Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0007 Transporter Info | ||||
| Gene Name | SLC47A1 | ||||
| Transporter Name | Multidrug and toxin extrusion protein 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Diabetes |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypermethylation of SLC47A1 in diabetes | [ 1 ] | |||
|
Location |
Promoter (11 CpG sites) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | HumanMethylation450 BeadChip | ||
|
Related Molecular Changes |
Down regulation of SLC47A1 | Experiment Method | BeadChip | ||
|
Studied Phenotype |
Diabetes [ ICD-11: 5A10-5A14] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
Lower average and promoter DNA methylation of SLC47A1 was found in diabetic subjects receiving just metformin,compared to those who took insulin plus metformin or no diabetes medication. | ||||
|
Human liver tissue |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypermethylation of SLC47A1 in human liver tissue | [ 2 ] | |||
|
Location |
27 kb upstream of gene | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Bisulfite sequencing | ||
|
Related Molecular Changes |
Down regulation of SLC47A1 | Experiment Method | Semiquantitative RT-PCR | ||
|
Studied Phenotype |
Human liver tissue | ||||
|
Experimental Material |
Caucasian patient tissue samples | ||||
|
Additional Notes |
A relationship was not found between DNA methylation in the SLC47A1 promoter and MATE1 mRNA expression. | ||||
|
Non-alcoholic fatty liver disease |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypermethylation of SLC47A1 in non-alcoholic fatty liver disease | [ 3 ] | |||
|
Location |
6 CpG sites | ||||
|
Epigenetic Type |
Methylation | Experiment Method | HumanMethylation450 BeadChip | ||
|
Related Molecular Changes |
Down regulation of SLC47A1 | Experiment Method | Methylation microarray | ||
|
Studied Phenotype |
Non-alcoholic fatty liver disease [ ICD-11: DB92] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
SLC47A1 was detected to be significantly inversely associated with the transcriptional expression. | ||||
|
Colon cancer |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg05373457) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.30E+00 | Statistic Test | p-value: 1.89E-06; Z-score: 2.08E+00 | ||
|
Methylation in Case |
5.58E-01 (Median) | Methylation in Control | 4.29E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg02577240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 7.18E-04; Z-score: -1.49E+00 | ||
|
Methylation in Case |
6.01E-01 (Median) | Methylation in Control | 6.98E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg05311412) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.34E+00 | Statistic Test | p-value: 7.92E-07; Z-score: 3.02E+00 | ||
|
Methylation in Case |
6.11E-01 (Median) | Methylation in Control | 2.60E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC47A1 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg01454305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 3.53E-07; Z-score: -3.88E+00 | ||
|
Methylation in Case |
4.91E-01 (Median) | Methylation in Control | 7.16E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC47A1 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg10311318) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 4.42E-04; Z-score: 8.90E-01 | ||
|
Methylation in Case |
5.39E-01 (Median) | Methylation in Control | 4.72E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC47A1 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg12866656) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 2.22E-03; Z-score: -1.58E+00 | ||
|
Methylation in Case |
5.17E-01 (Median) | Methylation in Control | 6.16E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC47A1 in colon adenocarcinoma | [ 4 ] | |||
|
Location |
3'UTR (cg08828816) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 4.55E-03; Z-score: -2.33E+00 | ||
|
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 7.42E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
18 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
5'UTR (cg14932645) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 5.28E-10; Z-score: -3.98E+00 | ||
|
Methylation in Case |
7.68E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg21692194) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 8.19E-06; Z-score: -6.73E-01 | ||
|
Methylation in Case |
1.09E-01 (Median) | Methylation in Control | 1.28E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg15971010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 6.81E-04; Z-score: -8.39E-01 | ||
|
Methylation in Case |
1.08E-01 (Median) | Methylation in Control | 1.50E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg25387636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 1.62E-02; Z-score: -8.51E-01 | ||
|
Methylation in Case |
5.88E-02 (Median) | Methylation in Control | 8.59E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg12133118) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 1.66E-02; Z-score: -7.27E-01 | ||
|
Methylation in Case |
3.22E-01 (Median) | Methylation in Control | 3.67E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
TSS200 (cg07829432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 6.45E-04; Z-score: -7.82E-01 | ||
|
Methylation in Case |
8.02E-02 (Median) | Methylation in Control | 9.95E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
TSS200 (cg15014549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 6.52E-03; Z-score: -5.87E-01 | ||
|
Methylation in Case |
6.69E-02 (Median) | Methylation in Control | 7.54E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
TSS200 (cg13004927) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 1.84E-02; Z-score: -2.52E-01 | ||
|
Methylation in Case |
2.58E-02 (Median) | Methylation in Control | 3.31E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg02068832) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.79E+00 | Statistic Test | p-value: 1.39E-18; Z-score: -6.05E+00 | ||
|
Methylation in Case |
4.16E-01 (Median) | Methylation in Control | 7.44E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg16925177) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.67E+00 | Statistic Test | p-value: 3.76E-17; Z-score: -5.57E+00 | ||
|
Methylation in Case |
4.81E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg05510976) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.51E+00 | Statistic Test | p-value: 2.88E-16; Z-score: -6.93E+00 | ||
|
Methylation in Case |
5.25E-01 (Median) | Methylation in Control | 7.91E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg07566700) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 5.37E-16; Z-score: -4.42E+00 | ||
|
Methylation in Case |
5.62E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg00601711) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 4.46E-12; Z-score: 2.14E+00 | ||
|
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 6.42E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg10718608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 4.40E-08; Z-score: -1.60E+00 | ||
|
Methylation in Case |
3.71E-01 (Median) | Methylation in Control | 4.91E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg08895056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 8.41E-08; Z-score: -1.61E+00 | ||
|
Methylation in Case |
3.71E-01 (Median) | Methylation in Control | 4.87E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg20930201) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 1.63E-05; Z-score: -7.83E-01 | ||
|
Methylation in Case |
1.15E-01 (Median) | Methylation in Control | 1.45E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg12894055) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.38E+00 | Statistic Test | p-value: 5.37E-03; Z-score: -1.06E+00 | ||
|
Methylation in Case |
9.94E-02 (Median) | Methylation in Control | 1.37E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC47A1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
3'UTR (cg12550399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 7.52E-05; Z-score: 3.90E-01 | ||
|
Methylation in Case |
7.69E-01 (Median) | Methylation in Control | 7.40E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg26590537) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.70E+00 | Statistic Test | p-value: 1.17E-24; Z-score: 3.82E+00 | ||
|
Methylation in Case |
4.11E-01 (Median) | Methylation in Control | 1.52E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg24079038) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 5.82E-10; Z-score: -1.78E+00 | ||
|
Methylation in Case |
2.97E-01 (Median) | Methylation in Control | 4.39E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg18646365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.36E+00 | Statistic Test | p-value: 1.57E-08; Z-score: 1.31E+00 | ||
|
Methylation in Case |
3.98E-01 (Median) | Methylation in Control | 2.93E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg06750832) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 5.47E+00 | Statistic Test | p-value: 3.34E-33; Z-score: 5.41E+00 | ||
|
Methylation in Case |
4.26E-01 (Median) | Methylation in Control | 7.79E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg14994247) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 2.01E-20; Z-score: -2.74E+00 | ||
|
Methylation in Case |
3.94E-01 (Median) | Methylation in Control | 4.76E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg04320476) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 7.13E-09; Z-score: -1.61E+00 | ||
|
Methylation in Case |
7.94E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg10605137) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.54E-05; Z-score: -9.81E-01 | ||
|
Methylation in Case |
3.28E-01 (Median) | Methylation in Control | 3.61E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg04726373) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.65E-05; Z-score: -9.44E-01 | ||
|
Methylation in Case |
7.20E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg19866594) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.23E-05; Z-score: -3.92E-01 | ||
|
Methylation in Case |
8.70E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg13755144) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.94E-04; Z-score: 5.86E-01 | ||
|
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg00714531) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.25E-03; Z-score: 6.19E-01 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg26129353) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.62E-02; Z-score: -6.53E-01 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 8.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg13405678) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.79E-02; Z-score: 5.36E-01 | ||
|
Methylation in Case |
5.86E-01 (Median) | Methylation in Control | 5.67E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg22288309) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.98E-02; Z-score: -1.32E-01 | ||
|
Methylation in Case |
8.00E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC47A1 in pancretic ductal adenocarcinoma | [ 6 ] | |||
|
Location |
3'UTR (cg06566678) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 4.11E-06; Z-score: 1.77E+00 | ||
|
Methylation in Case |
8.55E-01 (Median) | Methylation in Control | 8.22E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
14 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg01530032) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 6.81E-07; Z-score: -4.41E+00 | ||
|
Methylation in Case |
4.58E-01 (Median) | Methylation in Control | 6.10E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg15971010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.35E+00 | Statistic Test | p-value: 4.06E-02; Z-score: 2.06E+00 | ||
|
Methylation in Case |
3.92E-01 (Median) | Methylation in Control | 2.90E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
TSS200 (cg13004927) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.67E+00 | Statistic Test | p-value: 3.00E-03; Z-score: 1.60E+00 | ||
|
Methylation in Case |
5.99E-02 (Median) | Methylation in Control | 3.59E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
TSS200 (cg07829432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 3.22E-02; Z-score: 4.08E-01 | ||
|
Methylation in Case |
1.18E-01 (Median) | Methylation in Control | 1.10E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
TSS200 (cg15014549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.71E-02; Z-score: -7.98E-02 | ||
|
Methylation in Case |
9.52E-02 (Median) | Methylation in Control | 9.62E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
Body (cg24151087) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.86E+00 | Statistic Test | p-value: 6.51E-16; Z-score: -2.13E+01 | ||
|
Methylation in Case |
1.40E-01 (Median) | Methylation in Control | 4.01E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
Body (cg04308167) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.84E+00 | Statistic Test | p-value: 1.65E-08; Z-score: -7.26E+00 | ||
|
Methylation in Case |
3.43E-01 (Median) | Methylation in Control | 6.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
Body (cg12799818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.91E+00 | Statistic Test | p-value: 1.22E-07; Z-score: -7.78E+00 | ||
|
Methylation in Case |
8.98E-02 (Median) | Methylation in Control | 3.51E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
Body (cg08895056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 4.88E-07; Z-score: -4.70E+00 | ||
|
Methylation in Case |
5.41E-01 (Median) | Methylation in Control | 7.15E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
Body (cg10718608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 1.43E-05; Z-score: -5.59E+00 | ||
|
Methylation in Case |
5.02E-01 (Median) | Methylation in Control | 6.75E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
Body (cg20930201) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.46E+00 | Statistic Test | p-value: 2.90E-04; Z-score: 7.75E+00 | ||
|
Methylation in Case |
2.29E-01 (Median) | Methylation in Control | 1.57E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
Body (cg26959235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 2.52E-03; Z-score: 2.84E+00 | ||
|
Methylation in Case |
1.58E-01 (Median) | Methylation in Control | 1.09E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
Body (cg16887170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.74E-03; Z-score: -2.16E+00 | ||
|
Methylation in Case |
7.06E-01 (Median) | Methylation in Control | 7.85E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC47A1 in bladder cancer | [ 7 ] | |||
|
Location |
Body (cg17332016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 1.14E-02; Z-score: 9.85E-01 | ||
|
Methylation in Case |
5.12E-02 (Median) | Methylation in Control | 4.02E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg15971010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.35E+00 | Statistic Test | p-value: 2.21E-07; Z-score: 1.10E+00 | ||
|
Methylation in Case |
2.49E-01 (Median) | Methylation in Control | 1.85E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg21692194) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 6.56E-06; Z-score: 8.36E-01 | ||
|
Methylation in Case |
1.73E-01 (Median) | Methylation in Control | 1.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg25387636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.39E+00 | Statistic Test | p-value: 1.52E-05; Z-score: 1.00E+00 | ||
|
Methylation in Case |
1.40E-01 (Median) | Methylation in Control | 1.00E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg01530032) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 2.09E-04; Z-score: -1.21E+00 | ||
|
Methylation in Case |
5.58E-01 (Median) | Methylation in Control | 6.35E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg12133118) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 3.78E-02; Z-score: -7.59E-01 | ||
|
Methylation in Case |
5.23E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
TSS200 (cg07829432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 1.95E-05; Z-score: 8.84E-01 | ||
|
Methylation in Case |
1.07E-01 (Median) | Methylation in Control | 8.72E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
TSS200 (cg13004927) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.35E+00 | Statistic Test | p-value: 5.95E-04; Z-score: 3.49E-01 | ||
|
Methylation in Case |
3.88E-02 (Median) | Methylation in Control | 2.88E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
TSS200 (cg15014549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 6.71E-03; Z-score: 4.96E-01 | ||
|
Methylation in Case |
7.76E-02 (Median) | Methylation in Control | 6.84E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
Body (cg08895056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 8.26E-13; Z-score: -2.23E+00 | ||
|
Methylation in Case |
5.37E-01 (Median) | Methylation in Control | 6.88E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
Body (cg20930201) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.45E+00 | Statistic Test | p-value: 1.40E-10; Z-score: 2.48E+00 | ||
|
Methylation in Case |
2.07E-01 (Median) | Methylation in Control | 1.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
Body (cg10718608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 7.64E-08; Z-score: -1.82E+00 | ||
|
Methylation in Case |
5.62E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
Body (cg04308167) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 1.27E-07; Z-score: -1.55E+00 | ||
|
Methylation in Case |
4.38E-01 (Median) | Methylation in Control | 5.57E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
Body (cg16887170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 4.94E-04; Z-score: -1.23E+00 | ||
|
Methylation in Case |
6.20E-01 (Median) | Methylation in Control | 7.83E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
Body (cg26959235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 5.02E-04; Z-score: 4.52E-01 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 1.18E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC47A1 in breast cancer | [ 8 ] | |||
|
Location |
Body (cg17332016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 2.52E-03; Z-score: 1.73E-01 | ||
|
Methylation in Case |
4.83E-02 (Median) | Methylation in Control | 4.55E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Celiac disease |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in celiac disease | [ 9 ] | |||
|
Location |
TSS1500 (cg21692194) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.61E+00 | Statistic Test | p-value: 1.38E-03; Z-score: 1.91E+00 | ||
|
Methylation in Case |
2.10E-01 (Median) | Methylation in Control | 1.31E-01 (Median) | ||
|
Studied Phenotype |
Celiac disease [ ICD-11: DA95] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in celiac disease | [ 9 ] | |||
|
Location |
TSS1500 (cg25387636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.84E+00 | Statistic Test | p-value: 3.58E-02; Z-score: 5.26E-01 | ||
|
Methylation in Case |
9.86E-02 (Median) | Methylation in Control | 5.37E-02 (Median) | ||
|
Studied Phenotype |
Celiac disease [ ICD-11: DA95] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in celiac disease | [ 9 ] | |||
|
Location |
Body (cg16887170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 3.07E-02; Z-score: -1.14E+00 | ||
|
Methylation in Case |
7.01E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Celiac disease [ ICD-11: DA95] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
18 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg15971010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.20E+00 | Statistic Test | p-value: 1.59E-12; Z-score: 4.44E+00 | ||
|
Methylation in Case |
4.89E-01 (Median) | Methylation in Control | 2.22E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg25387636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.95E+00 | Statistic Test | p-value: 2.49E-11; Z-score: 6.62E+00 | ||
|
Methylation in Case |
3.66E-01 (Median) | Methylation in Control | 1.24E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg21692194) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.91E+00 | Statistic Test | p-value: 1.67E-09; Z-score: 3.73E+00 | ||
|
Methylation in Case |
3.04E-01 (Median) | Methylation in Control | 1.59E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg01530032) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 1.31E-08; Z-score: -2.16E+00 | ||
|
Methylation in Case |
7.03E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
TSS200 (cg07829432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.82E+00 | Statistic Test | p-value: 2.59E-09; Z-score: 3.90E+00 | ||
|
Methylation in Case |
3.13E-01 (Median) | Methylation in Control | 1.71E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
TSS200 (cg15014549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.64E+00 | Statistic Test | p-value: 1.01E-08; Z-score: 3.34E+00 | ||
|
Methylation in Case |
1.91E-01 (Median) | Methylation in Control | 1.17E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
TSS200 (cg13004927) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.17E+00 | Statistic Test | p-value: 3.99E-08; Z-score: 1.58E+00 | ||
|
Methylation in Case |
6.96E-02 (Median) | Methylation in Control | 3.21E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
Body (cg24151087) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 1.12E-06; Z-score: 1.88E+00 | ||
|
Methylation in Case |
4.17E-01 (Median) | Methylation in Control | 3.12E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
Body (cg26959235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 1.15E-06; Z-score: 1.32E+00 | ||
|
Methylation in Case |
1.71E-01 (Median) | Methylation in Control | 1.32E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
Body (cg04308167) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.25E-06; Z-score: -1.17E+00 | ||
|
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 8.29E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
Body (cg20930201) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 3.29E-06; Z-score: 1.80E+00 | ||
|
Methylation in Case |
3.26E-01 (Median) | Methylation in Control | 2.34E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
Body (cg17332016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 7.25E-05; Z-score: 2.14E-01 | ||
|
Methylation in Case |
1.37E-01 (Median) | Methylation in Control | 1.32E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
Body (cg10718608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 5.08E-04; Z-score: -7.26E-01 | ||
|
Methylation in Case |
8.24E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
Body (cg11784214) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 8.98E-04; Z-score: -9.82E-01 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
Body (cg08895056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 9.10E-04; Z-score: -6.30E-01 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
Body (cg16887170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.94E-02; Z-score: -4.04E-01 | ||
|
Methylation in Case |
8.71E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC47A1 in colorectal cancer | [ 10 ] | |||
|
Location |
Body (cg12799818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.17E-02; Z-score: 9.34E-02 | ||
|
Methylation in Case |
2.71E-01 (Median) | Methylation in Control | 2.67E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in HIV infection | [ 11 ] | |||
|
Location |
TSS1500 (cg15971010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 4.88E-03; Z-score: 6.76E-01 | ||
|
Methylation in Case |
1.70E-01 (Median) | Methylation in Control | 1.36E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in HIV infection | [ 11 ] | |||
|
Location |
TSS1500 (cg25387636) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 5.93E-03; Z-score: 9.43E-01 | ||
|
Methylation in Case |
9.77E-02 (Median) | Methylation in Control | 7.37E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in HIV infection | [ 11 ] | |||
|
Location |
TSS200 (cg07829432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 1.21E-04; Z-score: 1.43E+00 | ||
|
Methylation in Case |
1.14E-01 (Median) | Methylation in Control | 8.46E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC47A1 in HIV infection | [ 11 ] | |||
|
Location |
TSS200 (cg13004927) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.65E+00 | Statistic Test | p-value: 1.73E-03; Z-score: 2.20E+00 | ||
|
Methylation in Case |
4.52E-02 (Median) | Methylation in Control | 1.71E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC47A1 in HIV infection | [ 11 ] | |||
|
Location |
Body (cg24151087) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.49E+00 | Statistic Test | p-value: 2.12E-06; Z-score: 2.25E+00 | ||
|
Methylation in Case |
1.91E-01 (Median) | Methylation in Control | 1.28E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC47A1 in HIV infection | [ 11 ] | |||
|
Location |
Body (cg16887170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.11E-05; Z-score: -2.19E+00 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 8.36E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC47A1 in HIV infection | [ 11 ] | |||
|
Location |
Body (cg12799818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.50E+00 | Statistic Test | p-value: 2.09E-05; Z-score: 1.85E+00 | ||
|
Methylation in Case |
8.68E-02 (Median) | Methylation in Control | 5.78E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC47A1 in HIV infection | [ 11 ] | |||
|
Location |
Body (cg20930201) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 4.18E-05; Z-score: 2.31E+00 | ||
|
Methylation in Case |
2.32E-01 (Median) | Methylation in Control | 1.74E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC47A1 in HIV infection | [ 11 ] | |||
|
Location |
Body (cg12894055) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 4.43E-04; Z-score: 8.90E-01 | ||
|
Methylation in Case |
5.22E-02 (Median) | Methylation in Control | 4.18E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC47A1 in HIV infection | [ 11 ] | |||
|
Location |
Body (cg26959235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.57E-02; Z-score: 7.72E-01 | ||
|
Methylation in Case |
1.45E-01 (Median) | Methylation in Control | 1.22E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC47A1 in HIV infection | [ 11 ] | |||
|
Location |
Body (cg10718608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 3.00E-02; Z-score: 1.30E+00 | ||
|
Methylation in Case |
3.15E-01 (Median) | Methylation in Control | 2.67E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in prostate cancer | [ 12 ] | |||
|
Location |
TSS1500 (cg20533553) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 2.38E-02; Z-score: 2.62E+00 | ||
|
Methylation in Case |
7.79E-01 (Median) | Methylation in Control | 6.38E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in prostate cancer | [ 12 ] | |||
|
Location |
Body (cg08874645) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 1.34E-02; Z-score: 1.88E+00 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 7.15E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in clear cell renal cell carcinoma | [ 13 ] | |||
|
Location |
TSS200 (cg15014549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.50E-02; Z-score: 5.02E-01 | ||
|
Methylation in Case |
3.47E-02 (Median) | Methylation in Control | 3.06E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in clear cell renal cell carcinoma | [ 13 ] | |||
|
Location |
TSS200 (cg07829432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 3.16E-02; Z-score: 2.64E-01 | ||
|
Methylation in Case |
3.80E-02 (Median) | Methylation in Control | 3.34E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in clear cell renal cell carcinoma | [ 13 ] | |||
|
Location |
Body (cg12894055) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.41E+00 | Statistic Test | p-value: 6.34E-08; Z-score: -2.52E+00 | ||
|
Methylation in Case |
5.62E-02 (Median) | Methylation in Control | 1.35E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC47A1 in clear cell renal cell carcinoma | [ 13 ] | |||
|
Location |
Body (cg10718608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 3.14E-07; Z-score: -3.83E+00 | ||
|
Methylation in Case |
5.26E-01 (Median) | Methylation in Control | 6.94E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC47A1 in clear cell renal cell carcinoma | [ 13 ] | |||
|
Location |
Body (cg08895056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 1.59E-06; Z-score: -3.32E+00 | ||
|
Methylation in Case |
5.11E-01 (Median) | Methylation in Control | 6.73E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC47A1 in clear cell renal cell carcinoma | [ 13 ] | |||
|
Location |
Body (cg20930201) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.36E+00 | Statistic Test | p-value: 4.54E-03; Z-score: 9.20E-01 | ||
|
Methylation in Case |
1.07E-01 (Median) | Methylation in Control | 7.89E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC47A1 in clear cell renal cell carcinoma | [ 13 ] | |||
|
Location |
3'UTR (cg12550399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 2.75E-03; Z-score: 2.21E+00 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg07829432) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.46E+00 | Statistic Test | p-value: 3.51E-03; Z-score: 3.46E+00 | ||
|
Methylation in Case |
1.84E-01 (Median) | Methylation in Control | 1.26E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg15014549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 7.76E-03; Z-score: 2.65E+00 | ||
|
Methylation in Case |
1.25E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
TSS200 (cg13004927) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.62E+00 | Statistic Test | p-value: 4.44E-02; Z-score: 1.78E+00 | ||
|
Methylation in Case |
7.07E-02 (Median) | Methylation in Control | 4.38E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC47A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg10718608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 5.10E-05; Z-score: -3.35E+00 | ||
|
Methylation in Case |
4.90E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC47A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg08895056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 1.04E-04; Z-score: -2.47E+00 | ||
|
Methylation in Case |
5.25E-01 (Median) | Methylation in Control | 6.48E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC47A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg12894055) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.49E+00 | Statistic Test | p-value: 5.84E-03; Z-score: -1.48E+00 | ||
|
Methylation in Case |
1.49E-01 (Median) | Methylation in Control | 2.22E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC47A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg16887170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 7.22E-03; Z-score: -1.53E+00 | ||
|
Methylation in Case |
7.68E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC47A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg20930201) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 2.61E-02; Z-score: 1.29E+00 | ||
|
Methylation in Case |
2.47E-01 (Median) | Methylation in Control | 2.13E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in panic disorder | [ 15 ] | |||
|
Location |
TSS200 (cg15014549) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 9.75E-01 | Statistic Test | p-value: 6.59E-03; Z-score: 3.02E-01 | ||
|
Methylation in Case |
-4.09E+00 (Median) | Methylation in Control | -4.19E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in panic disorder | [ 15 ] | |||
|
Location |
Body (cg17332016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -9.80E-01 | Statistic Test | p-value: 2.59E-02; Z-score: -3.18E-01 | ||
|
Methylation in Case |
-5.20E+00 (Median) | Methylation in Control | -5.10E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in panic disorder | [ 15 ] | |||
|
Location |
Body (cg10718608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 9.46E-01 | Statistic Test | p-value: 4.36E-02; Z-score: 3.36E-01 | ||
|
Methylation in Case |
-1.97E+00 (Median) | Methylation in Control | -2.09E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg04308167) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 6.87E-04; Z-score: -9.00E-01 | ||
|
Methylation in Case |
3.86E-01 (Median) | Methylation in Control | 4.96E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg08895056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 8.62E-03; Z-score: 4.86E-01 | ||
|
Methylation in Case |
9.34E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg10718608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.75E-02; Z-score: -3.83E-01 | ||
|
Methylation in Case |
7.59E-01 (Median) | Methylation in Control | 7.96E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC47A1 in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg11784214) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.51E+00 | Statistic Test | p-value: 2.49E-02; Z-score: -6.29E-01 | ||
|
Methylation in Case |
1.74E-01 (Median) | Methylation in Control | 2.62E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC47A1 in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg12799818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 2.97E-02; Z-score: 8.34E-01 | ||
|
Methylation in Case |
6.40E-01 (Median) | Methylation in Control | 5.27E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC47A1 in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
Body (cg12894055) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.11E-02; Z-score: 3.82E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC47A1 in atypical teratoid rhabdoid tumor | [ 16 ] | |||
|
Location |
3'UTR (cg12550399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.60E+00 | Statistic Test | p-value: 1.55E-11; Z-score: -1.75E+00 | ||
|
Methylation in Case |
2.62E-01 (Median) | Methylation in Control | 4.19E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in depression | [ 17 ] | |||
|
Location |
Body (cg16887170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.07E-03; Z-score: -6.47E-01 | ||
|
Methylation in Case |
7.63E-01 (Median) | Methylation in Control | 7.80E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in papillary thyroid cancer | [ 18 ] | |||
|
Location |
Body (cg12894055) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.65E+00 | Statistic Test | p-value: 2.07E-17; Z-score: -1.68E+00 | ||
|
Methylation in Case |
9.77E-02 (Median) | Methylation in Control | 1.61E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in papillary thyroid cancer | [ 18 ] | |||
|
Location |
Body (cg26959235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 5.83E-16; Z-score: -1.96E+00 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 1.91E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in papillary thyroid cancer | [ 18 ] | |||
|
Location |
Body (cg24151087) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 1.46E-13; Z-score: -2.20E+00 | ||
|
Methylation in Case |
4.10E-01 (Median) | Methylation in Control | 5.41E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC47A1 in papillary thyroid cancer | [ 18 ] | |||
|
Location |
Body (cg08895056) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 3.58E-12; Z-score: -1.97E+00 | ||
|
Methylation in Case |
3.56E-01 (Median) | Methylation in Control | 4.70E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC47A1 in papillary thyroid cancer | [ 18 ] | |||
|
Location |
Body (cg10718608) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 1.10E-10; Z-score: -1.78E+00 | ||
|
Methylation in Case |
3.68E-01 (Median) | Methylation in Control | 4.60E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC47A1 in papillary thyroid cancer | [ 18 ] | |||
|
Location |
Body (cg12799818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 3.35E-07; Z-score: -1.56E+00 | ||
|
Methylation in Case |
2.92E-01 (Median) | Methylation in Control | 3.90E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC47A1 in papillary thyroid cancer | [ 18 ] | |||
|
Location |
Body (cg17332016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.43E-03; Z-score: -4.84E-01 | ||
|
Methylation in Case |
4.25E-02 (Median) | Methylation in Control | 4.68E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC47A1 in papillary thyroid cancer | [ 18 ] | |||
|
Location |
Body (cg04308167) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.31E-02; Z-score: -4.65E-01 | ||
|
Methylation in Case |
7.60E-01 (Median) | Methylation in Control | 7.85E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC47A1 in systemic lupus erythematosus | [ 19 ] | |||
|
Location |
Body (cg04308167) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 6.32E-03; Z-score: -3.99E-01 | ||
|
Methylation in Case |
4.89E-01 (Median) | Methylation in Control | 5.44E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC47A1 in systemic lupus erythematosus | [ 19 ] | |||
|
Location |
Body (cg11784214) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.40E-02; Z-score: -1.44E-01 | ||
|
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC47A1 in systemic lupus erythematosus | [ 19 ] | |||
|
Location |
Body (cg12894055) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.79E-02; Z-score: -1.01E-01 | ||
|
Methylation in Case |
7.10E-02 (Median) | Methylation in Control | 7.53E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC47A1 in systemic lupus erythematosus | [ 19 ] | |||
|
Location |
Body (cg16887170) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.38E-02; Z-score: -8.87E-02 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 7.94E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate/moderate hypermethylation of SLC47A1 in gastric cancer than that in healthy individual/adjacent tissue | ||||
Studied Phenotype |
Gastric cancer [ICD-11:2B72] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.98E-15; Fold-change: 0.209868716; Z-score: 1.624788814 | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 8.21E-66; Fold-change: 0.284929054; Z-score: 170.8903475 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC47A1 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.037135313; Fold-change: 0.242405384; Z-score: 9.410363493 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
microRNA |
|||||
|
Unclear Phenotype |
52 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-1275 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1275 | miRNA Mature ID | miR-1275 | ||
|
miRNA Sequence |
GUGGGGGAGAGGCUGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 2 |
miR-1307 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1307 | miRNA Mature ID | miR-1307-3p | ||
|
miRNA Sequence |
ACUCGGCGUGGCGUCGGUCGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-1343 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1343 | miRNA Mature ID | miR-1343-5p | ||
|
miRNA Sequence |
UGGGGAGCGGCCCCCGGGUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 4 |
miR-149 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-149 | miRNA Mature ID | miR-149-3p | ||
|
miRNA Sequence |
AGGGAGGGACGGGGGCUGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 5 |
miR-181d directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-181d | miRNA Mature ID | miR-181d-3p | ||
|
miRNA Sequence |
CCACCGGGGGAUGAAUGUCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 6 |
miR-1908 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1908 | miRNA Mature ID | miR-1908-5p | ||
|
miRNA Sequence |
CGGCGGGGACGGCGAUUGGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-212 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-212 | miRNA Mature ID | miR-212-5p | ||
|
miRNA Sequence |
ACCUUGGCUCUAGACUGCUUACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 8 |
miR-3144 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3144 | miRNA Mature ID | miR-3144-5p | ||
|
miRNA Sequence |
AGGGGACCAAAGAGAUAUAUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-3189 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3189 | miRNA Mature ID | miR-3189-3p | ||
|
miRNA Sequence |
CCCUUGGGUCUGAUGGGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-326 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-326 | miRNA Mature ID | miR-326 | ||
|
miRNA Sequence |
CCUCUGGGCCCUUCCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 11 |
miR-330 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-330 | miRNA Mature ID | miR-330-5p | ||
|
miRNA Sequence |
UCUCUGGGCCUGUGUCUUAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 12 |
miR-3616 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3616 | miRNA Mature ID | miR-3616-3p | ||
|
miRNA Sequence |
CGAGGGCAUUUCAUGAUGCAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 13 |
miR-3960 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3960 | miRNA Mature ID | miR-3960 | ||
|
miRNA Sequence |
GGCGGCGGCGGAGGCGGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 14 |
miR-4300 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4300 | miRNA Mature ID | miR-4300 | ||
|
miRNA Sequence |
UGGGAGCUGGACUACUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 15 |
miR-4467 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4467 | miRNA Mature ID | miR-4467 | ||
|
miRNA Sequence |
UGGCGGCGGUAGUUAUGGGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 16 |
miR-4525 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4525 | miRNA Mature ID | miR-4525 | ||
|
miRNA Sequence |
GGGGGGAUGUGCAUGCUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 17 |
miR-4655 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4655 | miRNA Mature ID | miR-4655-5p | ||
|
miRNA Sequence |
CACCGGGGAUGGCAGAGGGUCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 18 |
miR-4665 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4665 | miRNA Mature ID | miR-4665-5p | ||
|
miRNA Sequence |
CUGGGGGACGCGUGAGCGCGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 19 |
miR-4667 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4667 | miRNA Mature ID | miR-4667-5p | ||
|
miRNA Sequence |
ACUGGGGAGCAGAAGGAGAACC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 20 |
miR-4680 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4680 | miRNA Mature ID | miR-4680-5p | ||
|
miRNA Sequence |
AGAACUCUUGCAGUCUUAGAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 21 |
miR-4700 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4700 | miRNA Mature ID | miR-4700-5p | ||
|
miRNA Sequence |
UCUGGGGAUGAGGACAGUGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 22 |
miR-4706 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4706 | miRNA Mature ID | miR-4706 | ||
|
miRNA Sequence |
AGCGGGGAGGAAGUGGGCGCUGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 23 |
miR-4723 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4723 | miRNA Mature ID | miR-4723-5p | ||
|
miRNA Sequence |
UGGGGGAGCCAUGAGAUAAGAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 24 |
miR-4728 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4728 | miRNA Mature ID | miR-4728-5p | ||
|
miRNA Sequence |
UGGGAGGGGAGAGGCAGCAAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 25 |
miR-4730 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4730 | miRNA Mature ID | miR-4730 | ||
|
miRNA Sequence |
CUGGCGGAGCCCAUUCCAUGCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 26 |
miR-4749 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4749 | miRNA Mature ID | miR-4749-5p | ||
|
miRNA Sequence |
UGCGGGGACAGGCCAGGGCAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 27 |
miR-5008 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5008 | miRNA Mature ID | miR-5008-5p | ||
|
miRNA Sequence |
UGAGGCCCUUGGGGCACAGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 28 |
miR-5010 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5010 | miRNA Mature ID | miR-5010-5p | ||
|
miRNA Sequence |
AGGGGGAUGGCAGAGCAAAAUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 29 |
miR-514a directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-514a | miRNA Mature ID | miR-514a-5p | ||
|
miRNA Sequence |
UACUCUGGAGAGUGACAAUCAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 30 |
miR-5591 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5591 | miRNA Mature ID | miR-5591-5p | ||
|
miRNA Sequence |
UGGGAGCUAAGCUAUGGGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 31 |
miR-5698 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5698 | miRNA Mature ID | miR-5698 | ||
|
miRNA Sequence |
UGGGGGAGUGCAGUGAUUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 32 |
miR-625 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-625 | miRNA Mature ID | miR-625-5p | ||
|
miRNA Sequence |
AGGGGGAAAGUUCUAUAGUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 33 |
miR-637 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-637 | miRNA Mature ID | miR-637 | ||
|
miRNA Sequence |
ACUGGGGGCUUUCGGGCUCUGCGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 34 |
miR-663a directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-663a | miRNA Mature ID | miR-663a | ||
|
miRNA Sequence |
AGGCGGGGCGCCGCGGGACCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 35 |
miR-6726 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6726 | miRNA Mature ID | miR-6726-5p | ||
|
miRNA Sequence |
CGGGAGCUGGGGUCUGCAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 36 |
miR-6770 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6770 | miRNA Mature ID | miR-6770-3p | ||
|
miRNA Sequence |
CUGGCGGCUGUGUCUUCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 37 |
miR-6777 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6777 | miRNA Mature ID | miR-6777-5p | ||
|
miRNA Sequence |
ACGGGGAGUCAGGCAGUGGUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 38 |
miR-6784 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6784 | miRNA Mature ID | miR-6784-5p | ||
|
miRNA Sequence |
GCCGGGGCUUUGGGUGAGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 39 |
miR-6785 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6785 | miRNA Mature ID | miR-6785-5p | ||
|
miRNA Sequence |
UGGGAGGGCGUGGAUGAUGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 40 |
miR-6787 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6787 | miRNA Mature ID | miR-6787-5p | ||
|
miRNA Sequence |
UGGCGGGGGUAGAGCUGGCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 41 |
miR-6825 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6825 | miRNA Mature ID | miR-6825-5p | ||
|
miRNA Sequence |
UGGGGAGGUGUGGAGUCAGCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 42 |
miR-6851 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6851 | miRNA Mature ID | miR-6851-3p | ||
|
miRNA Sequence |
UGGCCCUUUGUACCCCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 43 |
miR-6870 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6870 | miRNA Mature ID | miR-6870-5p | ||
|
miRNA Sequence |
UGGGGGAGAUGGGGGUUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 44 |
miR-6883 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6883 | miRNA Mature ID | miR-6883-5p | ||
|
miRNA Sequence |
AGGGAGGGUGUGGUAUGGAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 45 |
miR-6889 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6889 | miRNA Mature ID | miR-6889-5p | ||
|
miRNA Sequence |
UCGGGGAGUCUGGGGUCCGGAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 46 |
miR-7111 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7111 | miRNA Mature ID | miR-7111-5p | ||
|
miRNA Sequence |
UGGGGGAGGAAGGACAGGCCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 47 |
miR-7155 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7155 | miRNA Mature ID | miR-7155-5p | ||
|
miRNA Sequence |
UCUGGGGUCUUGGGCCAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 48 |
miR-7160 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7160 | miRNA Mature ID | miR-7160-3p | ||
|
miRNA Sequence |
CAGGGCCCUGGCUUUAGCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 49 |
miR-8072 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8072 | miRNA Mature ID | miR-8072 | ||
|
miRNA Sequence |
GGCGGCGGGGAGGUAGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 50 |
miR-8089 directly targets SLC47A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8089 | miRNA Mature ID | miR-8089 | ||
|
miRNA Sequence |
CCUGGGGACAGGGGAUUGGGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 51 |
miR-920 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-920 | miRNA Mature ID | miR-920 | ||
|
miRNA Sequence |
GGGGAGCUGUGGAAGCAGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 52 |
miR-939 directly targets SLC47A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-939 | miRNA Mature ID | miR-939-5p | ||
|
miRNA Sequence |
UGGGGAGCUGAGGCUCUGGGGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Human liver tissue |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-95 regulates SLC47A1 expression | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Taqman OpenArray Human miRNA Panel | ||
|
miRNA Stemloop ID |
miR-95 | miRNA Mature ID | miR-95-5p | ||
|
miRNA Sequence |
UCAAUAAAUGUCUGUUGAAUU | ||||
|
miRNA Target Type |
Undirect | ||||
|
Studied Phenotype |
Human liver tissue | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
The effects of rifampin on four uptake drug transporters SLC47A1 were negatively correlated with the rifampin effects on miR-95 expression(r=-0.79, p=0.0048). | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples