General Information of Drug Transporter (DT)
DT ID DTD0012 Transporter Info
Gene Name ABCC3
Transporter Name Multidrug resistance-associated protein 3
Gene ID
8714
UniProt ID
O15438
Epigenetic Regulations of This DT (ERD)
Epigenetic Phenomenon Hypermethylation of ABCC3 in ischemic stroke [1]
Location Promoter
Epigenetic Type Methylation Experiment Method Bisulfite pyrosequencing
Related Molecular Changes Down regulation of ABCC3 Experiment Method RT-qPCR
Studied Phenotype Ischemic stroke [ICD-11: 8B11]
Experimental Material Chinese patient tissue samples
Additional Notes The ABCC3 promoter methylation status in 87 clinical samples from patients correlated inversely with the expression of ABCC3 (R = - 0.854, P < 0.001).
Epigenetic Phenomenon Methylation of ABCC3 in atypical teratoid rhabdoid tumor [2]
Location Body (cg04433051)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.13E+00 Statistic Test p-value: 7.58E-04; Z-score: -5.83E-01
Methylation in Case 4.95E-01 (Median) Methylation in Control 5.57E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in bladder cancer [3]
Location Body (cg04433051)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 2.46E+00 Statistic Test p-value: 1.95E-08; Z-score: 8.30E+00
Methylation in Case 4.96E-01 (Median) Methylation in Control 2.01E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in bladder cancer [3]
Location Body (cg18312989)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.08E+00 Statistic Test p-value: 3.05E-02; Z-score: 2.04E+00
Methylation in Case 5.35E-01 (Median) Methylation in Control 4.94E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in colorectal cancer [4]
Location Body (cg18426477)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.26E+00 Statistic Test p-value: 3.14E-08; Z-score: -2.14E+00
Methylation in Case 5.59E-01 (Median) Methylation in Control 7.06E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in colorectal cancer [4]
Location Body (cg18312989)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 3.06E-03; Z-score: -6.74E-01
Methylation in Case 7.07E-01 (Median) Methylation in Control 7.48E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in hepatocellular carcinoma [5]
Location Body (cg04433051)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.31E+00 Statistic Test p-value: 5.88E-05; Z-score: 1.73E+00
Methylation in Case 5.09E-01 (Median) Methylation in Control 3.88E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in hepatocellular carcinoma [5]
Location Body (cg18312989)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 4.43E-03; Z-score: -9.28E-01
Methylation in Case 5.35E-01 (Median) Methylation in Control 5.84E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in HIV infection [6]
Location Body (cg18312989)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.12E+00 Statistic Test p-value: 5.64E-05; Z-score: -1.94E+00
Methylation in Case 6.65E-01 (Median) Methylation in Control 7.42E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in HIV infection [6]
Location Body (cg18426477)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 8.88E-04; Z-score: -1.01E+00
Methylation in Case 8.21E-01 (Median) Methylation in Control 8.53E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in HIV infection [6]
Location Body (cg19734752)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.01E+00 Statistic Test p-value: 1.36E-02; Z-score: 4.88E-01
Methylation in Case 8.82E-01 (Median) Methylation in Control 8.73E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in HIV infection [6]
Location Body (cg04433051)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.09E+00 Statistic Test p-value: 2.00E-02; Z-score: 7.45E-01
Methylation in Case 1.81E-01 (Median) Methylation in Control 1.66E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in panic disorder [7]
Location Body (cg18312989)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.16E+00 Statistic Test p-value: 4.66E-03; Z-score: 5.04E-01
Methylation in Case 1.42E+00 (Median) Methylation in Control 1.22E+00 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in papillary thyroid cancer [8]
Location Body (cg19734752)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.19E+00 Statistic Test p-value: 6.96E-13; Z-score: -3.05E+00
Methylation in Case 6.72E-01 (Median) Methylation in Control 7.99E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in papillary thyroid cancer [8]
Location Body (cg04433051)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.24E+00 Statistic Test p-value: 9.38E-10; Z-score: 2.19E+00
Methylation in Case 5.71E-01 (Median) Methylation in Control 4.59E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in prostate cancer [9]
Location Body (cg13117272)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.43E+00 Statistic Test p-value: 1.10E-02; Z-score: -2.30E+00
Methylation in Case 4.12E-01 (Median) Methylation in Control 5.90E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in atypical teratoid rhabdoid tumor [2]
Location 3'UTR (cg14592673)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.42E+00 Statistic Test p-value: 4.54E-11; Z-score: -1.64E+00
Methylation in Case 4.37E-01 (Median) Methylation in Control 6.20E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in bladder cancer [3]
Location 3'UTR (cg14592673)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -3.13E+00 Statistic Test p-value: 7.89E-13; Z-score: -1.21E+01
Methylation in Case 2.17E-01 (Median) Methylation in Control 6.82E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in breast cancer [10]
Location 3'UTR (cg14592673)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.36E+00 Statistic Test p-value: 1.02E-13; Z-score: -2.58E+00
Methylation in Case 4.63E-01 (Median) Methylation in Control 6.31E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in HIV infection [6]
Location 3'UTR (cg14592673)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 4.00E-02; Z-score: -4.87E-01
Methylation in Case 8.01E-01 (Median) Methylation in Control 8.18E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC3 in papillary thyroid cancer [8]
Location 3'UTR (cg14592673)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.09E+00 Statistic Test p-value: 6.76E-10; Z-score: -1.71E+00
Methylation in Case 7.18E-01 (Median) Methylation in Control 7.79E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon miR-9* regulates ABCC3 expression [11]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCC3 Experiment Method RT-qPCR
miRNA Stemloop ID miR-9* miRNA Mature ID Unclear
miRNA Target Type Indirect(ID4; miR-9*; SOX2; ABCC3)
Studied Phenotype Glioma [ICD-11: 2A00.0]
Experimental Material Multiple cell lines of human
Additional Notes ID4-miR-9*-SOX2-ABCC3/ABCC6 regulatory pathway is recapitulated in glioma stem cells derived from patients with glioma.
Epigenetic Phenomenon miR-124 directly targets ABCC3 [12]
Epigenetic Type microRNA Experiment Method Microarray
miRNA Stemloop ID miR-124 miRNA Mature ID miR-124-3p
miRNA Sequence UAAGGCACGCGGUGAAUGCCAA
miRNA Target Type Direct
Experimental Material Human cervical cancer cell line (Hela)
Epigenetic Phenomenon miR-192 directly targets ABCC3 [13]
Epigenetic Type microRNA Experiment Method Microarray
miRNA Stemloop ID miR-192 miRNA Mature ID miR-192-5p
miRNA Sequence CUGACCUAUGAAUUGACAGCC
miRNA Target Type Direct
Experimental Material Patient tissue samples
Epigenetic Phenomenon miR-197 directly targets ABCC3 [13]
Epigenetic Type microRNA Experiment Method Microarray
miRNA Stemloop ID miR-197 miRNA Mature ID miR-197-3p
miRNA Sequence UUCACCACCUUCUCCACCCAGC
miRNA Target Type Direct
Experimental Material Patient tissue samples
Epigenetic Phenomenon miR-335 directly targets ABCC3 [14]
Epigenetic Type microRNA Experiment Method Microarray
miRNA Stemloop ID miR-335 miRNA Mature ID miR-335-5p
miRNA Sequence UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
References
1 The association of ABCC3 promoter methylation with clopidogrel response in Chinese ischemic stroke patients. Pharmazie. 2014 Oct;69(10):764-8.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10 Genome-wide Scan for Methylation Profiles in Breast Cancer
11 ID4 imparts chemoresistance and cancer stemness to glioma cells by derepressing miR-9*-mediated suppression of SOX2. Cancer Res. 2011 May 1;71(9):3410-21.
12 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
13 A limited set of human MicroRNA is deregulated in follicular thyroid carcinoma. J Clin Endocrinol Metab. 2006 Sep;91(9):3584-91.
14 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.