General Information of Drug Transporter (DT)
DT ID DTD0014 Transporter Info
Gene Name ABCB11
Transporter Name Bile salt export pump
Gene ID
8647
UniProt ID
O95342
Epigenetic Regulations of This DT (ERD)
Epigenetic Phenomenon Methylation of ABCB11 in atypical teratoid rhabdoid tumor [1]
Location 5'UTR (cg20118424)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.31E+00 Statistic Test p-value: 3.94E-06; Z-score: -1.18E+00
Methylation in Case 6.35E-01 (Median) Methylation in Control 8.30E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in hepatocellular carcinoma [2]
Location 5'UTR (cg20118424)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.23E+00 Statistic Test p-value: 1.15E-02; Z-score: -1.10E+00
Methylation in Case 5.05E-01 (Median) Methylation in Control 6.23E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in bladder cancer [3]
Location TSS1500 (cg21346679)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.10E+00 Statistic Test p-value: 4.64E-04; Z-score: -2.82E+00
Methylation in Case 7.37E-01 (Median) Methylation in Control 8.13E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in breast cancer [4]
Location TSS1500 (cg21346679)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 7.95E-03; Z-score: 3.70E-01
Methylation in Case 6.47E-01 (Median) Methylation in Control 6.14E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in colorectal cancer [5]
Location TSS1500 (cg21346679)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 6.19E-05; Z-score: -1.12E+00
Methylation in Case 8.36E-01 (Median) Methylation in Control 8.73E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in depression [6]
Location TSS1500 (cg21346679)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 3.32E-02; Z-score: -3.84E-01
Methylation in Case 7.84E-01 (Median) Methylation in Control 7.98E-01 (Median)
Studied Phenotype Depression [ICD-11: 6A8Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in hepatocellular carcinoma [2]
Location TSS1500 (cg21346679)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.26E+00 Statistic Test p-value: 5.16E-06; Z-score: -1.78E+00
Methylation in Case 4.50E-01 (Median) Methylation in Control 5.68E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in HIV infection [7]
Location TSS1500 (cg21346679)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 1.05E-02; Z-score: -1.15E+00
Methylation in Case 8.60E-01 (Median) Methylation in Control 9.09E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in panic disorder [8]
Location TSS1500 (cg21346679)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.59E+00 Statistic Test p-value: 1.88E-02; Z-score: 4.76E-01
Methylation in Case 5.24E-01 (Median) Methylation in Control 3.29E-01 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in papillary thyroid cancer [9]
Location TSS1500 (cg21346679)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 3.55E-02; Z-score: -1.96E-01
Methylation in Case 7.91E-01 (Median) Methylation in Control 8.02E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in prostate cancer [10]
Location TSS1500 (cg03371125)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.15E+00 Statistic Test p-value: 2.25E-02; Z-score: 2.26E+00
Methylation in Case 8.26E-01 (Median) Methylation in Control 7.17E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in bladder cancer [3]
Location TSS200 (cg00295325)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.13E+00 Statistic Test p-value: 6.50E-04; Z-score: 3.89E+00
Methylation in Case 7.08E-01 (Median) Methylation in Control 6.26E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in breast cancer [4]
Location TSS200 (cg00295325)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.19E+00 Statistic Test p-value: 8.05E-11; Z-score: 1.61E+00
Methylation in Case 6.01E-01 (Median) Methylation in Control 5.07E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in colorectal cancer [5]
Location TSS200 (cg00295325)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 1.05E-02; Z-score: -3.98E-01
Methylation in Case 8.20E-01 (Median) Methylation in Control 8.35E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in hepatocellular carcinoma [2]
Location TSS200 (cg00295325)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.45E+00 Statistic Test p-value: 2.27E-05; Z-score: -1.71E+00
Methylation in Case 2.98E-01 (Median) Methylation in Control 4.32E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in papillary thyroid cancer [9]
Location TSS200 (cg00295325)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 4.17E-03; Z-score: 9.36E-01
Methylation in Case 7.76E-01 (Median) Methylation in Control 7.37E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in systemic lupus erythematosus [11]
Location TSS200 (cg00295325)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 4.16E-04; Z-score: -3.52E-01
Methylation in Case 8.17E-01 (Median) Methylation in Control 8.40E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in bladder cancer [3]
Location Body (cg24334048)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.65E+00 Statistic Test p-value: 1.41E-08; Z-score: -1.19E+01
Methylation in Case 4.59E-01 (Median) Methylation in Control 7.59E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in colorectal cancer [5]
Location Body (cg24334048)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 5.26E-05; Z-score: -1.37E+00
Methylation in Case 8.93E-01 (Median) Methylation in Control 9.21E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in hepatocellular carcinoma [2]
Location Body (cg24334048)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 4.08E-02; Z-score: -3.21E-01
Methylation in Case 8.08E-01 (Median) Methylation in Control 8.28E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in HIV infection [7]
Location Body (cg24334048)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 3.06E-02; Z-score: -4.50E-01
Methylation in Case 8.61E-01 (Median) Methylation in Control 8.83E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in pancretic ductal adenocarcinoma [12]
Location Body (cg04208466)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 1.54E-03; Z-score: -1.11E-01
Methylation in Case 8.86E-01 (Median) Methylation in Control 8.88E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in atypical teratoid rhabdoid tumor [1]
Location 3'UTR (cg08997639)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.55E+00 Statistic Test p-value: 7.61E-13; Z-score: 2.08E+00
Methylation in Case 6.38E-01 (Median) Methylation in Control 4.12E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in bladder cancer [3]
Location 3'UTR (cg08997639)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 4.22E-02; Z-score: -9.56E-02
Methylation in Case 8.88E-01 (Median) Methylation in Control 8.90E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCB11 in panic disorder [8]
Location 3'UTR (cg08997639)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.07E+00 Statistic Test p-value: 1.16E-02; Z-score: 6.15E-01
Methylation in Case 2.96E+00 (Median) Methylation in Control 2.76E+00 (Median)
Studied Phenotype Panic disorder [ICD-11: 6B01]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Hyperacetylation of Abcb11 in liver (compare with kidney and cerebrum cells) [13]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Up regulation of Abcb11 Experiment Method RT-qPCR
Studied Phenotype Rat liver
Experimental Material Model organism in vivo (mouse)
Additional Notes The histone H3 associated with Oatp1b2 promoters was hyperacetylated in the liver but was acetylated very little in the kidney and cerebrum.
Epigenetic Phenomenon miR-33 downregulates ABCB11 expression [14]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCB11 Experiment Method RT-qPCR
miRNA Stemloop ID miR-33 miRNA Mature ID Unclear
miRNA Target Type Direct
Studied Phenotype Rat hepatocytes
Experimental Material Model organism in vivo (mouse); Human hepato cellular carcinoma cell line (HuH-7)
Additional Notes miR-33 controls the expression of biliary transporters, and mediates statin- and diet-induced hepatotoxicity via downregulates of ABCB11 expression.
Epigenetic Phenomenon miR-1266 directly targets ABCB11 [15]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-1266 miRNA Mature ID miR-1266-3p
miRNA Sequence CCCUGUUCUAUGCCCUGAGGGA
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-138-2 directly targets ABCB11 [15]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-138-2 miRNA Mature ID miR-138-2-3p
miRNA Sequence GCUAUUUCACGACACCAGGGUU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-1538 directly targets ABCB11 [16]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-1538 miRNA Mature ID miR-1538
miRNA Sequence CGGCCCGGGCUGCUGCUGUUCCU
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-3074 directly targets ABCB11 [15]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-3074 miRNA Mature ID miR-3074-5p
miRNA Sequence GUUCCUGCUGAACUGAGCCAG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-33a directly targets ABCB11 [14]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay//qRT-PCR
miRNA Stemloop ID miR-33a miRNA Mature ID miR-33a-5p
miRNA Sequence GUGCAUUGUAGUUGCAUUGCA
miRNA Target Type Direct
Experimental Material Model organism in vivo (mouse); Human hepato cellular carcinoma cell line (HuH-7)
Epigenetic Phenomenon miR-4307 directly targets ABCB11 [15]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-4307 miRNA Mature ID miR-4307
miRNA Sequence AAUGUUUUUUCCUGUUUCC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-4433a directly targets ABCB11 [16]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4433a miRNA Mature ID miR-4433a-3p
miRNA Sequence ACAGGAGUGGGGGUGGGACAU
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-4433b directly targets ABCB11 [16]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4433b miRNA Mature ID miR-4433b-3p
miRNA Sequence CAGGAGUGGGGGGUGGGACGU
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-449b directly targets ABCB11 [16]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-449b miRNA Mature ID miR-449b-3p
miRNA Sequence CAGCCACAACUACCCUGCCACU
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-4700 directly targets ABCB11 [16]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4700 miRNA Mature ID miR-4700-3p
miRNA Sequence CACAGGACUGACUCCUCACCCCAGUG
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-4745 directly targets ABCB11 [16]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4745 miRNA Mature ID miR-4745-3p
miRNA Sequence UGGCCCGGCGACGUCUCACGGUC
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-6504 directly targets ABCB11 [16]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6504 miRNA Mature ID miR-6504-3p
miRNA Sequence CAUUACAGCACAGCCAUUCU
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-6720 directly targets ABCB11 [16]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6720 miRNA Mature ID miR-6720-3p
miRNA Sequence CGCGCCUGCAGGAACUGGUAGA
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-6807 directly targets ABCB11 [16]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6807 miRNA Mature ID miR-6807-5p
miRNA Sequence GUGAGCCAGUGGAAUGGAGAGG
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-7151 directly targets ABCB11 [16]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-7151 miRNA Mature ID miR-7151-3p
miRNA Sequence CUACAGGCUGGAAUGGGCUCA
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-7152 directly targets ABCB11 [15]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-7152 miRNA Mature ID miR-7152-5p
miRNA Sequence UUUCCUGUCCUCCAACCAGACC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
13 Analysis of DNA methylation and histone modification profiles of liver-specific transporters. Mol Pharmacol. 2009 Mar;75(3):568-76.
14 miR-33 controls the expression of biliary transporters, and mediates statin- and diet-induced hepatotoxicity. EMBO Mol Med. 2012 Sep;4(9):882-95.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
16 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.