General Information of Drug Transporter (DT)
DT ID DTD0056 Transporter Info
Gene Name ABCC10
Transporter Name Multidrug resistance-associated protein 7
Gene ID
89845
UniProt ID
Q5T3U5
Epigenetic Regulations of This DT (ERD)
Epigenetic Phenomenon Methylation of ABCC10 in bladder cancer [1]
Location TSS1500 (cg25545088)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.22E+00 Statistic Test p-value: 2.62E-03; Z-score: 2.21E+00
Methylation in Case 7.51E-01 (Median) Methylation in Control 6.16E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in breast cancer [2]
Location TSS1500 (cg25545088)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.11E+00 Statistic Test p-value: 8.07E-09; Z-score: 1.14E+00
Methylation in Case 7.38E-01 (Median) Methylation in Control 6.63E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in breast cancer [2]
Location TSS1500 (cg12572677)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.04E+00 Statistic Test p-value: 4.65E-05; Z-score: 9.79E-01
Methylation in Case 8.46E-01 (Median) Methylation in Control 8.17E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in lung adenocarcinoma [3]
Location TSS1500 (cg25545088)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 1.18E-02; Z-score: 1.17E+00
Methylation in Case 8.08E-01 (Median) Methylation in Control 7.66E-01 (Median)
Studied Phenotype Lung adenocarcinoma [ICD-11: 2C25.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in pancretic ductal adenocarcinoma [4]
Location TSS1500 (cg14479139)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.12E+00 Statistic Test p-value: 1.46E-07; Z-score: 1.46E+00
Methylation in Case 7.93E-01 (Median) Methylation in Control 7.05E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in papillary thyroid cancer [5]
Location TSS1500 (cg25545088)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.03E+00 Statistic Test p-value: 3.04E-03; Z-score: 8.99E-01
Methylation in Case 8.53E-01 (Median) Methylation in Control 8.26E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in prostate cancer [6]
Location TSS1500 (cg13116946)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.05E+00 Statistic Test p-value: 3.91E-02; Z-score: 1.72E+00
Methylation in Case 9.49E-01 (Median) Methylation in Control 9.00E-01 (Median)
Studied Phenotype Prostate cancer [ICD-11: 2C82]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in systemic lupus erythematosus [7]
Location TSS1500 (cg23781719)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 4.36E-02; Z-score: -1.11E-01
Methylation in Case 8.75E-01 (Median) Methylation in Control 8.80E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in bladder cancer [1]
Location TSS200 (cg26511326)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.17E+00 Statistic Test p-value: 1.58E-07; Z-score: -6.61E+00
Methylation in Case 7.07E-01 (Median) Methylation in Control 8.24E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in colorectal cancer [8]
Location TSS200 (cg26511326)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.04E+00 Statistic Test p-value: 5.38E-09; Z-score: -1.96E+00
Methylation in Case 8.74E-01 (Median) Methylation in Control 9.10E-01 (Median)
Studied Phenotype Colorectal cancer [ICD-11: 2B91]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in hepatocellular carcinoma [9]
Location TSS200 (cg26511326)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.03E+00 Statistic Test p-value: 2.71E-05; Z-score: -7.88E-01
Methylation in Case 8.55E-01 (Median) Methylation in Control 8.81E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in systemic lupus erythematosus [7]
Location TSS200 (cg26511326)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 1.70E-02; Z-score: -1.82E-01
Methylation in Case 8.50E-01 (Median) Methylation in Control 8.55E-01 (Median)
Studied Phenotype Systemic lupus erythematosus [ICD-11: 4A40.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in atypical teratoid rhabdoid tumor [10]
Location Body (cg00050375)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.21E+00 Statistic Test p-value: 1.58E-05; Z-score: 1.28E+00
Methylation in Case 8.54E-01 (Median) Methylation in Control 7.06E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in bladder cancer [1]
Location Body (cg00050375)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.69E+00 Statistic Test p-value: 1.99E-06; Z-score: -5.96E+00
Methylation in Case 2.71E-01 (Median) Methylation in Control 4.57E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in breast cancer [2]
Location Body (cg00050375)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.14E+00 Statistic Test p-value: 1.08E-02; Z-score: 1.11E+00
Methylation in Case 5.82E-01 (Median) Methylation in Control 5.09E-01 (Median)
Studied Phenotype Breast cancer [ICD-11: 2C60-2C6Z]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in hepatocellular carcinoma [9]
Location Body (cg22203323)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.58E+00 Statistic Test p-value: 1.06E-14; Z-score: -2.99E+00
Methylation in Case 5.13E-01 (Median) Methylation in Control 8.08E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in hepatocellular carcinoma [9]
Location Body (cg00050375)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.19E+00 Statistic Test p-value: 4.38E-08; Z-score: -2.48E+00
Methylation in Case 6.16E-01 (Median) Methylation in Control 7.32E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in pancretic ductal adenocarcinoma [4]
Location Body (cg18256640)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.06E+00 Statistic Test p-value: 2.30E-03; Z-score: 5.97E-01
Methylation in Case 8.85E-01 (Median) Methylation in Control 8.37E-01 (Median)
Studied Phenotype Pancretic ductal adenocarcinoma [ICD-11: 2C10.0]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in papillary thyroid cancer [5]
Location Body (cg00050375)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.10E+00 Statistic Test p-value: 1.06E-02; Z-score: 7.10E-01
Methylation in Case 5.56E-01 (Median) Methylation in Control 5.04E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in atypical teratoid rhabdoid tumor [10]
Location 3'UTR (cg08073652)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.85E+00 Statistic Test p-value: 3.25E-13; Z-score: -2.12E+00
Methylation in Case 2.16E-01 (Median) Methylation in Control 4.01E-01 (Median)
Studied Phenotype Atypical teratoid rhabdoid tumor [ICD-11: 2A00.1Y]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in bladder cancer [1]
Location 3'UTR (cg08073652)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: 1.02E+00 Statistic Test p-value: 7.17E-03; Z-score: 1.96E+00
Methylation in Case 8.76E-01 (Median) Methylation in Control 8.55E-01 (Median)
Studied Phenotype Bladder cancer [ICD-11: 2C94]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in hepatocellular carcinoma [9]
Location 3'UTR (cg08073652)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.01E+00 Statistic Test p-value: 2.92E-04; Z-score: -4.94E-01
Methylation in Case 8.73E-01 (Median) Methylation in Control 8.81E-01 (Median)
Studied Phenotype Hepatocellular carcinoma [ICD-11: 2C12.02]
Experimental Material Patient tissue samples
Epigenetic Phenomenon Methylation of ABCC10 in papillary thyroid cancer [5]
Location 3'UTR (cg08073652)
Epigenetic Type Methylation Experiment Method Infinium HumanMethylation450 BeadChip
Methylation Fold Change Fold Change: -1.00E+00 Statistic Test p-value: 4.14E-02; Z-score: -4.14E-01
Methylation in Case 9.38E-01 (Median) Methylation in Control 9.42E-01 (Median)
Studied Phenotype Papillary thyroid cancer [ICD-11: 2D10.1]
Experimental Material Patient tissue samples
Epigenetic Phenomenon miR-183 directly targets ABCC10 [11]
Epigenetic Type microRNA Experiment Method CLASH
miRNA Stemloop ID miR-183 miRNA Mature ID miR-183-5p
miRNA Sequence UAUGGCACUGGUAGAAUUCACU
miRNA Target Type Direct
Experimental Material Human embryonic kidney 293 cells (HEK293)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
4 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
5 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
6 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.