General Information of Drug Transporter (DT)
DT ID DTD0004 Transporter Info
Gene Name ABCG2
Transporter Name Breast cancer resistance protein
Gene ID
9429
UniProt ID
Q9UNQ0
Epigenetic Regulations of This DT (ERD)
Epigenetic Phenomenon Hypomethylation of ABCG2 in pancreatic cancer [1]
Location Promoter
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Related Molecular Changes Up regulation of ABCG2 Experiment Method RT-qPCR
Studied Phenotype Pancreatic cancer [ICD-11: 2C10]
Experimental Material Multiple cell lines of human
Additional Notes ABCG2 expression correlated with pancreatic cancer tumorigenesis and drug resistance in a mechanism that is independent of promoter methylation.
Epigenetic Phenomenon Hypermethylation of ABCG2 in chronic myelogenous leukemia [2]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-sensitive PCR
Related Molecular Changes Down regulation of ABCG2 Experiment Method Southern blotting
Studied Phenotype Chronic myelogenous leukemia [ICD-11: 2A20.0]
Experimental Material Multiple cell lines of human
Additional Notes c-MYCmediated transcription of ABCG2 gene is controlled by its CpG islandpromoter methylation status.
Epigenetic Phenomenon Hypermethylation of ABCG2 in lung cancer (compare with drug-resistant counterpart cells) [3]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
Studied Phenotype Small cell lung cancer [ICD-11: 2C25.1]
Experimental Material Multiple cell lines of human
Additional Notes Methylation status of ABCG2 is correlated inversely with its expression in drug-resistant lung cancer cells.
Epigenetic Phenomenon Hypermethylation of ABCG2 in lung cancer (compare with drug-resistant counterpart cells) [3]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Related Molecular Changes Down regulation of ABCG2 Experiment Method Western Blot
Studied Phenotype Small cell lung cancer [ICD-11: 2C25.1]
Experimental Material Multiple cell lines of human
Additional Notes Methylation status of ABCG2 is correlated inversely with its expression in drug-resistant lung cancer cells.
Epigenetic Phenomenon Hypermethylation of ABCG2 in multiple myeloma [4]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
Studied Phenotype Multiple myeloma [ICD-11: 2A83]
Experimental Material Multiple cell lines of human
Additional Notes Demethylation of the promoter increased ABCG2 mRNA and protein expression.
Epigenetic Phenomenon Hypermethylation of ABCG2 in multiple myeloma [4]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Related Molecular Changes Down regulation of ABCG2 Experiment Method Western Blot
Studied Phenotype Multiple myeloma [ICD-11: 2A83]
Experimental Material Multiple cell lines of human
Additional Notes Demethylation of the promoter increased ABCG2 mRNA and protein expression.
Epigenetic Phenomenon Hypermethylation of ABCG2 in renal carcinoma [5]
Location Promoter (-599 to +329 bp)
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Related Molecular Changes Down regulation of ABCG2 Experiment Method Semiquantitative RT-PCR
Studied Phenotype Renal cancer [ICD-11: 2C90]
Experimental Material Multiple cell lines of human
Additional Notes Methylation of the ABCG2 promoter inhibited transcriptional activity.
Epigenetic Phenomenon Hypermethylation of ABCG2 in glioblastoma multiforme [6]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Related Molecular Changes level of ABCG2 Unchanged Experiment Method RT-qPCR
Studied Phenotype Glioblastoma multiforme [ICD-11: 2A00.00]
Experimental Material Patient tissue samples
Additional Notes No association between ABCG2 promoter methylation and ABCG2 expression or overall survival was seen.
Epigenetic Phenomenon Methylation of ABCG2 in atypical teratoid rhabdoid tumor [7]
Location 5'UTR (cg02016771)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 1.18E-08; Z-score: -1.25E+00
Methylation in Case 7.75E-01 (Median) Methylation in Control 8.23E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in atypical teratoid rhabdoid tumor [7]
Location 5'UTR (cg05919690)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.75E+00 Statistic Test p-value: 4.99E-08; Z-score: 1.51E+00
Methylation in Case 8.62E-02 (Median) Methylation in Control 4.92E-02 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in atypical teratoid rhabdoid tumor [7]
Location 5'UTR (cg15443907)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.05E+00 Statistic Test p-value: 1.19E-06; Z-score: -1.09E+00
Methylation in Case 8.21E-01 (Median) Methylation in Control 8.60E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in bladder cancer [8]
Location 5'UTR (cg02016771)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -2.36E+00 Statistic Test p-value: 2.42E-09; Z-score: -9.59E+00
Methylation in Case 3.19E-01 (Median) Methylation in Control 7.54E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in bladder cancer [8]
Location 5'UTR (cg15443907)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 3.60E-02; Z-score: -7.05E-01
Methylation in Case 8.77E-01 (Median) Methylation in Control 8.93E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in breast cancer [9]
Location 5'UTR (cg15443907)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 8.04E-04; Z-score: -9.54E-01
Methylation in Case 8.80E-01 (Median) Methylation in Control 9.05E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in breast cancer [9]
Location 5'UTR (cg02016771)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 2.29E-03; Z-score: -8.10E-01
Methylation in Case 6.82E-01 (Median) Methylation in Control 7.45E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in breast cancer [9]
Location 5'UTR (cg05919690)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 3.56E-02; Z-score: -3.32E-01
Methylation in Case 6.67E-01 (Median) Methylation in Control 6.82E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in hepatocellular carcinoma [10]
Location 5'UTR (cg15443907)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 4.49E-03; Z-score: -6.16E-01
Methylation in Case 8.44E-01 (Median) Methylation in Control 8.66E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in hepatocellular carcinoma [10]
Location 5'UTR (cg02016771)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 1.69E-02; Z-score: -5.10E-03
Methylation in Case 8.32E-01 (Median) Methylation in Control 8.33E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in panic disorder [11]
Location 5'UTR (cg02016771)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.04E+00 Statistic Test p-value: 8.39E-03; Z-score: 2.81E-01
Methylation in Case 2.33E+00 (Median) Methylation in Control 2.25E+00 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in bladder cancer [8]
Location TSS1500 (cg24352530)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -3.96E+00 Statistic Test p-value: 1.17E-05; Z-score: -5.36E+00
Methylation in Case 8.59E-02 (Median) Methylation in Control 3.40E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in bladder cancer [8]
Location TSS1500 (cg11000292)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -2.39E+00 Statistic Test p-value: 5.90E-03; Z-score: -2.04E+00
Methylation in Case 3.05E-02 (Median) Methylation in Control 7.31E-02 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in breast cancer [9]
Location TSS1500 (cg11000292)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.07E+00 Statistic Test p-value: 1.13E-02; Z-score: 1.82E-01
Methylation in Case 3.61E-02 (Median) Methylation in Control 3.37E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in breast cancer [9]
Location TSS1500 (cg27493371)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 3.71E-02; Z-score: 3.45E-01
Methylation in Case 1.68E-01 (Median) Methylation in Control 1.59E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in clear cell renal cell carcinoma [12]
Location TSS1500 (cg24352530)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.31E+00 Statistic Test p-value: 1.06E-02; Z-score: -1.20E+00
Methylation in Case 1.64E-01 (Median) Methylation in Control 2.15E-01 (Median)
Studied Phenotype Clear cell renal cell carcinoma [ICD-11: 2C90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in colorectal cancer [13]
Location TSS1500 (cg02196227)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 3.72E-02; Z-score: -2.59E-02
Methylation in Case 1.22E-01 (Median) Methylation in Control 1.22E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in depression [14]
Location TSS1500 (cg24352530)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.06E+00 Statistic Test p-value: 4.59E-02; Z-score: 5.87E-01
Methylation in Case 1.09E-01 (Median) Methylation in Control 1.03E-01 (Median)
Studied Phenotype Depression [ICD-11: 6A8Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in hepatocellular carcinoma [10]
Location TSS1500 (cg24352530)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.38E+00 Statistic Test p-value: 2.61E-03; Z-score: -1.33E+00
Methylation in Case 9.47E-02 (Median) Methylation in Control 1.30E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in pancretic ductal adenocarcinoma [15]
Location TSS1500 (cg24507762)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.67E+00 Statistic Test p-value: 1.93E-13; Z-score: 2.55E+00
Methylation in Case 3.72E-01 (Median) Methylation in Control 2.23E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in pancretic ductal adenocarcinoma [15]
Location TSS1500 (cg06213598)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 1.68E-02; Z-score: -5.28E-01
Methylation in Case 7.99E-01 (Median) Methylation in Control 8.27E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in papillary thyroid cancer [16]
Location TSS1500 (cg24352530)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.32E+00 Statistic Test p-value: 4.57E-05; Z-score: -1.30E+00
Methylation in Case 1.18E-01 (Median) Methylation in Control 1.55E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in papillary thyroid cancer [16]
Location TSS1500 (cg11000292)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.20E+00 Statistic Test p-value: 9.42E-04; Z-score: -6.16E-01
Methylation in Case 2.60E-02 (Median) Methylation in Control 3.12E-02 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in systemic lupus erythematosus [17]
Location TSS1500 (cg11000292)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.10E+00 Statistic Test p-value: 3.53E-03; Z-score: -2.70E-01
Methylation in Case 5.39E-02 (Median) Methylation in Control 5.92E-02 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in systemic lupus erythematosus [17]
Location TSS1500 (cg24352530)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.11E+00 Statistic Test p-value: 4.38E-03; Z-score: -4.23E-01
Methylation in Case 2.00E-01 (Median) Methylation in Control 2.21E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in systemic lupus erythematosus [17]
Location TSS1500 (cg02196227)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 5.16E-03; Z-score: -1.68E-01
Methylation in Case 9.74E-02 (Median) Methylation in Control 1.00E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in bladder cancer [8]
Location TSS200 (cg26489994)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.81E+00 Statistic Test p-value: 3.96E-03; Z-score: -2.69E+00
Methylation in Case 1.89E-02 (Median) Methylation in Control 3.42E-02 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in breast cancer [9]
Location TSS200 (cg03415858)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.10E+00 Statistic Test p-value: 7.24E-03; Z-score: 3.28E-01
Methylation in Case 5.32E-02 (Median) Methylation in Control 4.83E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in breast cancer [9]
Location TSS200 (cg26489994)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.16E+00 Statistic Test p-value: 1.47E-02; Z-score: 1.05E-01
Methylation in Case 1.79E-02 (Median) Methylation in Control 1.54E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in breast cancer [9]
Location TSS200 (cg25295218)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.64E+00 Statistic Test p-value: 3.85E-02; Z-score: 4.58E-01
Methylation in Case 2.71E-02 (Median) Methylation in Control 1.65E-02 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in colorectal cancer [13]
Location TSS200 (cg26489994)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.13E+00 Statistic Test p-value: 3.86E-02; Z-score: 3.87E-01
Methylation in Case 1.66E-02 (Median) Methylation in Control 1.47E-02 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in colorectal cancer [13]
Location TSS200 (cg25295218)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 4.93E-02; Z-score: 1.31E-01
Methylation in Case 1.62E-02 (Median) Methylation in Control 1.54E-02 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in HIV infection [18]
Location TSS200 (cg03415858)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.09E+00 Statistic Test p-value: 1.25E-02; Z-score: 4.98E-01
Methylation in Case 5.89E-02 (Median) Methylation in Control 5.39E-02 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in lung adenocarcinoma [19]
Location TSS200 (cg26489994)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.19E+00 Statistic Test p-value: 1.27E-02; Z-score: -1.30E+00
Methylation in Case 3.39E-02 (Median) Methylation in Control 4.03E-02 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in pancretic ductal adenocarcinoma [15]
Location TSS200 (cg13120771)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.53E+00 Statistic Test p-value: 2.42E-04; Z-score: -1.17E+00
Methylation in Case 9.04E-02 (Median) Methylation in Control 1.38E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in pancretic ductal adenocarcinoma [15]
Location TSS200 (cg24084363)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.11E+00 Statistic Test p-value: 1.31E-03; Z-score: 4.54E-01
Methylation in Case 1.03E-01 (Median) Methylation in Control 9.27E-02 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in pancretic ductal adenocarcinoma [15]
Location TSS200 (cg09796800)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.01E+00 Statistic Test p-value: 1.53E-02; Z-score: 3.57E-01
Methylation in Case 9.52E-01 (Median) Methylation in Control 9.42E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in papillary thyroid cancer [16]
Location TSS200 (cg26489994)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.15E+00 Statistic Test p-value: 3.36E-06; Z-score: -8.46E-01
Methylation in Case 5.05E-02 (Median) Methylation in Control 5.82E-02 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in papillary thyroid cancer [16]
Location TSS200 (cg25295218)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 9.48E-03; Z-score: -3.98E-01
Methylation in Case 5.39E-02 (Median) Methylation in Control 5.71E-02 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in systemic lupus erythematosus [17]
Location TSS200 (cg01263075)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 6.00E-03; Z-score: -1.22E-01
Methylation in Case 8.00E-02 (Median) Methylation in Control 8.20E-02 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in atypical teratoid rhabdoid tumor [7]
Location Body (cg04064583)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 5.50E-04; Z-score: -4.51E-01
Methylation in Case 4.65E-01 (Median) Methylation in Control 5.07E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in bladder cancer [8]
Location Body (cg04064583)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.92E+00 Statistic Test p-value: 1.37E-04; Z-score: -3.80E+00
Methylation in Case 6.39E-02 (Median) Methylation in Control 1.23E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in breast cancer [9]
Location Body (cg04064583)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.61E+00 Statistic Test p-value: 1.25E-06; Z-score: -1.66E+00
Methylation in Case 1.87E-01 (Median) Methylation in Control 3.01E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in colon adenocarcinoma [20]
Location Body (cg04310063)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.16E+00 Statistic Test p-value: 1.63E-03; Z-score: -3.79E+00
Methylation in Case 6.73E-01 (Median) Methylation in Control 7.84E-01 (Median)
Studied Phenotype Colon adenocarcinoma [ICD-11: 2B90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in colorectal cancer [13]
Location Body (cg04064583)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.17E+00 Statistic Test p-value: 2.96E-02; Z-score: 6.86E-01
Methylation in Case 1.82E-01 (Median) Methylation in Control 1.55E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in hepatocellular carcinoma [10]
Location Body (cg20080616)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.53E+00 Statistic Test p-value: 1.91E-14; Z-score: -5.48E+00
Methylation in Case 5.09E-01 (Median) Methylation in Control 7.80E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in hepatocellular carcinoma [10]
Location Body (cg05369268)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.17E+00 Statistic Test p-value: 5.10E-11; Z-score: -4.61E+00
Methylation in Case 8.25E-01 (Median) Methylation in Control 9.62E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in hepatocellular carcinoma [10]
Location Body (cg04064583)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.24E+00 Statistic Test p-value: 1.92E-06; Z-score: -8.38E-01
Methylation in Case 1.21E-01 (Median) Methylation in Control 1.50E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in HIV infection [18]
Location Body (cg04064583)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.42E+00 Statistic Test p-value: 5.66E-05; Z-score: 1.86E+00
Methylation in Case 2.74E-01 (Median) Methylation in Control 1.92E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in lung adenocarcinoma [19]
Location Body (cg04064583)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.18E+00 Statistic Test p-value: 3.40E-02; Z-score: 1.16E+00
Methylation in Case 2.06E-01 (Median) Methylation in Control 1.74E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in pancretic ductal adenocarcinoma [15]
Location Body (cg00244747)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.10E+00 Statistic Test p-value: 4.31E-05; Z-score: -1.12E+00
Methylation in Case 7.22E-01 (Median) Methylation in Control 7.94E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in pancretic ductal adenocarcinoma [15]
Location Body (cg25453063)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.02E+00 Statistic Test p-value: 2.46E-03; Z-score: 4.70E-01
Methylation in Case 8.71E-01 (Median) Methylation in Control 8.52E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in pancretic ductal adenocarcinoma [15]
Location Body (cg02414785)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 3.72E-03; Z-score: -6.37E-01
Methylation in Case 6.19E-01 (Median) Methylation in Control 6.43E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in pancretic ductal adenocarcinoma [15]
Location Body (cg15599483)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.16E+00 Statistic Test p-value: 1.57E-02; Z-score: -9.46E-01
Methylation in Case 7.34E-01 (Median) Methylation in Control 8.51E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCG2 in papillary thyroid cancer [16]
Location Body (cg04064583)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.14E+00 Statistic Test p-value: 4.19E-05; Z-score: -1.01E+00
Methylation in Case 4.99E-01 (Median) Methylation in Control 5.68E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Hypoacetylation of ABCG2 in acute myeloid leukemia (compare with valproate-treatment counterpart AML cells) [21]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
Studied Phenotype Acute myeloid leukemia [ICD-11: 2A60]
Experimental Material Multiple cell lines of human
Additional Notes Chromatin immunoprecipitation revealed the?hyperacetylation?of?histone?proteins in the promoter regions of?BCRP on valproate treatment.
Epigenetic Phenomenon Hypoacetylation of ABCG2 in AML (compare with valproate treatment counterpart cells) [21]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCG2 Experiment Method Western Blot
Studied Phenotype Acute myeloid leukemia [ICD-11: 2A60]
Experimental Material Multiple cell lines of human
Additional Notes Hyperacetylation of histone proteins in the promoter regions of BCRP on valproate treatment.
Epigenetic Phenomenon Hypoacetylation of ABCG2 in AML (compare with valproate treatment counterpart cells) [21]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCG2 Experiment Method Western Blot
Studied Phenotype Acute myeloid leukemia [ICD-11: 2A60]
Experimental Material Multiple cell lines of human
Additional Notes Hyperacetylation of histone proteins in the promoter regions of BCRP on valproate treatment.
Epigenetic Phenomenon Hypoacetylation of ABCG2 in breast cancer (compare with doxorubicin-resistant counterpart cells) [22]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Multiple cell lines of human
Additional Notes High acetylation level of histone H3 of ABCG2 in doxorubicin-resistant breast cancer cells associated with higher ABCG2 expression.
Epigenetic Phenomenon Hypoacetylation of ABCG2 in colon cancer (compare with romidepsin-resistant counterpart cells) [23]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
Studied Phenotype Colon cancer [ICD-11: 2B90.Z]
Experimental Material Multiple cell lines of human
Additional Notes High acetylation level of histone H3 of ABCG2 in romidepsin-resistant colon cancer cells associated with higher ABCG2 expression.
Epigenetic Phenomenon Hypoacetylation of ABCG2 in acute myeloid leukemia (compare with valproate-treatment counterpart AML cells) [24]
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
Studied Phenotype Promyeloblastic leukemia [ICD-11: 2A60.0]
Experimental Material Human leukemia stem cell-like cell line (KG-1a)
Additional Notes Exposure of promyeloblastic leukemia cells for 24 h to 2 mM of the weak histone deacetylase inhibitor phenylbutyrate resulted in enhanced and marked expression of BCRP.
Epigenetic Phenomenon Higher expression of miR-106a in breast cancer (compare with adjacent normal tissue) [25]
Epigenetic Type microRNA Experiment Method .
Related Molecular Changes Up regulation of ABCG2 Experiment Method Western Blot
miRNA Stemloop ID miR-106a miRNA Mature ID miR-106a-5p
miRNA Sequence AAAAGUGCUUACAGUGCAGGUAG
miRNA Target Type Unknown
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Multiple cell lines of human
Additional Notes miRNA-106a was upregulated in human breast cancer tissues. miRNA-106a promoted the proliferation, clonogenicity, migration, and invasion of breast cancer MCF-7 and MDA-MB-231 cells, and decreased their apoptosis.
Epigenetic Phenomenon Higher expression of miR-132 in Lgr5+ gastric cancer (compare with Lgr5- counterpart cells) [26]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Up regulation of ABCG2 Experiment Method RT-qPCR
miRNA Stemloop ID miR-132 miRNA Mature ID miR-132-3p
miRNA Sequence UAACAGUCUACAGCCAUGGUCG
miRNA Target Type Indirect(SIRT1; CREB; ABCG2)
Studied Phenotype Gastric cancer [ICD-11: 2B72]
Experimental Material Multiple cell lines of human; Model organism in vivo (mouse)
Additional Notes The expression of miR132 was inversely correlated with SIRT1 in gastric cancer. Down-regulation of SIRT1 led to a subsequent increase of the level of acetylated CREB which in turn activated the ABCG2 signaling pathway.
Epigenetic Phenomenon Higher expression of miR-145 in glioma (compare with glioma stem cells) [27]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
miRNA Stemloop ID miR-145 miRNA Mature ID miR-145-5p
miRNA Sequence GUCCAGUUUUCCCAGGAAUCCCU
miRNA Target Type Direct
Studied Phenotype Glioma [ICD-11: 2A00.0]
Experimental Material Chinese patient tissue samples
Additional Notes miR-145 downregulated ABCG2 expression, and miR-145-ABCG2MMP-2/9 pathway regulated the migration and invasion in GSCs.
Epigenetic Phenomenon Higher expression of miR-181a in breast cancer (compare with mitoxantrone-resistant cells) [28]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
miRNA Stemloop ID miR-181a miRNA Mature ID miR-181a-5p
miRNA Sequence AACAUUCAACGCUGUCGGUGAGU
miRNA Target Type Direct
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Additional Notes miR-181a was down-regulated in mitoxantrone-resistant MCF-7/MX cells and regulated BCRP expression via binding to the 3-UTR of BCRP mRNA.
Epigenetic Phenomenon Higher expression of miR-200c in breast cancer (compare with doxorubicin-resistant cells) [29]
Epigenetic Type microRNA Experiment Method Bioinformatic prediction
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
miRNA Stemloop ID miR-200c miRNA Mature ID Unclear
miRNA Target Type Direct
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Additional Notes Down-regulation of microRNA-200c is associated with drug resistance in human breast cancer.
Epigenetic Phenomenon Higher expression of miR-212 in chronic myeloid leukemia (compare with imatinib-resistant cells) [30]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
miRNA Stemloop ID miR-212 miRNA Mature ID Unclear
miRNA Target Type Direct
Studied Phenotype Chronic myeloid leukemia [ICD-11: 2B33.1]
Experimental Material Human immortalized myelogenous leukemia cell line(K-562)
Additional Notes Short-term and long-term imatinib treatment downregulates miR-212 expression, leading to the abolition of suppression of ABCG2 gene expression.
Epigenetic Phenomenon Higher expression of miR-212 in squamous cell carcinoma (compare with cisplatin-resistant cells) [31]
Epigenetic Type microRNA Experiment Method Dual-luciferase reporter assay
Related Molecular Changes Down regulation of ABCG2 Experiment Method Western Blot
miRNA Stemloop ID miR-222 miRNA Mature ID miR-222-3p
miRNA Sequence AGCUACAUCUGGCUACUGGGU
miRNA Target Type Direct
Studied Phenotype Tongue squamous cell carcinoma [ICD-11: 2B61.0]
Experimental Material Patient tissue samples
Additional Notes miR-222 overexpression may increase the sensitivity of tongue squamous cell carcinoma to cisplatin by targeting ABCG2.
Epigenetic Phenomenon Higher expression of miR-328 in breast cancer (compare with mitoxantrone-resistant cells) [32]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCG2 Experiment Method Western Blot
miRNA Stemloop ID miR-328 miRNA Mature ID miR-328-3p
miRNA Sequence CUGGCCCUCUCUGCCCUUCCGU
miRNA Target Type Direct
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Additional Notes miR-328 negatively regulates ABCG2 protein expression by acting on the 3-UTR segment and that repression of ABCG2 expression via miR-328-mediated pathway is translated into significantly increased drug sensitivity in cancer cells.
Epigenetic Phenomenon Higher expression of miR-328 in colorectal cancer (compare with adjacent normal tissue) [33]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
miRNA Stemloop ID miR-328 miRNA Mature ID miR-328-3p
miRNA Sequence CUGGCCCUCUCUGCCCUUCCGU
miRNA Target Type Direct
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Multiple cell lines of human
Additional Notes miR-328 downregulates ABCG2 in colorectal cancer.
Epigenetic Phenomenon Higher expression of miR-487a in breast cancer (compare with mitoxantrone-resistant cells) [34]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCG2 Experiment Method Western Blot
miRNA Stemloop ID miR-487a miRNA Mature ID miR-487a-3p
miRNA Sequence AAUCAUACAGGGACAUCCAGUU
miRNA Target Type Direct
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Additional Notes miR-487a can directly regulate BCRP expression and reverse chemotherapeutic drug resistance in a subset of breast cancers.
Epigenetic Phenomenon Lower expression of miR-133b in prostate cancer (compare with adjacent normal tissue) [35]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
miRNA Stemloop ID miR-133b miRNA Mature ID Unclear
miRNA Target Type Indirect(HuR; ABCG2)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Multiple cell lines of human
Additional Notes miR-133b downregulates ABCG2 via miR-133b/HuR/ ABCG2 pathway.
Epigenetic Phenomenon Lower expression of miR-495 in non-small cell lung cancer (compare with adjacent normal tissue) [36]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCG2 Experiment Method Western Blot
miRNA Stemloop ID miR-495 miRNA Mature ID miR-495-5p
miRNA Sequence GAAGUUGCCCAUGUUAUUUUCG
miRNA Target Type Indirect(UBE2C; ABCG2)
Studied Phenotype Non-small cell lung cancer [ICD-11: 2C25]
Experimental Material Multiple cell lines of human
Additional Notes The miR495-UBE2C-ABCG2/ERCC1 axis reverses DDP resistance via downregulation of anti-drug genes and reducing EMT in DDP-resistant NSCLC cells.
Epigenetic Phenomenon Lower expression of miR-519c in colorectal cancer (compare with adjacent normal tissue) [37]
Epigenetic Type microRNA Experiment Method Ribonucleoprotein immunoprecipitation
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
miRNA Stemloop ID miR-519c miRNA Mature ID miR-519c-3p
miRNA Sequence AAAGUGCAUCUUUUUAGAGGAU
miRNA Target Type Indirect(HuR; ABCG2)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Multiple cell lines of human
Additional Notes miR-519c downregulates ABCG2 via miR-519c/HuR/ ABCG2 pathway.
Epigenetic Phenomenon miR-142-3p downregulates ABCG2 expression in colon cancer [38]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
miRNA Stemloop ID miR-142 miRNA Mature ID miR-142-3p
miRNA Sequence UGUAGUGUUUCCUACUUUAUGGA
miRNA Target Type Direct
Studied Phenotype Colon cancer [ICD-11: 2B90.Z]
Experimental Material Multiple cell lines of human
Additional Notes OCT4 promoter is hypomethylated in colon cancer tissues, resulting in persistent low levels of miR-142-3p. The repression of miR-142-3p results in loss of inhibition of CD133, Lgr5, and ABCG2 in the cancer cells.
Epigenetic Phenomenon miR-3163 downregulates ABCG2 expression [39]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCG2 Experiment Method Western Blot
miRNA Stemloop ID miR-3163 miRNA Mature ID miR-3163
miRNA Sequence UAUAAAAUGAGGGCAGUAAGAC
miRNA Target Type Direct
Studied Phenotype Retinoblastoma [ICD-11: 2D02.2]
Experimental Material Human retinoblastoma cell line (WERI-Rb1)
Additional Notes miR-3163 has a significant impact on ABCG2 expression and can influence proliferation, apoptosis, and drug resistance in RCSCs.
Epigenetic Phenomenon miR-491 regulates ABCG2 expression in hepatocellular carcinoma [40]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCG2 Experiment Method Western Blot
miRNA Stemloop ID miR-491 miRNA Mature ID miR-491-5p
miRNA Sequence AGUGGGGAACCCUUCCAUGAGG
miRNA Target Type Direct
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Hepatocellular carcinoma cell line (MHCC-97L)
Additional Notes Aspirin enhanced the sensitivity of side population cells to doxorubicin via regulating the miR-491/ABCG2 signaling pathway.
Epigenetic Phenomenon miR-520h regulates ABCG2 expression [41]
Epigenetic Type microRNA Experiment Method Bioinformatic prediction
Related Molecular Changes Down regulation of ABCG2 Experiment Method RT-qPCR
miRNA Stemloop ID miR-520h miRNA Mature ID miR-520h
miRNA Sequence ACAAAGUGCUUCCCUUUAGAGU
miRNA Target Type Direct
Studied Phenotype Pancreatic cancer [ICD-11: 2C10]
Experimental Material Multiple cell lines of human
Additional Notes miR-520h downregulates ABCG2 in pancreatic cancer cells to inhibit migration, invasion, and side populations.
Epigenetic Phenomenon Hypomethylation of ABCG2 in nodular goiter [42]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-sensitive PCR
Studied Phenotype Nodular goiter [ICD-11: 5A01.Z]
Experimental Material Patient tissue samples
Additional Notes Promoter methylation of ABCG2 was significantly positively associated with a family history of thyroid diseases (P < 0.05).
Epigenetic Phenomenon miR-10a directly targets ABCG2 [43]
Epigenetic Type microRNA Experiment Method CLASH
miRNA Stemloop ID miR-10a miRNA Mature ID miR-10a-5p
miRNA Sequence UACCCUGUAGAUCCGAAUUUGUG
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-142 directly targets ABCG2 [38]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay//Western blot
miRNA Stemloop ID miR-142 miRNA Mature ID miR-142-3p
miRNA Sequence UGUAGUGUUUCCUACUUUAUGGA
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-16-2 directly targets ABCG2 [44]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-16-2 miRNA Mature ID miR-16-2-3p
miRNA Sequence CCAAUAUUACUGUGCUGCUUUA
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-181a directly targets ABCG2 [28]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay//Microarray//qRT-PCR//Western blot
miRNA Stemloop ID miR-181a miRNA Mature ID miR-181a-5p
miRNA Sequence AACAUUCAACGCUGUCGGUGAGU
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-192 directly targets ABCG2 [45]
Epigenetic Type microRNA Experiment Method Microarray
miRNA Stemloop ID miR-192 miRNA Mature ID miR-192-5p
miRNA Sequence CUGACCUAUGAAUUGACAGCC
miRNA Target Type Direct
Experimental Material Patient tissue samples
Epigenetic Phenomenon miR-195 directly targets ABCG2 [44]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-195 miRNA Mature ID miR-195-3p
miRNA Sequence CCAAUAUUGGCUGUGCUGCUCC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-222 directly targets ABCG2 [31]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
miRNA Stemloop ID miR-222 miRNA Mature ID miR-222-3p
miRNA Sequence AGCUACAUCUGGCUACUGGGU
miRNA Target Type Direct
Experimental Material Patient tissue samples
Epigenetic Phenomenon miR-26b directly targets ABCG2 [46]
Epigenetic Type microRNA Experiment Method Microarray
miRNA Stemloop ID miR-26b miRNA Mature ID miR-26b-5p
miRNA Sequence UUCAAGUAAUUCAGGAUAGGU
miRNA Target Type Direct
Experimental Material Human cervical cancer cell line (Hela)
Epigenetic Phenomenon miR-3167 directly targets ABCG2 [44]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-3167 miRNA Mature ID miR-3167
miRNA Sequence AGGAUUUCAGAAAUACUGGUGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-328 directly targets ABCG2 [33]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay//qRT-PCR//Western blot
miRNA Stemloop ID miR-328 miRNA Mature ID miR-328-3p
miRNA Sequence CUGGCCCUCUCUGCCCUUCCGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-340 directly targets ABCG2 [47]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-340 miRNA Mature ID miR-340-5p
miRNA Sequence UUAUAAAGCAAUGAGACUGAUU
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-369 directly targets ABCG2 [44]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-369 miRNA Mature ID miR-369-3p
miRNA Sequence AAUAAUACAUGGUUGAUCUUU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-374a directly targets ABCG2 [44]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-374a miRNA Mature ID miR-374a-5p
miRNA Sequence UUAUAAUACAACCUGAUAAGUG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-374b directly targets ABCG2 [44]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-374b miRNA Mature ID miR-374b-5p
miRNA Sequence AUAUAAUACAACCUGCUAAGUG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-4539 directly targets ABCG2 [47]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4539 miRNA Mature ID miR-4539
miRNA Sequence GCUGAACUGGGCUGAGCUGGGC
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-4635 directly targets ABCG2 [44]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4635 miRNA Mature ID miR-4635
miRNA Sequence UCUUGAAGUCAGAACCCGCAA
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-4724 directly targets ABCG2 [47]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4724 miRNA Mature ID miR-4724-5p
miRNA Sequence AACUGAACCAGGAGUGAGCUUCG
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-487a directly targets ABCG2 [34]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay//qRT-PCR//Western blot
miRNA Stemloop ID miR-487a miRNA Mature ID miR-487a-3p
miRNA Sequence AAUCAUACAGGGACAUCCAGUU
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-497 directly targets ABCG2 [47]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-497 miRNA Mature ID miR-497-3p
miRNA Sequence CAAACCACACUGUGGUGUUAGA
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-520h directly targets ABCG2 [41]
Epigenetic Type microRNA Experiment Method qRT-PCR//Western blot
miRNA Stemloop ID miR-520h miRNA Mature ID miR-520h
miRNA Sequence ACAAAGUGCUUCCCUUUAGAGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-5692b directly targets ABCG2 [44]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-5692b miRNA Mature ID miR-5692b
miRNA Sequence AAUAAUAUCACAGUAGGUGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-5692c directly targets ABCG2 [44]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-5692c miRNA Mature ID miR-5692c
miRNA Sequence AAUAAUAUCACAGUAGGUGUAC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-7158 directly targets ABCG2 [47]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-7158 miRNA Mature ID miR-7158-3p
miRNA Sequence CUGAACUAGAGAUUGGGCCCA
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-876 directly targets ABCG2 [44]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-876 miRNA Mature ID miR-876-5p
miRNA Sequence UGGAUUUCUUUGUGAAUCACCA
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-889 directly targets ABCG2 [44]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-889 miRNA Mature ID miR-889-3p
miRNA Sequence UUAAUAUCGGACAACCAUUGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
References
1 Expression and promoter methylation analysis of ATP-binding cassette genes in pancreatic cancer. Oncol Rep. 2012 Jan;27(1):265-9.
2 c-MYC oncoprotein dictates transcriptional profiles of ATP-binding cassette transporter genes in chronic myelogenous leukemia CD34+ hematopoietic progenitor cells. Mol Cancer Res. 2011 Aug;9(8):1054-66.
3 Methylation status of breast cancer resistance protein detected by methylation-specific polymerase chain reaction analysis is correlated inversely with its expression in drug-resistant lung cancer cells. Cancer. 2008 Mar 1;112(5):1122-30.
4 ABCG2 expression, function, and promoter methylation in human multiple myeloma. Blood. 2006 Dec 1;108(12):3881-9.
5 Aberrant promoter methylation of the ABCG2 gene in renal carcinoma. Mol Cell Biol. 2006 Nov;26(22):8572-85.
6 Epigenetic modulation of the drug resistance genes MGMT, ABCB1 and ABCG2 in glioblastoma multiforme. BMC Cancer. 2013 Dec 31;13:617.
7 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
8 DNA Methylation Dynamics in Urological Tumors.
9 Genome-wide Scan for Methylation Profiles in Breast Cancer
10 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
11 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
13 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
14 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
15 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
16 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
17 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
18 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
19 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
20 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
21 Histone deacetylase inhibitors induce a very broad, pleiotropic anticancer drug resistance phenotype in acute myeloid leukemia cells by modulation of multiple ABC transporter genes. Clin Cancer Res. 2009 Jun 1;15(11):3705-15.
22 Single-step doxorubicin-selected cancer cells overexpress the ABCG2 drug transporter through epigenetic changes. Br J Cancer. 2008 May 6;98(9):1515-24.
23 Histone modifications at the ABCG2 promoter following treatment with histone deacetylase inhibitor mirror those in multidrug-resistant cells. Mol Cancer Res. 2008 Jan;6(1):151-64.
24 Salinomycin overcomes ABC transporter-mediated multidrug and apoptosis resistance in human leukemia stem cell-like KG-1a cells. Biochem Biophys Res Commun. 2010 Apr 16;394(4):1098-104.
25 miRNA-106a Promotes Breast Cancer Cell Proliferation, Clonogenicity, Migration, and Invasion Through Inhibiting Apoptosis and Chemosensitivity. DNA Cell Biol. 2019 Feb;38(2):198-207.
26 Upregulated miR-132 in Lgr5+ gastric cancer stem cell-like cells contributes to cisplatin-resistance via SIRT1/CREB/ABCG2 signaling pathway. Mol Carcinog. 2017 Sep;56(9):2022-2034.
27 Escape from hsa-miR-519c enables drug-resistant cells to maintain high expression of ABCG2. Mol Cancer Ther. 2009 Oct;8(10):2959-68.
28 MiR-181a enhances drug sensitivity in mitoxantone-resistant breast cancer cells by targeting breast cancer resistance protein (BCRP/ABCG2). Breast Cancer Res Treat. 2013 Jun;139(3):717-30.
29 MicroRNA-199a targets CD44 to suppress the tumorigenicity and multidrug resistance of ovarian cancer-initiating cells. FEBS J. 2012 Jun;279(11):2047-59.
30 MicroRNA profiling in K-562 cells under imatinib treatment: influence of miR-212 and miR-328 on ABCG2 expression. Pharmacogenet Genomics. 2012 Mar;22(3):198-205.
31 Deregulation of the miR-222-ABCG2 regulatory module in tongue squamous cell carcinoma contributes to chemoresistance and enhanced migratory/invasive potential. Oncotarget. 2015 Dec 29;6(42):44538-50.
32 MicroRNA-328 negatively regulates the expression of breast cancer resistance protein (BCRP/ABCG2) in human cancer cells. Mol Pharmacol. 2009 Jun;75(6):1374-9.
33 MicroRNA expression profiling identifies miR-328 regulates cancer stem cell-like SP cells in colorectal cancer. Br J Cancer. 2012 Mar 27;106(7):1320-30.
34 MiR-487a resensitizes mitoxantrone (MX)-resistant breast cancer cells (MCF-7/MX) to MX by targeting breast cancer resistance protein (BCRP/ABCG2). Cancer Lett. 2013 Oct 1;339(1):107-15.
35 Posttranscriptional Regulation of Human Antigen R by miR-133b Enhances Docetaxel Cytotoxicity Through the Inhibition of ATP-Binding Cassette Subfamily G Member 2 in Prostate Cancer Cells. DNA Cell Biol. 2018 Mar;37(3):210-219.
36 The miR 495-UBE2C-ABCG2/ERCC1 axis reverses cisplatin resistance by downregulating drug resistance genes in cisplatin-resistant non-small cell lung cancer cells. EBioMedicine. 2018 Sep;35:204-221.
37 Exploiting a novel miR-519c-HuR-ABCG2 regulatory pathway to overcome chemoresistance in colorectal cancer. Exp Cell Res. 2015 Nov 1;338(2):222-31.
38 MiR-142-3p functions as a tumor suppressor by targeting CD133, ABCG2, and Lgr5 in colon cancer cells. J Mol Med (Berl). 2013 Aug;91(8):989-1000.
39 Silencing of ABCG2 by MicroRNA-3163 Inhibits Multidrug Resistance in Retinoblastoma Cancer Stem Cells. J Korean Med Sci. 2016 Jun;31(6):836-42.
40 Aspirin enhances the sensitivity of hepatocellular carcinoma side population cells to doxorubicin via miR-491/ABCG2. Biosci Rep. 2018 Nov 9;38(6). pii: BSR20180854.
41 hsa-miR-520h downregulates ABCG2 in pancreatic cancer cells to inhibit migration, invasion, and side populations. Br J Cancer. 2010 Aug 10;103(4):567-74.
42 Aberrant DNA methylation of drug metabolism and transport genes in nodular goiter. Thyroid Res. 2011 Oct 12;4(1):15.
43 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
44 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
45 A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91.
46 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
47 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.