General Information of Drug Transporter (DT)
DT ID DTD0024 Transporter Info
Gene Name SLC22A6
Transporter Name Organic anion transporter 1
Gene ID
9356
UniProt ID
Q4U2R8
Epigenetic Regulations of This DT (ERD)
Epigenetic Phenomenon Hypermethylation of SLC22A6 in liver (compare with the kidney) [1]
Location Promoter
Epigenetic Type Methylation Experiment Method Bisulfite sequencing
Studied Phenotype Human liver tissue
Experimental Material Model organism in vivo (mouse)
Additional Notes The difference in the Oat1 DNA methylation status was prevalent downstream of TSS
Epigenetic Phenomenon miR-1236 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-1236 miRNA Mature ID miR-1236-3p
miRNA Sequence CCUCUUCCCCUUGUCUCUCCAG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-1238 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-1238 miRNA Mature ID miR-1238-3p
miRNA Sequence CUUCCUCGUCUGUCUGCCCC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-1470 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-1470 miRNA Mature ID miR-1470
miRNA Sequence GCCCUCCGCCCGUGCACCCCG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-147a directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-147a miRNA Mature ID miR-147a
miRNA Sequence GUGUGUGGAAAUGCUUCUGC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-204 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-204 miRNA Mature ID miR-204-5p
miRNA Sequence UUCCCUUUGUCAUCCUAUGCCU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-211 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-211 miRNA Mature ID miR-211-5p
miRNA Sequence UUCCCUUUGUCAUCCUUCGCCU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-2909 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-2909 miRNA Mature ID miR-2909
miRNA Sequence GUUAGGGCCAACAUCUCUUGG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-296 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-296 miRNA Mature ID miR-296-3p
miRNA Sequence GAGGGUUGGGUGGAGGCUCUCC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-3911 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-3911 miRNA Mature ID miR-3911
miRNA Sequence UGUGUGGAUCCUGGAGGAGGCA
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-4287 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-4287 miRNA Mature ID miR-4287
miRNA Sequence UCUCCCUUGAGGGCACUUU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-4667 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-4667 miRNA Mature ID miR-4667-3p
miRNA Sequence UCCCUCCUUCUGUCCCCACAG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-4685 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-4685 miRNA Mature ID miR-4685-3p
miRNA Sequence UCUCCCUUCCUGCCCUGGCUAG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-4691 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-4691 miRNA Mature ID miR-4691-5p
miRNA Sequence GUCCUCCAGGCCAUGAGCUGCGG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-5193 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-5193 miRNA Mature ID miR-5193
miRNA Sequence UCCUCCUCUACCUCAUCCCAGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-581 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-581 miRNA Mature ID miR-581
miRNA Sequence UCUUGUGUUCUCUAGAUCAGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-642a directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-642a miRNA Mature ID miR-642a-5p
miRNA Sequence GUCCCUCUCCAAAUGUGUCUUG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-644a directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-644a miRNA Mature ID miR-644a
miRNA Sequence AGUGUGGCUUUCUUAGAGC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-659 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-659 miRNA Mature ID miR-659-5p
miRNA Sequence AGGACCUUCCCUGAACCAAGGA
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-660 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-660 miRNA Mature ID miR-660-3p
miRNA Sequence ACCUCCUGUGUGCAUGGAUUA
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-670 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-670 miRNA Mature ID miR-670-3p
miRNA Sequence UUUCCUCAUAUUCAUUCAGGA
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6734 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-6734 miRNA Mature ID miR-6734-3p
miRNA Sequence CCCUUCCCUCACUCUUCUCUCAG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6748 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-6748 miRNA Mature ID miR-6748-5p
miRNA Sequence UGUGGGUGGGAAGGACUGGAUU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6749 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-6749 miRNA Mature ID miR-6749-3p
miRNA Sequence CUCCUCCCCUGCCUGGCCCAG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6759 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-6759 miRNA Mature ID miR-6759-5p
miRNA Sequence UUGUGGGUGGGCAGAAGUCUGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6780a directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-6780a miRNA Mature ID miR-6780a-3p
miRNA Sequence CUCCUCUGUUUUCUUUCCUAG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6792 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-6792 miRNA Mature ID miR-6792-3p
miRNA Sequence CUCCUCCACAGCCCCUGCUCAU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6793 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-6793 miRNA Mature ID miR-6793-5p
miRNA Sequence UGUGGGUUCUGGGUUGGGGUGA
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6818 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-6818 miRNA Mature ID miR-6818-5p
miRNA Sequence UUGUGUGAGUACAGAGAGCAUC
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6832 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-6832 miRNA Mature ID miR-6832-3p
miRNA Sequence ACCCUUUUUCUCUUUCCCAG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-6881 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-6881 miRNA Mature ID miR-6881-3p
miRNA Sequence AUCCUCUUUCGUCCUUCCCACU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-7111 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-7111 miRNA Mature ID miR-7111-3p
miRNA Sequence AUCCUCUCUUCCCUCCUCCCAG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-8065 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-8065 miRNA Mature ID miR-8065
miRNA Sequence UGUAGGAACAGUUGAAUUUUGGCU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
Epigenetic Phenomenon miR-877 directly targets SLC22A6 [2]
Epigenetic Type microRNA Experiment Method HITS-CLIP
miRNA Stemloop ID miR-877 miRNA Mature ID miR-877-3p
miRNA Sequence UCCUCUUCUCCCUCCUCCCAG
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
References
1 Regulation of tissue-specific expression of renal organic anion transporters by hepatocyte nuclear factor 1 / and DNA methylation. J Pharmacol Exp Ther. 2012 Mar;340(3):648-55.
2 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.