General Information of Drug Transporter (DT)
DT ID DTD0029 Transporter Info
Gene Name SLCO1A2
Transporter Name Organic anion transporting polypeptide 1A2
Gene ID
UniProt ID
Epigenetic Regulations of This DT (ERD)
    Atypical teratoid rhabdoid tumor            2 Epigenetic Phenomena Related to This Phenotype
Click to Show/Hide the Full List
          Epigenetic Phenomenon 1 Methylation of SLCO1A2 in atypical teratoid rhabdoid tumor [1]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.30E+00 Statistic Test p-value: 3.40E-07; Z-score: -1.57E+00
                  Methylation in Case 4.77E-01 (Median) Methylation in Control 6.22E-01 (Median)
                  Studied Phenotype Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
                  Experimental Material Patient tissue samples
          Epigenetic Phenomenon 2 Methylation of SLCO1A2 in atypical teratoid rhabdoid tumor [1]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.30E+00 Statistic Test p-value: 3.40E-07; Z-score: -1.57E+00
                  Methylation in Case 4.77E-01 (Median) Methylation in Control 6.22E-01 (Median)
                  Studied Phenotype Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
                  Experimental Material Patient tissue samples
    Bladder cancer            2 Epigenetic Phenomena Related to This Phenotype
Click to Show/Hide the Full List
          Epigenetic Phenomenon 1 Methylation of SLCO1A2 in bladder cancer [2]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -2.95E+00 Statistic Test p-value: 2.70E-12; Z-score: -1.12E+01
                  Methylation in Case 2.13E-01 (Median) Methylation in Control 6.29E-01 (Median)
                  Studied Phenotype Bladder cancer [ ICD-11: 2C94]
                  Experimental Material Patient tissue samples
          Epigenetic Phenomenon 2 Methylation of SLCO1A2 in bladder cancer [2]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -2.95E+00 Statistic Test p-value: 2.70E-12; Z-score: -1.12E+01
                  Methylation in Case 2.13E-01 (Median) Methylation in Control 6.29E-01 (Median)
                  Studied Phenotype Bladder cancer [ ICD-11: 2C94]
                  Experimental Material Patient tissue samples
    Breast cancer            2 Epigenetic Phenomena Related to This Phenotype
Click to Show/Hide the Full List
          Epigenetic Phenomenon 1 Methylation of SLCO1A2 in breast cancer [3]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.10E+00 Statistic Test p-value: 1.46E-04; Z-score: -1.08E+00
                  Methylation in Case 5.34E-01 (Median) Methylation in Control 5.88E-01 (Median)
                  Studied Phenotype Breast cancer [ ICD-11: 2C60-2C6Z]
                  Experimental Material Patient tissue samples
          Epigenetic Phenomenon 2 Methylation of SLCO1A2 in breast cancer [3]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.10E+00 Statistic Test p-value: 1.46E-04; Z-score: -1.08E+00
                  Methylation in Case 5.34E-01 (Median) Methylation in Control 5.88E-01 (Median)
                  Studied Phenotype Breast cancer [ ICD-11: 2C60-2C6Z]
                  Experimental Material Patient tissue samples
    Colorectal cancer            2 Epigenetic Phenomena Related to This Phenotype
Click to Show/Hide the Full List
          Epigenetic Phenomenon 1 Methylation of SLCO1A2 in colorectal cancer [4]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.25E+00 Statistic Test p-value: 1.05E-12; Z-score: -2.67E+00
                  Methylation in Case 6.48E-01 (Median) Methylation in Control 8.11E-01 (Median)
                  Studied Phenotype Colorectal cancer [ ICD-11: 2B91]
                  Experimental Material Patient tissue samples
          Epigenetic Phenomenon 2 Methylation of SLCO1A2 in colorectal cancer [4]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.25E+00 Statistic Test p-value: 1.05E-12; Z-score: -2.67E+00
                  Methylation in Case 6.48E-01 (Median) Methylation in Control 8.11E-01 (Median)
                  Studied Phenotype Colorectal cancer [ ICD-11: 2B91]
                  Experimental Material Patient tissue samples
    Hepatocellular carcinoma            2 Epigenetic Phenomena Related to This Phenotype
Click to Show/Hide the Full List
          Epigenetic Phenomenon 1 Methylation of SLCO1A2 in hepatocellular carcinoma [5]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.07E+00 Statistic Test p-value: 6.50E-05; Z-score: -7.08E-01
                  Methylation in Case 6.71E-01 (Median) Methylation in Control 7.21E-01 (Median)
                  Studied Phenotype Hepatocellular carcinoma [ ICD-11: 2C12.02]
                  Experimental Material Patient tissue samples
          Epigenetic Phenomenon 2 Methylation of SLCO1A2 in hepatocellular carcinoma [5]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.07E+00 Statistic Test p-value: 6.50E-05; Z-score: -7.08E-01
                  Methylation in Case 6.71E-01 (Median) Methylation in Control 7.21E-01 (Median)
                  Studied Phenotype Hepatocellular carcinoma [ ICD-11: 2C12.02]
                  Experimental Material Patient tissue samples
    HIV infection            2 Epigenetic Phenomena Related to This Phenotype
Click to Show/Hide the Full List
          Epigenetic Phenomenon 1 Methylation of SLCO1A2 in HIV infection [6]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 1.50E-02; Z-score: -5.90E-01
                  Methylation in Case 7.49E-01 (Median) Methylation in Control 7.76E-01 (Median)
                  Studied Phenotype HIV infection [ ICD-11: 1C62.Z]
                  Experimental Material Patient tissue samples
          Epigenetic Phenomenon 2 Methylation of SLCO1A2 in HIV infection [6]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 1.50E-02; Z-score: -5.90E-01
                  Methylation in Case 7.49E-01 (Median) Methylation in Control 7.76E-01 (Median)
                  Studied Phenotype HIV infection [ ICD-11: 1C62.Z]
                  Experimental Material Patient tissue samples
    Panic disorder            2 Epigenetic Phenomena Related to This Phenotype
Click to Show/Hide the Full List
          Epigenetic Phenomenon 1 Methylation of SLCO1A2 in panic disorder [7]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -6.41E+00 Statistic Test p-value: 1.56E-07; Z-score: -9.06E-01
                  Methylation in Case 8.71E-02 (Median) Methylation in Control 5.58E-01 (Median)
                  Studied Phenotype Panic disorder [ ICD-11: 6B01]
                  Experimental Material Patient tissue samples
          Epigenetic Phenomenon 2 Methylation of SLCO1A2 in panic disorder [7]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -6.41E+00 Statistic Test p-value: 1.56E-07; Z-score: -9.06E-01
                  Methylation in Case 8.71E-02 (Median) Methylation in Control 5.58E-01 (Median)
                  Studied Phenotype Panic disorder [ ICD-11: 6B01]
                  Experimental Material Patient tissue samples
    Papillary thyroid cancer            2 Epigenetic Phenomena Related to This Phenotype
Click to Show/Hide the Full List
          Epigenetic Phenomenon 1 Methylation of SLCO1A2 in papillary thyroid cancer [8]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.08E+00 Statistic Test p-value: 5.56E-07; Z-score: -9.56E-01
                  Methylation in Case 6.77E-01 (Median) Methylation in Control 7.31E-01 (Median)
                  Studied Phenotype Papillary thyroid cancer [ ICD-11: 2D10.1]
                  Experimental Material Patient tissue samples
          Epigenetic Phenomenon 2 Methylation of SLCO1A2 in papillary thyroid cancer [8]
                  Location 5'UTR (cg11704114)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.08E+00 Statistic Test p-value: 5.56E-07; Z-score: -9.56E-01
                  Methylation in Case 6.77E-01 (Median) Methylation in Control 7.31E-01 (Median)
                  Studied Phenotype Papillary thyroid cancer [ ICD-11: 2D10.1]
                  Experimental Material Patient tissue samples
    Pancretic ductal adenocarcinoma            2 Epigenetic Phenomena Related to This Phenotype
Click to Show/Hide the Full List
          Epigenetic Phenomenon 1 Methylation of SLCO1A2 in pancretic ductal adenocarcinoma [9]
                  Location TSS1500 (cg26743024)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.26E+00 Statistic Test p-value: 1.31E-06; Z-score: -1.27E+00
                  Methylation in Case 3.68E-01 (Median) Methylation in Control 4.64E-01 (Median)
                  Studied Phenotype Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
                  Experimental Material Patient tissue samples
          Epigenetic Phenomenon 2 Methylation of SLCO1A2 in pancretic ductal adenocarcinoma [9]
                  Location TSS1500 (cg26743024)
                  Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
                  Methylation Fold Change Fold Change: -1.26E+00 Statistic Test p-value: 1.31E-06; Z-score: -1.27E+00
                  Methylation in Case 3.68E-01 (Median) Methylation in Control 4.64E-01 (Median)
                  Studied Phenotype Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
                  Experimental Material Patient tissue samples
    B-cell acute lymphoblastic leukemia            2 Epigenetic Phenomena Related to This Phenotype
Click to Show/Hide the Full List
          Epigenetic Phenomenon 1 miR-595 downregulates SLCO1A2 in B-cell acute lymphoblastic leukemia [10]
                  Epigenetic Type microRNA Experiment Method In-silico analysis
                  Related Molecular Changes Down regulation of SLCO1A2 Experiment Method RT-qPCR
                  miRNA Stemloop ID miR-595 miRNA Mature ID miR-595
                  miRNA Sequence GAAGUGUGCCGUGGUGUGUCU
                  miRNA Target Type Direct
                  Studied Phenotype B-cell acute lymphoblastic leukemia [ ICD-11: 2A82]
                  Experimental Material Patient tissue samples
                  Additional Notes SNPs in miR-595 that might affect SLCO1A2 MTX transport gene regulation and could affect MTX levels in patients with pediatric B-cell ALL.
          Epigenetic Phenomenon 2 miR-595 downregulates SLCO1A2 in B-cell acute lymphoblastic leukemia [10]
                  Epigenetic Type microRNA Experiment Method In-silico analysis
                  Related Molecular Changes Down regulation of SLCO1A2 Experiment Method RT-qPCR
                  miRNA Stemloop ID miR-595 miRNA Mature ID miR-595
                  miRNA Sequence GAAGUGUGCCGUGGUGUGUCU
                  miRNA Target Type Direct
                  Studied Phenotype B-cell acute lymphoblastic leukemia [ ICD-11: 2A82]
                  Experimental Material Patient tissue samples
                  Additional Notes SNPs in miR-595 that might affect SLCO1A2 MTX transport gene regulation and could affect MTX levels in patients with pediatric B-cell ALL.
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 MiR-pharmacogenetics of methotrexate in childhood B-cell acute lymphoblastic leukemia. Pharmacogenet Genomics. 2016 Nov;26(11):517-525.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.