General Information of Drug Transporter (DT)
DT ID DTD0057 Transporter Info
Gene Name ABCC11
Transporter Name Multidrug resistance-associated protein 8
Gene ID
85320
UniProt ID
Q96J66
Epigenetic Regulations of This DT (ERD)
Epigenetic Phenomenon Hypoacetylation of ABCB11 in acute myeloid leukemia (compare with valproate treatment counterpart cells) [1]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Up regulation of ABCC11 Experiment Method RT-qPCR
Studied Phenotype Acute myeloid leukemia [ICD-11: 2A60]
Experimental Material Multiple cell lines of human
Additional Notes Chromatin immunoprecipitation revealed the hyperacetylation of histone proteins in the promoter regions of MDR1, BCRP, and MRP8 on valproate treatment.
Epigenetic Phenomenon Hypoacetylation of ABCB11 in acute myeloid leukemia (compare with valproate treatment counterpart cells) [1]
Location Promoter
Epigenetic Type Histone acetylation Experiment Method Chromatin immunoprecipitation
Related Molecular Changes Up regulation of ABCC11 Experiment Method RT-qPCR
Studied Phenotype Acute myeloid leukemia [ICD-11: 2A60]
Experimental Material Multiple cell lines of human
Additional Notes Chromatin immunoprecipitation revealed the hyperacetylation of histone proteins in the promoter regions of MDR1, BCRP, and MRP8 on valproate treatment.
Epigenetic Phenomenon hsa-miR-1291 directly targets ABCC1 [2]
Epigenetic Type microRNA Experiment Method Luciferase reporter assay
Related Molecular Changes Down regulation of ABCC1 Experiment Method Western Blot
miRNA Stemloop ID miR-1291 miRNA Mature ID miR-1291
miRNA Target Type Direct
Experimental Material Human pancreatic carcinoma cell line (PANC-1)
Additional Notes Overexpression of hsa-miR-1291 led to a reduced ABCC1 protein expression in hsa-miR-1291 stably transfected cells.
Epigenetic Phenomenon miR-335 directly targets ABCC11 [3]
Epigenetic Type microRNA Experiment Method Microarray
miRNA Stemloop ID miR-335 miRNA Mature ID miR-335-5p
miRNA Sequence UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type Direct
Experimental Material Multiple cell lines of human
References
1 Histone deacetylase inhibitors induce a very broad, pleiotropic anticancer drug resistance phenotype in acute myeloid leukemia cells by modulation of multiple ABC transporter genes. Clin Cancer Res. 2009 Jun 1;15(11):3705-15.
2 Small nucleolar RNA-derived microRNA hsa-miR-1291 modulates cellular drug disposition through direct targeting of ABC transporter ABCC1. Drug Metab Dispos. 2013 Oct;41(10):1744-51.
3 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.