General Information of Drug Transporter (DT)
DT ID DTD0006 Transporter Info
Gene Name SLC22A2
Transporter Name Organic cation transporter 2
Gene ID
6582
UniProt ID
O15244
Epigenetic Regulations of This DT (ERD)
Epigenetic Phenomenon Hypermethylation of SLC22A2 in renal cell carcinoma [1]
Location Proximal promoter
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Related Molecular Changes Down regulation of SLC22A2 Experiment Method RT-qPCR
Studied Phenotype Renal cell carcinoma [ICD-11: 2C90]
Frequency 70% of the studied tumor samples
Experimental Material Patient tissue samples
Additional Notes All CpG sites in the OCT2 proximal promoter were hypomethylated in the kidney.
Epigenetic Phenomenon Hypermethylation of SLC22A2 in renal cell carcinoma [2]
Location Promoter
Epigenetic Type Methylation Experiment Method Bisulfite sequencing PCR
Related Molecular Changes Down regulation of SLC22A2 Experiment Method RT-qPCR
Studied Phenotype Renal cell carcinoma [ICD-11: 2C90]
Frequency In all three RCC lines (786-O, 769-P, and Caki-1)
Experimental Material Multiple cell lines of human; Patients tissue samples
Additional Notes DNA Hypermethylation blocked MYC activation of OCT2 by disrupting its interaction with the E-Box motif, which prevented MYC from recruiting MLL1 to catalyze H3K4me3 at the OCT2 promoter and resulted in repressed OCT2 transcription.
Epigenetic Phenomenon Hypermethylation of SLC22A2 in cisplatin-resistant esophageal cancer (compare with parental cells) [3]
Location Promoter
Epigenetic Type Methylation Experiment Method Methylation-sensitive PCR
Related Molecular Changes Down regulation of SLC22A2 Experiment Method Western Blot
Studied Phenotype Esophageal cancer [ICD-11: 2B70]
Experimental Material Patient tissue samples
Additional Notes Long-term exposure to cisplatin promotes methylation of the OCT1 gene in human esophageal cancer cells.
Epigenetic Phenomenon Hypermethylation of SLC22A2 in hepatocellular carcinoma (compare with non-tumor adjacent tissues) [4]
Location Promoter
Epigenetic Type Methylation Experiment Method MALDI-TOF MS
Related Molecular Changes Down regulation of SLC22A2 Experiment Method RT-qPCR
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Additional Notes DNA methylation is associated with downregulation of the organic cation transporter OCT1 (SLC22A1) in human hepatocellular carcinoma.
Epigenetic Phenomenon Hypermethylation of SLC22A2 in renal cell carcinoma [5]
Location Promoter (10 CpG sites)
Epigenetic Type Methylation Experiment Method HumanMethylation450 BeadChip
Related Molecular Changes Down regulation of SLC22A2 Experiment Method Affymetrix Human Transcriptome 2.0 microarrays
Studied Phenotype Renal cell carcinoma [ICD-11: 2C90]
Experimental Material Multiple cell lines of human
Additional Notes In RCC cell lines, OCT2 protein expression is downregulated due to Hypermethylation in the SLC22A2 promoter region compared to primary tumors or metastases.
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location 5'UTR (cg13323097)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.51E+00 Statistic Test p-value: 1.89E-04; Z-score: 5.73E+00
Methylation in Case 2.20E-01 (Median) Methylation in Control 1.46E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location 5'UTR (cg26248082)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.19E+00 Statistic Test p-value: 3.00E-02; Z-score: 2.67E+00
Methylation in Case 7.67E-01 (Median) Methylation in Control 6.44E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location TSS1500 (cg07026448)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.37E+00 Statistic Test p-value: 6.51E-06; Z-score: 1.21E+01
Methylation in Case 6.18E-01 (Median) Methylation in Control 4.49E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location TSS1500 (cg23995605)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.05E+00 Statistic Test p-value: 2.05E-04; Z-score: -3.50E+00
Methylation in Case 8.82E-01 (Median) Methylation in Control 9.24E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location TSS1500 (cg14450766)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.50E+00 Statistic Test p-value: 3.71E-15; Z-score: -1.93E+00
Methylation in Case 2.08E-01 (Median) Methylation in Control 3.11E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location TSS1500 (cg23995605)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.13E+00 Statistic Test p-value: 3.50E-14; Z-score: -5.03E+00
Methylation in Case 7.86E-01 (Median) Methylation in Control 8.87E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location TSS1500 (cg19499998)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.11E+00 Statistic Test p-value: 5.42E-13; Z-score: -3.65E+00
Methylation in Case 8.06E-01 (Median) Methylation in Control 8.96E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location TSS1500 (cg25545503)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 1.14E-09; Z-score: -1.80E+00
Methylation in Case 8.54E-01 (Median) Methylation in Control 9.32E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in clear cell renal cell carcinoma [9]
Location TSS1500 (cg23995605)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 3.94E-04; Z-score: -2.90E-02
Methylation in Case 9.23E-01 (Median) Methylation in Control 9.24E-01 (Median)
Studied Phenotype Clear cell renal cell carcinoma [ICD-11: 2C90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in colon adenocarcinoma [10]
Location TSS1500 (cg09595245)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.16E+00 Statistic Test p-value: 5.57E-04; Z-score: -2.37E+00
Methylation in Case 6.72E-01 (Median) Methylation in Control 7.80E-01 (Median)
Studied Phenotype Colon adenocarcinoma [ICD-11: 2B90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in depression [11]
Location TSS1500 (cg07026448)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.02E+00 Statistic Test p-value: 4.21E-02; Z-score: 1.81E-01
Methylation in Case 4.21E-01 (Median) Methylation in Control 4.14E-01 (Median)
Studied Phenotype Depression [ICD-11: 6A8Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in hepatocellular carcinoma [12]
Location TSS1500 (cg07026448)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.16E+00 Statistic Test p-value: 1.17E-08; Z-score: 1.41E+00
Methylation in Case 6.40E-01 (Median) Methylation in Control 5.50E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in hepatocellular carcinoma [12]
Location TSS1500 (cg23995605)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 8.40E-03; Z-score: -3.12E-01
Methylation in Case 8.79E-01 (Median) Methylation in Control 8.87E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in hepatocellular carcinoma [12]
Location TSS1500 (cg14450766)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.07E+00 Statistic Test p-value: 3.95E-02; Z-score: 3.63E-01
Methylation in Case 4.92E-01 (Median) Methylation in Control 4.61E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in HIV infection [13]
Location TSS1500 (cg14450766)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.07E+00 Statistic Test p-value: 6.14E-04; Z-score: -3.43E-01
Methylation in Case 2.51E-01 (Median) Methylation in Control 2.69E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in HIV infection [13]
Location TSS1500 (cg19499998)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.01E+00 Statistic Test p-value: 7.98E-04; Z-score: 7.92E-01
Methylation in Case 9.33E-01 (Median) Methylation in Control 9.20E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in lung adenocarcinoma [14]
Location TSS1500 (cg07026448)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.06E+00 Statistic Test p-value: 3.92E-02; Z-score: 7.17E-01
Methylation in Case 6.11E-01 (Median) Methylation in Control 5.78E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location TSS1500 (cg25545503)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.06E+00 Statistic Test p-value: 6.84E-11; Z-score: 1.47E+00
Methylation in Case 8.75E-01 (Median) Methylation in Control 8.23E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location TSS1500 (cg19499998)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.07E+00 Statistic Test p-value: 1.17E-10; Z-score: 1.56E+00
Methylation in Case 8.57E-01 (Median) Methylation in Control 8.01E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location TSS1500 (cg23995605)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 1.64E-09; Z-score: -2.12E+00
Methylation in Case 9.27E-01 (Median) Methylation in Control 9.53E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location TSS1500 (cg07026448)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.08E+00 Statistic Test p-value: 9.62E-03; Z-score: 1.09E+00
Methylation in Case 6.88E-01 (Median) Methylation in Control 6.37E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location TSS1500 (cg01352551)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.11E+00 Statistic Test p-value: 3.97E-03; Z-score: 2.49E+00
Methylation in Case 8.12E-01 (Median) Methylation in Control 7.34E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location TSS1500 (cg17174275)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.09E+00 Statistic Test p-value: 9.95E-03; Z-score: 2.19E+00
Methylation in Case 8.67E-01 (Median) Methylation in Control 7.96E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location TSS1500 (cg27043188)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.45E+00 Statistic Test p-value: 1.29E-02; Z-score: -2.00E+00
Methylation in Case 3.22E-01 (Median) Methylation in Control 4.66E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location TSS1500 (cg10528482)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.21E+00 Statistic Test p-value: 1.51E-02; Z-score: 1.57E+01
Methylation in Case 8.28E-01 (Median) Methylation in Control 6.86E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location TSS1500 (cg04833514)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.17E+00 Statistic Test p-value: 1.91E-02; Z-score: 3.12E+00
Methylation in Case 8.25E-01 (Median) Methylation in Control 7.03E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location TSS1500 (cg02707152)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.44E+00 Statistic Test p-value: 3.01E-02; Z-score: 3.38E+00
Methylation in Case 3.34E-01 (Median) Methylation in Control 2.31E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in systemic lupus erythematosus [16]
Location TSS1500 (cg23995605)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 2.95E-02; Z-score: -2.21E-01
Methylation in Case 9.19E-01 (Median) Methylation in Control 9.24E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location TSS200 (cg19627213)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.57E+00 Statistic Test p-value: 3.81E-05; Z-score: -4.72E+00
Methylation in Case 3.93E-01 (Median) Methylation in Control 6.18E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location TSS200 (cg06236276)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.11E+00 Statistic Test p-value: 5.91E-03; Z-score: -1.99E+00
Methylation in Case 5.95E-01 (Median) Methylation in Control 6.61E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location TSS200 (cg04294894)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 1.30E-02; Z-score: -2.26E+00
Methylation in Case 7.62E-01 (Median) Methylation in Control 8.06E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location TSS200 (cg26939503)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.17E+00 Statistic Test p-value: 1.32E-02; Z-score: -4.78E+00
Methylation in Case 5.51E-01 (Median) Methylation in Control 6.43E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location TSS200 (cg02666489)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.08E+00 Statistic Test p-value: 1.97E-02; Z-score: -1.90E+00
Methylation in Case 6.54E-01 (Median) Methylation in Control 7.06E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location TSS200 (cg26939503)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.54E+00 Statistic Test p-value: 3.15E-20; Z-score: -4.08E+00
Methylation in Case 4.32E-01 (Median) Methylation in Control 6.67E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location TSS200 (cg06236276)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.32E+00 Statistic Test p-value: 1.62E-19; Z-score: -4.20E+00
Methylation in Case 5.03E-01 (Median) Methylation in Control 6.66E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location TSS200 (cg04294894)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.40E+00 Statistic Test p-value: 1.45E-16; Z-score: -3.33E+00
Methylation in Case 5.62E-01 (Median) Methylation in Control 7.89E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location TSS200 (cg19627213)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.51E+00 Statistic Test p-value: 8.30E-14; Z-score: -1.97E+00
Methylation in Case 3.98E-01 (Median) Methylation in Control 6.01E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location TSS200 (cg21755969)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.16E+00 Statistic Test p-value: 1.07E-08; Z-score: -2.33E+00
Methylation in Case 4.74E-01 (Median) Methylation in Control 5.52E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location TSS200 (cg02666489)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.07E+00 Statistic Test p-value: 5.03E-08; Z-score: -1.06E+00
Methylation in Case 6.99E-01 (Median) Methylation in Control 7.47E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in clear cell renal cell carcinoma [9]
Location TSS200 (cg04294894)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.10E+00 Statistic Test p-value: 3.59E-02; Z-score: -1.28E+00
Methylation in Case 6.05E-01 (Median) Methylation in Control 6.65E-01 (Median)
Studied Phenotype Clear cell renal cell carcinoma [ICD-11: 2C90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in hepatocellular carcinoma [12]
Location TSS200 (cg06236276)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.04E+00 Statistic Test p-value: 8.34E-03; Z-score: 1.72E-01
Methylation in Case 6.85E-01 (Median) Methylation in Control 6.60E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in HIV infection [13]
Location TSS200 (cg19627213)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.15E+00 Statistic Test p-value: 4.26E-06; Z-score: -1.45E+00
Methylation in Case 5.04E-01 (Median) Methylation in Control 5.80E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in HIV infection [13]
Location TSS200 (cg04294894)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 3.10E-03; Z-score: -6.46E-01
Methylation in Case 8.24E-01 (Median) Methylation in Control 8.48E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in HIV infection [13]
Location TSS200 (cg06236276)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 3.82E-02; Z-score: -4.79E-01
Methylation in Case 6.56E-01 (Median) Methylation in Control 6.77E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in lung adenocarcinoma [14]
Location TSS200 (cg19627213)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.12E+00 Statistic Test p-value: 3.43E-02; Z-score: -3.14E+00
Methylation in Case 5.50E-01 (Median) Methylation in Control 6.17E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in panic disorder [17]
Location TSS200 (cg04294894)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.08E+00 Statistic Test p-value: 3.35E-02; Z-score: 4.99E-01
Methylation in Case 2.72E+00 (Median) Methylation in Control 2.53E+00 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in panic disorder [17]
Location TSS200 (cg21755969)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.30E+00 Statistic Test p-value: 3.64E-02; Z-score: 4.24E-01
Methylation in Case 6.92E-01 (Median) Methylation in Control 5.31E-01 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location TSS200 (cg06236276)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 1.58E-06; Z-score: -1.16E+00
Methylation in Case 6.87E-01 (Median) Methylation in Control 7.30E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location TSS200 (cg26939503)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.05E+00 Statistic Test p-value: 2.36E-05; Z-score: -6.23E-01
Methylation in Case 6.43E-01 (Median) Methylation in Control 6.72E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location TSS200 (cg02666489)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.10E+00 Statistic Test p-value: 5.04E-05; Z-score: 1.73E+00
Methylation in Case 8.37E-01 (Median) Methylation in Control 7.62E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location TSS200 (cg19627213)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 3.42E-03; Z-score: -5.49E-01
Methylation in Case 6.66E-01 (Median) Methylation in Control 7.03E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location TSS200 (cg18335740)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.62E+00 Statistic Test p-value: 3.86E-03; Z-score: 3.84E+00
Methylation in Case 2.91E-01 (Median) Methylation in Control 1.80E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in systemic lupus erythematosus [16]
Location TSS200 (cg26939503)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 1.19E-03; Z-score: -2.66E-01
Methylation in Case 6.52E-01 (Median) Methylation in Control 6.72E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in systemic lupus erythematosus [16]
Location TSS200 (cg02666489)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 1.35E-02; Z-score: -2.51E-01
Methylation in Case 8.70E-01 (Median) Methylation in Control 8.77E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in systemic lupus erythematosus [16]
Location TSS200 (cg06236276)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 3.12E-02; Z-score: -1.25E-01
Methylation in Case 7.03E-01 (Median) Methylation in Control 7.11E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in atypical teratoid rhabdoid tumor [18]
Location 1stExon (cg13717233)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.49E+00 Statistic Test p-value: 2.58E-19; Z-score: -3.07E+00
Methylation in Case 5.11E-01 (Median) Methylation in Control 7.62E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in atypical teratoid rhabdoid tumor [18]
Location 1stExon (cg19561774)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.18E+00 Statistic Test p-value: 1.13E-17; Z-score: -2.79E+00
Methylation in Case 7.34E-01 (Median) Methylation in Control 8.65E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in atypical teratoid rhabdoid tumor [18]
Location 1stExon (cg27204616)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.36E+00 Statistic Test p-value: 9.27E-16; Z-score: -3.43E+00
Methylation in Case 5.38E-01 (Median) Methylation in Control 7.33E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location 1stExon (cg27204616)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 2.44E-03; Z-score: -4.31E+00
Methylation in Case 9.01E-01 (Median) Methylation in Control 9.52E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location 1stExon (cg19561774)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 2.75E-03; Z-score: -1.71E+00
Methylation in Case 8.25E-01 (Median) Methylation in Control 8.48E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location 1stExon (cg13717233)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 1.21E-02; Z-score: -1.31E+00
Methylation in Case 8.24E-01 (Median) Methylation in Control 8.45E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location 1stExon (cg13717233)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.11E+00 Statistic Test p-value: 5.12E-13; Z-score: -4.25E+00
Methylation in Case 7.54E-01 (Median) Methylation in Control 8.36E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location 1stExon (cg27204616)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.15E+00 Statistic Test p-value: 2.39E-12; Z-score: -6.29E+00
Methylation in Case 8.15E-01 (Median) Methylation in Control 9.36E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location 1stExon (cg19561774)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 1.15E-09; Z-score: -1.89E+00
Methylation in Case 7.54E-01 (Median) Methylation in Control 8.18E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in colorectal cancer [19]
Location 1stExon (cg19561774)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 8.06E-03; Z-score: -1.88E-01
Methylation in Case 9.48E-01 (Median) Methylation in Control 9.50E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in HIV infection [13]
Location 1stExon (cg19561774)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.03E+00 Statistic Test p-value: 2.37E-06; Z-score: 1.25E+00
Methylation in Case 8.94E-01 (Median) Methylation in Control 8.69E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location 1stExon (cg19561774)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 5.02E-09; Z-score: -1.47E+00
Methylation in Case 9.20E-01 (Median) Methylation in Control 9.37E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location 1stExon (cg27204616)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 1.60E-06; Z-score: -1.22E+00
Methylation in Case 9.01E-01 (Median) Methylation in Control 9.18E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location 1stExon (cg13717233)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 3.30E-06; Z-score: -9.37E-01
Methylation in Case 8.97E-01 (Median) Methylation in Control 9.11E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location 1stExon (cg08457872)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 3.39E-02; Z-score: 1.73E+00
Methylation in Case 9.01E-01 (Median) Methylation in Control 8.56E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in atypical teratoid rhabdoid tumor [18]
Location Body (cg02490934)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 1.67E-04; Z-score: -7.24E-01
Methylation in Case 8.91E-01 (Median) Methylation in Control 9.16E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in atypical teratoid rhabdoid tumor [18]
Location Body (cg03488613)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.33E+00 Statistic Test p-value: 3.52E-04; Z-score: -1.02E+00
Methylation in Case 5.67E-01 (Median) Methylation in Control 7.52E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in atypical teratoid rhabdoid tumor [18]
Location Body (cg04310488)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 7.00E-04; Z-score: -4.47E-01
Methylation in Case 7.84E-01 (Median) Methylation in Control 8.16E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in atypical teratoid rhabdoid tumor [18]
Location Body (cg07601258)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.06E+00 Statistic Test p-value: 4.49E-03; Z-score: 6.32E-01
Methylation in Case 9.30E-01 (Median) Methylation in Control 8.75E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location Body (cg14918008)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.32E+00 Statistic Test p-value: 8.47E-10; Z-score: 8.08E+00
Methylation in Case 7.69E-01 (Median) Methylation in Control 5.84E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location Body (cg04310488)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.66E+00 Statistic Test p-value: 1.06E-05; Z-score: -3.87E+00
Methylation in Case 3.84E-01 (Median) Methylation in Control 6.40E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location Body (cg02490934)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.48E+00 Statistic Test p-value: 1.13E-05; Z-score: -4.29E+00
Methylation in Case 4.75E-01 (Median) Methylation in Control 7.03E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in bladder cancer [7]
Location Body (cg07601258)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 3.33E-03; Z-score: -3.43E+00
Methylation in Case 8.79E-01 (Median) Methylation in Control 9.12E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location Body (cg17098387)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.30E+00 Statistic Test p-value: 6.95E-20; Z-score: -3.61E+00
Methylation in Case 5.59E-01 (Median) Methylation in Control 7.27E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location Body (cg04310488)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.34E+00 Statistic Test p-value: 5.15E-15; Z-score: -2.69E+00
Methylation in Case 5.64E-01 (Median) Methylation in Control 7.58E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location Body (cg14918008)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.13E+00 Statistic Test p-value: 2.00E-11; Z-score: -1.81E+00
Methylation in Case 6.82E-01 (Median) Methylation in Control 7.72E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location Body (cg03488613)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 8.15E-10; Z-score: -2.01E+00
Methylation in Case 8.03E-01 (Median) Methylation in Control 8.75E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location Body (cg07601258)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.05E+00 Statistic Test p-value: 2.64E-09; Z-score: -1.64E+00
Methylation in Case 8.43E-01 (Median) Methylation in Control 8.85E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in breast cancer [8]
Location Body (cg02490934)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.21E+00 Statistic Test p-value: 8.82E-03; Z-score: -1.05E+00
Methylation in Case 4.20E-01 (Median) Methylation in Control 5.09E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in clear cell renal cell carcinoma [9]
Location Body (cg02490934)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.28E+00 Statistic Test p-value: 3.42E-03; Z-score: -2.82E+00
Methylation in Case 4.94E-01 (Median) Methylation in Control 6.34E-01 (Median)
Studied Phenotype Clear cell renal cell carcinoma [ICD-11: 2C90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in clear cell renal cell carcinoma [9]
Location Body (cg07601258)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 6.36E-03; Z-score: -9.85E-01
Methylation in Case 7.68E-01 (Median) Methylation in Control 8.14E-01 (Median)
Studied Phenotype Clear cell renal cell carcinoma [ICD-11: 2C90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in colon adenocarcinoma [10]
Location Body (cg05672174)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 9.28E-05; Z-score: -2.18E+00
Methylation in Case 6.99E-01 (Median) Methylation in Control 7.60E-01 (Median)
Studied Phenotype Colon adenocarcinoma [ICD-11: 2B90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in colon adenocarcinoma [10]
Location Body (cg26907313)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.15E+00 Statistic Test p-value: 1.00E-03; Z-score: -3.03E+00
Methylation in Case 7.19E-01 (Median) Methylation in Control 8.25E-01 (Median)
Studied Phenotype Colon adenocarcinoma [ICD-11: 2B90]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in colorectal cancer [19]
Location Body (cg03488613)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.03E+00 Statistic Test p-value: 9.96E-03; Z-score: 9.12E-01
Methylation in Case 9.20E-01 (Median) Methylation in Control 8.94E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in colorectal cancer [19]
Location Body (cg07601258)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.01E+00 Statistic Test p-value: 2.47E-02; Z-score: 3.07E-01
Methylation in Case 9.45E-01 (Median) Methylation in Control 9.40E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in hepatocellular carcinoma [12]
Location Body (cg10473100)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.24E+00 Statistic Test p-value: 6.30E-12; Z-score: -1.29E+01
Methylation in Case 7.82E-01 (Median) Methylation in Control 9.73E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in hepatocellular carcinoma [12]
Location Body (cg08793936)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.26E+00 Statistic Test p-value: 1.84E-10; Z-score: -3.25E+00
Methylation in Case 5.62E-01 (Median) Methylation in Control 7.09E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in hepatocellular carcinoma [12]
Location Body (cg04310488)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.46E+00 Statistic Test p-value: 1.36E-06; Z-score: -1.32E+00
Methylation in Case 2.63E-01 (Median) Methylation in Control 3.84E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in hepatocellular carcinoma [12]
Location Body (cg14918008)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 3.70E-03; Z-score: -7.65E-01
Methylation in Case 8.01E-01 (Median) Methylation in Control 8.19E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in hepatocellular carcinoma [12]
Location Body (cg17098387)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.07E+00 Statistic Test p-value: 4.77E-03; Z-score: 4.43E-01
Methylation in Case 7.81E-01 (Median) Methylation in Control 7.33E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in hepatocellular carcinoma [12]
Location Body (cg07601258)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 1.45E-02; Z-score: -3.44E-01
Methylation in Case 8.71E-01 (Median) Methylation in Control 8.80E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in HIV infection [13]
Location Body (cg17098387)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.08E+00 Statistic Test p-value: 2.08E-04; Z-score: -1.02E+00
Methylation in Case 6.62E-01 (Median) Methylation in Control 7.17E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in HIV infection [13]
Location Body (cg02490934)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.08E+00 Statistic Test p-value: 2.97E-04; Z-score: -1.08E+00
Methylation in Case 7.76E-01 (Median) Methylation in Control 8.34E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in lung adenocarcinoma [14]
Location Body (cg17098387)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.11E+00 Statistic Test p-value: 2.72E-02; Z-score: -3.43E+00
Methylation in Case 6.86E-01 (Median) Methylation in Control 7.62E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in pancretic ductal adenocarcinoma [20]
Location Body (cg12933431)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.26E+00 Statistic Test p-value: 1.75E-03; Z-score: 1.32E+00
Methylation in Case 6.71E-01 (Median) Methylation in Control 5.32E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location Body (cg02490934)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.07E+00 Statistic Test p-value: 7.43E-06; Z-score: -1.20E+00
Methylation in Case 7.82E-01 (Median) Methylation in Control 8.36E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in papillary thyroid cancer [15]
Location Body (cg07601258)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 8.06E-04; Z-score: -2.45E-01
Methylation in Case 9.40E-01 (Median) Methylation in Control 9.43E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location Body (cg06635952)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 3.11E+00 Statistic Test p-value: 4.23E-03; Z-score: 1.29E+01
Methylation in Case 6.50E-01 (Median) Methylation in Control 2.09E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location Body (cg06145736)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.21E+00 Statistic Test p-value: 6.78E-03; Z-score: 2.70E+00
Methylation in Case 8.80E-01 (Median) Methylation in Control 7.29E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location Body (cg25575590)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.39E+00 Statistic Test p-value: 8.54E-03; Z-score: -1.19E+01
Methylation in Case 6.48E-01 (Median) Methylation in Control 9.02E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location Body (cg15930240)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.33E+00 Statistic Test p-value: 1.08E-02; Z-score: 1.96E+00
Methylation in Case 7.95E-01 (Median) Methylation in Control 5.98E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location Body (cg00551954)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 1.29E-02; Z-score: 2.04E+00
Methylation in Case 9.33E-01 (Median) Methylation in Control 8.85E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location Body (cg10665321)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.45E+00 Statistic Test p-value: 2.95E-02; Z-score: 2.02E+00
Methylation in Case 6.35E-01 (Median) Methylation in Control 4.38E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location Body (cg22931795)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.51E+00 Statistic Test p-value: 4.02E-02; Z-score: -2.37E+00
Methylation in Case 4.12E-01 (Median) Methylation in Control 6.20E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location Body (cg04954559)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.79E+00 Statistic Test p-value: 4.95E-02; Z-score: 4.75E+00
Methylation in Case 1.41E-01 (Median) Methylation in Control 7.88E-02 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in systemic lupus erythematosus [16]
Location Body (cg07601258)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 5.79E-03; Z-score: -2.06E-01
Methylation in Case 9.24E-01 (Median) Methylation in Control 9.28E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in systemic lupus erythematosus [16]
Location Body (cg17098387)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 7.48E-03; Z-score: -1.85E-01
Methylation in Case 6.55E-01 (Median) Methylation in Control 6.69E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in systemic lupus erythematosus [16]
Location Body (cg02490934)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 3.70E-02; Z-score: -1.77E-01
Methylation in Case 7.69E-01 (Median) Methylation in Control 7.85E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in hepatocellular carcinoma [12]
Location 3'UTR (cg04092332)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.16E+00 Statistic Test p-value: 5.29E-11; Z-score: -4.69E+00
Methylation in Case 7.42E-01 (Median) Methylation in Control 8.63E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of SLC22A2 in prostate cancer [6]
Location 3'UTR (cg09888840)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.06E+00 Statistic Test p-value: 8.80E-03; Z-score: 3.47E+00
Methylation in Case 9.35E-01 (Median) Methylation in Control 8.81E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Hypoacetylation of SLC22A2 in renal cell carcinoma [21]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of SLC22A2 Experiment Method RT-qPCR
Studied Phenotype Renal cell carcinoma [ICD-11: 2C90]
Experimental Material Patients samples of human; Multiple cell lines of human
Additional Notes Combined treatment using the DNA methylation inhibitor decitabine and the histone deacetylase inhibitor vorinostat significantly increased the expression of OCT2 in RCC cell lines, which sensitized these cells to oxaliplatin.
Epigenetic Phenomenon Hypoacetylation of SLC22A2 in renal cell carcinoma [21]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Down regulation of SLC22A2 Experiment Method RT-qPCR
Studied Phenotype Renal cell carcinoma [ICD-11: 2C90]
Experimental Material Patients samples of human; Multiple cell lines of human
Additional Notes Combined treatment using the DNA methylation inhibitor decitabine and the histone deacetylase inhibitor vorinostat significantly increased the expression of OCT2 in RCC cell lines, which sensitized these cells to oxaliplatin.
Epigenetic Phenomenon miR-21 silencing increased SLC22A2 expression [22]
Epigenetic Type microRNA Experiment Method .
Related Molecular Changes Down regulation of SLC22A2 Experiment Method RT-qPCR
miRNA Stemloop ID miR-21 miRNA Mature ID miR-21-5p
miRNA Sequence UAGCUUAUCAGACUGAUGUUGA
miRNA Target Type Unknown
Studied Phenotype Renal cancer [ICD-11: 2C90]
Experimental Material Multiple cell lines of human
Additional Notes Targeting miR-21 decreases expression of SLC22A2 and promotes chemosensitivity of renal carcinoma.
Epigenetic Phenomenon miR-335 directly targets SLC22A2 [23]
Epigenetic Type microRNA Experiment Method Microarray
miRNA Stemloop ID miR-335 miRNA Mature ID miR-335-5p
miRNA Sequence UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
References
1 Kidney-specific expression of human organic cation transporter 2 (OCT2/SLC22A2) is regulated by DNA methylation. Am J Physiol Renal Physiol. 2008 Jul;295(1):F165-70.
2 Epigenetic activation of the drug transporter OCT2 sensitizes renal cell carcinoma to oxaliplatin. Sci Transl Med. 2016 Jul 20;8(348):348ra97.
3 Long-term cisplatin exposure promotes methylation of the OCT1 gene in human esophageal cancer cells. Dig Dis Sci. 2013 Mar;58(3):694-8.
4 Epigenetic events involved in organic cation transporter 1-dependent impaired response of hepatocellular carcinoma to sorafenib. Br J Pharmacol. 2019 Mar;176(6):787-800.
5 Methylomes of renal cell lines and tumors or metastases differ significantly with impact on pharmacogenes. Sci Rep. 2016 Jul 20;6:29930.
6 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
7 DNA Methylation Dynamics in Urological Tumors.
8 Genome-wide Scan for Methylation Profiles in Breast Cancer
9 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
10 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
11 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
12 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
13 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
14 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
15 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
16 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
17 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
18 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
19 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
20 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
21 Regulation of OCT2 transcriptional repression by histone acetylation in renal cell carcinoma. Epigenetics. 2019 May 15:1-13.
22 Targeting miR-21 decreases expression of multi-drug resistant genes and promotes chemosensitivity of renal carcinoma. Tumour Biol. 2017 Jul;39(7):1010428317707372.
23 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.