General Information of Drug Transporter (DT)
DT ID DTD0016 Transporter Info
Gene Name ABCC5
Transporter Name Multidrug resistance-associated protein 5
Gene ID
10057
UniProt ID
O15440
Epigenetic Regulations of This DT (ERD)
Epigenetic Phenomenon Hypermethylation of ABCC5 in nasopharyngeal cancer (compare to taxol-resistance counterpart cells) [1]
Epigenetic Type Methylation Experiment Method Methylation-specific PCR
Related Molecular Changes Down regulation of ABCC5 Experiment Method RT-qPCR
Studied Phenotype Nasopharyngeal carcinoma [ICD-11: 2B6B]
Experimental Material Multiple cell lines of human
Additional Notes ABCC5 is hypomethylated and upregulated 1.6 fold in taxol-resistant nasopharyngreal carcinoma cell lines.
Epigenetic Phenomenon Methylation of ABCC5 in pancretic ductal adenocarcinoma [2]
Location 5'UTR (cg25285433)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.17E+00 Statistic Test p-value: 4.51E-03; Z-score: 1.22E+00
Methylation in Case 7.12E-01 (Median) Methylation in Control 6.10E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in prostate cancer [3]
Location TSS1500 (cg25468058)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.02E+00 Statistic Test p-value: 3.84E-02; Z-score: 1.49E+00
Methylation in Case 9.40E-01 (Median) Methylation in Control 9.20E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in atypical teratoid rhabdoid tumor [4]
Location Body (cg02915290)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.04E+00 Statistic Test p-value: 2.36E-04; Z-score: 6.68E-01
Methylation in Case 9.31E-01 (Median) Methylation in Control 8.97E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in atypical teratoid rhabdoid tumor [4]
Location Body (cg03176305)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.36E+00 Statistic Test p-value: 2.59E-04; Z-score: -7.27E-01
Methylation in Case 1.12E-01 (Median) Methylation in Control 1.53E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in atypical teratoid rhabdoid tumor [4]
Location Body (cg13341498)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.03E+00 Statistic Test p-value: 3.41E-02; Z-score: 6.70E-01
Methylation in Case 8.74E-01 (Median) Methylation in Control 8.49E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in atypical teratoid rhabdoid tumor [4]
Location Body (cg13435758)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.01E+00 Statistic Test p-value: 3.61E-02; Z-score: 4.25E-01
Methylation in Case 9.12E-01 (Median) Methylation in Control 9.02E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in atypical teratoid rhabdoid tumor [4]
Location Body (cg14652434)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 4.90E-02; Z-score: -3.50E-01
Methylation in Case 7.97E-01 (Median) Methylation in Control 8.21E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in bladder cancer [5]
Location Body (cg15127656)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.24E+00 Statistic Test p-value: 1.14E-07; Z-score: -6.58E+00
Methylation in Case 7.09E-01 (Median) Methylation in Control 8.78E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in bladder cancer [5]
Location Body (cg02915290)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 1.38E-04; Z-score: -3.13E+00
Methylation in Case 9.66E-01 (Median) Methylation in Control 9.74E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in bladder cancer [5]
Location Body (cg14652434)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 5.97E-03; Z-score: -1.51E+00
Methylation in Case 9.81E-01 (Median) Methylation in Control 9.84E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in breast cancer [6]
Location Body (cg15127656)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.06E+00 Statistic Test p-value: 7.19E-09; Z-score: -1.47E+00
Methylation in Case 8.40E-01 (Median) Methylation in Control 8.89E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in breast cancer [6]
Location Body (cg03176305)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 1.55E-04; Z-score: -7.86E-01
Methylation in Case 7.35E-01 (Median) Methylation in Control 7.57E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in breast cancer [6]
Location Body (cg18478891)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 2.84E-03; Z-score: -5.91E-01
Methylation in Case 8.09E-01 (Median) Methylation in Control 8.26E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in breast cancer [6]
Location Body (cg13435758)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 1.57E-02; Z-score: -5.09E-01
Methylation in Case 8.34E-01 (Median) Methylation in Control 8.44E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in colorectal cancer [7]
Location Body (cg15127656)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 4.33E-02; Z-score: -1.38E-01
Methylation in Case 9.12E-01 (Median) Methylation in Control 9.15E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in hepatocellular carcinoma [8]
Location Body (cg15127656)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 6.79E-05; Z-score: -7.07E-01
Methylation in Case 8.16E-01 (Median) Methylation in Control 8.41E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in HIV infection [9]
Location Body (cg14652434)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 9.88E-03; Z-score: -5.92E-01
Methylation in Case 9.90E-01 (Median) Methylation in Control 9.93E-01 (Median)
Studied Phenotype HIV infection [ICD-11: 1C62.Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in pancretic ductal adenocarcinoma [2]
Location Body (cg11360755)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.17E+00 Statistic Test p-value: 1.56E-06; Z-score: 1.56E+00
Methylation in Case 7.72E-01 (Median) Methylation in Control 6.59E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in pancretic ductal adenocarcinoma [2]
Location Body (cg14331316)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.27E+00 Statistic Test p-value: 2.36E-04; Z-score: 1.16E+00
Methylation in Case 7.92E-01 (Median) Methylation in Control 6.25E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in papillary thyroid cancer [10]
Location Body (cg13341498)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 4.84E-02; Z-score: -5.17E-01
Methylation in Case 9.36E-01 (Median) Methylation in Control 9.42E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in systemic lupus erythematosus [11]
Location Body (cg15732221)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.03E+00 Statistic Test p-value: 2.90E-02; Z-score: 1.92E-01
Methylation in Case 4.47E-01 (Median) Methylation in Control 4.35E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in systemic lupus erythematosus [11]
Location Body (cg14652434)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 3.45E-02; Z-score: -1.36E-02
Methylation in Case 9.77E-01 (Median) Methylation in Control 9.78E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in atypical teratoid rhabdoid tumor [4]
Location 3'UTR (cg18728109)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.46E+00 Statistic Test p-value: 2.06E-10; Z-score: 1.73E+00
Methylation in Case 6.70E-01 (Median) Methylation in Control 4.58E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in atypical teratoid rhabdoid tumor [4]
Location 3'UTR (cg22599229)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.62E+00 Statistic Test p-value: 6.49E-10; Z-score: -1.46E+00
Methylation in Case 3.57E-01 (Median) Methylation in Control 5.77E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in atypical teratoid rhabdoid tumor [4]
Location 3'UTR (cg24375736)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -2.15E+00 Statistic Test p-value: 1.43E-09; Z-score: -1.79E+00
Methylation in Case 1.86E-01 (Median) Methylation in Control 3.99E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in bladder cancer [5]
Location 3'UTR (cg24375736)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.02E+00 Statistic Test p-value: 8.03E-03; Z-score: -2.15E+00
Methylation in Case 8.58E-01 (Median) Methylation in Control 8.79E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in bladder cancer [5]
Location 3'UTR (cg18728109)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 1.41E-02; Z-score: -8.72E-01
Methylation in Case 8.76E-01 (Median) Methylation in Control 8.86E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in bladder cancer [5]
Location 3'UTR (cg22599229)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 2.12E-02; Z-score: -5.30E-01
Methylation in Case 8.43E-01 (Median) Methylation in Control 8.51E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in breast cancer [6]
Location 3'UTR (cg22599229)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 2.22E-03; Z-score: -5.91E-01
Methylation in Case 8.55E-01 (Median) Methylation in Control 8.66E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC5 in pancretic ductal adenocarcinoma [2]
Location 3'UTR (cg10024478)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.44E+00 Statistic Test p-value: 3.59E-04; Z-score: 1.30E+00
Methylation in Case 5.88E-01 (Median) Methylation in Control 4.08E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon miR-129-5p downregulates of ABCC5 in gastric cancer [12]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCC5 Experiment Method Western Blot
miRNA Stemloop ID miR-129 miRNA Mature ID miR-129-5p
miRNA Sequence CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type Direct
Studied Phenotype Gastric cancer [ICD-11: 2B72]
Experimental Material Human gastric adenocarcinoma cell line (SGC7901)
Additional Notes miR-129-5p regulates ABCC5 expression in vivo at the post-transcriptional level.
Epigenetic Phenomenon miR-1199 directly targets ABCC5 [13]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-1199 miRNA Mature ID miR-1199-3p
miRNA Sequence UGCGGCCGGUGCUCAACCUGC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-1224 directly targets ABCC5 [14]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-1224 miRNA Mature ID miR-1224-3p
miRNA Sequence CCCCACCUCCUCUCUCCUCAG
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-1226 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-1226 miRNA Mature ID miR-1226-5p
miRNA Sequence GUGAGGGCAUGCAGGCCUGGAUGGGG
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-1229 directly targets ABCC5 [16]
Epigenetic Type microRNA Experiment Method CLASH
miRNA Stemloop ID miR-1229 miRNA Mature ID miR-1229-3p
miRNA Sequence CUCUCACCACUGCCCUCCCACAG
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-1273h directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-1273h miRNA Mature ID miR-1273h-3p
miRNA Sequence CUGCAGACUCGACCUCCCAGGC
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-129 directly targets ABCC5 [12]
Epigenetic Type microRNA Experiment Method Immunohistochemistry//Luciferase reporter assay//Microarray//qRT-PCR//Western blot
miRNA Stemloop ID miR-129 miRNA Mature ID miR-129-5p
miRNA Sequence CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type Direct
Experimental Material Human gastric adenocarcinoma cell line (SGC7901)
Epigenetic Phenomenon miR-1304 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-1304 miRNA Mature ID miR-1304-5p
miRNA Sequence UUUGAGGCUACAGUGAGAUGUG
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-1343 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-1343 miRNA Mature ID miR-1343-5p
miRNA Sequence UGGGGAGCGGCCCCCGGGUGGG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-185 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-185 miRNA Mature ID miR-185-3p
miRNA Sequence AGGGGCUGGCUUUCCUCUGGUC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-185 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-185 miRNA Mature ID miR-185-5p
miRNA Sequence UGGAGAGAAAGGCAGUUCCUGA
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-188 directly targets ABCC5 [16]
Epigenetic Type microRNA Experiment Method CLASH
miRNA Stemloop ID miR-188 miRNA Mature ID miR-188-5p
miRNA Sequence CAUCCCUUGCAUGGUGGAGGG
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-1914 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-1914 miRNA Mature ID miR-1914-3p
miRNA Sequence GGAGGGGUCCCGCACUGGGAGG
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-2467 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-2467 miRNA Mature ID miR-2467-3p
miRNA Sequence AGCAGAGGCAGAGAGGCUCAGG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-3150a directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-3150a miRNA Mature ID miR-3150a-3p
miRNA Sequence CUGGGGAGAUCCUCGAGGUUGG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-3166 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-3166 miRNA Mature ID miR-3166
miRNA Sequence CGCAGACAAUGCCUACUGGCCUA
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-3175 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-3175 miRNA Mature ID miR-3175
miRNA Sequence CGGGGAGAGAACGCAGUGACGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-3184 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-3184 miRNA Mature ID miR-3184-5p
miRNA Sequence UGAGGGGCCUCAGACCGAGCUUUU
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-3622a directly targets ABCC5 [14]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-3622a miRNA Mature ID miR-3622a-3p
miRNA Sequence UCACCUGACCUCCCAUGCCUGU
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-3622b directly targets ABCC5 [14]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-3622b miRNA Mature ID miR-3622b-3p
miRNA Sequence UCACCUGAGCUCCCGUGCCUG
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-423 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-423 miRNA Mature ID miR-423-5p
miRNA Sequence UGAGGGGCAGAGAGCGAGACUUU
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-4254 directly targets ABCC5 [13]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4254 miRNA Mature ID miR-4254
miRNA Sequence GCCUGGAGCUACUCCACCAUCUC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-4306 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4306 miRNA Mature ID miR-4306
miRNA Sequence UGGAGAGAAAGGCAGUA
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-4308 directly targets ABCC5 [13]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4308 miRNA Mature ID miR-4308
miRNA Sequence UCCCUGGAGUUUCUUCUU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-4323 directly targets ABCC5 [14]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4323 miRNA Mature ID miR-4323
miRNA Sequence CAGCCCCACAGCCUCAGA
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-4644 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4644 miRNA Mature ID miR-4644
miRNA Sequence UGGAGAGAGAAAAGAGACAGAAG
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-4675 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4675 miRNA Mature ID miR-4675
miRNA Sequence GGGGCUGUGAUUGACCAGCAGG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-4741 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4741 miRNA Mature ID miR-4741
miRNA Sequence CGGGCUGUCCGGAGGGGUCGGCU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-4758 directly targets ABCC5 [14]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4758 miRNA Mature ID miR-4758-3p
miRNA Sequence UGCCCCACCUGCUGACCACCCUC
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-4771 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-4771 miRNA Mature ID miR-4771
miRNA Sequence AGCAGACUUGACCUACAAUUA
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-491 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-491 miRNA Mature ID miR-491-5p
miRNA Sequence AGUGGGGAACCCUUCCAUGAGG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-499b directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-499b miRNA Mature ID miR-499b-5p
miRNA Sequence ACAGACUUGCUGUGAUGUUCA
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-5194 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-5194 miRNA Mature ID miR-5194
miRNA Sequence UGAGGGGUUUGGAAUGGGAUGG
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-610 directly targets ABCC5 [14]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-610 miRNA Mature ID miR-610
miRNA Sequence UGAGCUAAAUGUGUGCUGGGA
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-634 directly targets ABCC5 [14]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-634 miRNA Mature ID miR-634
miRNA Sequence AACCAGCACCCCAACUUUGGAC
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-6510 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6510 miRNA Mature ID miR-6510-5p
miRNA Sequence CAGCAGGGGAGAGAGAGGAGUC
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-6731 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6731 miRNA Mature ID miR-6731-5p
miRNA Sequence UGGGAGAGCAGGGUAUUGUGGA
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-6734 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6734 miRNA Mature ID miR-6734-5p
miRNA Sequence UUGAGGGGAGAAUGAGGUGGAGA
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-6738 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6738 miRNA Mature ID miR-6738-5p
miRNA Sequence CGAGGGGUAGAAGAGCACAGGGG
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-6763 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6763 miRNA Mature ID miR-6763-5p
miRNA Sequence CUGGGGAGUGGCUGGGGAG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6805 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6805 miRNA Mature ID miR-6805-5p
miRNA Sequence UAGGGGGCGGCUUGUGGAGUGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6820 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6820 miRNA Mature ID miR-6820-5p
miRNA Sequence UGCGGCAGAGCUGGGGUCA
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6825 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6825 miRNA Mature ID miR-6825-5p
miRNA Sequence UGGGGAGGUGUGGAGUCAGCAU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6834 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6834 miRNA Mature ID miR-6834-5p
miRNA Sequence GUGAGGGACUGGGAUUUGUGG
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-6846 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6846 miRNA Mature ID miR-6846-5p
miRNA Sequence UGGGGGCUGGAUGGGGUAGAGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6848 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-6848 miRNA Mature ID miR-6848-5p
miRNA Sequence UGGGGGCUGGGAUGGGCCAUGGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-766 directly targets ABCC5 [14]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-766 miRNA Mature ID miR-766-3p
miRNA Sequence ACUCCAGCCCCACAGCCUCAGC
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-8085 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-8085 miRNA Mature ID miR-8085
miRNA Sequence UGGGAGAGAGGACUGUGAGGC
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-873 directly targets ABCC5 [15]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-873 miRNA Mature ID miR-873-3p
miRNA Sequence GGAGACUGAUGAGUUCCCGGGA
miRNA Target Type Direct
Experimental Material Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon miR-935 directly targets ABCC5 [16]
Epigenetic Type microRNA Experiment Method CLASH
miRNA Stemloop ID miR-935 miRNA Mature ID miR-935
miRNA Sequence CCAGUUACCGCUUCCGCUACCGC
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon miR-939 directly targets ABCC5 [17]
Epigenetic Type microRNA Experiment Method PAR-CLIP
miRNA Stemloop ID miR-939 miRNA Mature ID miR-939-5p
miRNA Sequence UGGGGAGCUGAGGCUCUGGGGGUG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-98 directly targets ABCC5 [18]
Epigenetic Type microRNA Experiment Method Microarray
miRNA Stemloop ID miR-98 miRNA Mature ID miR-98-5p
miRNA Sequence UGAGGUAGUAAGUUGUAUUGUU
miRNA Target Type Direct
Experimental Material Human cervical cancer cell line (Hela)
References
1 Genomic methylation profiling combined with gene expression microarray reveals the aberrant methylation mechanism involved in nasopharyngeal carcinoma taxol resistance. Anticancer Drugs. 2012 Sep;23(8):856-64.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
4 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
5 DNA Methylation Dynamics in Urological Tumors.
6 Genome-wide Scan for Methylation Profiles in Breast Cancer
7 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 Methylation of miR-129-5p CpG island modulates multi-drug resistance in gastric cancer by targeting ABC transporters. Oncotarget. 2014 Nov 30;5(22):11552-63.
13 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
14 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
15 Identification of distinct miRNA target regulation between breast cancer molecular subtypes using AGO2-PAR-CLIP and patient datasets. Genome Biol. 2014 Jan 7;15(1):R9.
16 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
17 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
18 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.