.
36 MiR-129 regulates cisplatin-resistance in human gastric cancer cells by targeting P-gp. Biomed Pharmacother. 2017 Feb;86:450-456.
37 miR-137 restoration sensitizes multidrug-resistant MCF-7/ADM cells to anticancer agents by targeting YB-1. Acta Biochim Biophys Sin (Shanghai). 2013 Feb;45(2):80-6.
38 MicroRNA-186 induces sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1. J Ovarian Res. 2015 Dec 2;8:80.
39 Decreased expression of microRNA-214 contributes to imatinib mesylate resistance of chronic myeloid leukemia patients by upregulating ABCB1 gene expression. Exp Ther Med. 2018 Sep;16(3):1693-1700.
40 MiR-223 modulates multidrug resistance via downregulation of ABCB1 in hepatocellular carcinoma cells. Exp Biol Med (Maywood). 2013 Sep;238(9):1024-32.
41 miR-508-5p regulates multidrug resistance of gastric cancer by targeting ABCB1 and ZNRD1. Oncogene. 2014 Jun 19;33(25):3267-76.
42 miR-9 regulates the multidrug resistance of chronic myelogenous leukemia by targeting ABCB1. Oncol Rep. 2017 Apr;37(4):2193-2200.
43 Atorvastatin attenuation of ABCB1 expression is mediated by microRNA miR-491-3p in Caco-2 cells. Eur J Pharm Sci. 2016 Oct 10;93:431-6.
44 The PI3K/mTOR dual inhibitor BEZ235 suppresses proliferation and migration and reverses multidrug resistance in acute myeloid leukemia. Acta Pharmacol Sin. 2017 Mar;38(3):382-391.
45 Methylation of miR-129-5p CpG island modulates multi-drug resistance in gastric cancer by targeting ABC transporters. Oncotarget. 2014 Nov 30;5(22):11552-63.
46 Genetic and epigenetic similarities and differences between childhood and adult AML. Pediatr Blood Cancer. 2012 Apr;58(4):525-31.
47 Quantitative analysis of cancer-associated gene methylation connected to risk factors in Korean colorectal cancer patients. J Prev Med Public Health. 2012 Jul;45(4):251-8.
48 Effect of promoter methylation of multidrug resistance 1 (MDR1) gene in gastric carcinogenesis. Anticancer Res. 2009 Jan;29(1):337-41.
49 RASSF1A, APC, ESR1, ABCB1 and HOXC9, but not p16INK4A, DAPK1, PTEN and MT1G genes were frequently methylated in the stage I non-small cell lung cancer in China. J Cancer Res Clin Oncol. 2009 Dec;135(12):1675-84.
50 Association of ABCB1 promoter methylation with aspirin exposure, platelet function, and clinical outcomes in Chinese intracranial artery stenosis patients. Eur J Clin Pharmacol. 2017 Oct;73(10):1261-1269.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.