General Information of Drug Transporter (DT)
DT ID DTD0009 Transporter Info
Gene Name SLC22A3
Transporter Name Organic cation transporter 3
Gene ID
6581
UniProt ID
O75751
Epigenetic Regulations of This DT (EGR)

Methylation

  Prostate cancer

         15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Hypermethylation of SLC22A3 in prostate cancer [ 1 ]

Location

Promoter

Epigenetic Type

Methylation Experiment Method Methylation-specific PCR

Related Molecular Changes

Down regulation of SLC22A3 Experiment Method RT-qPCR

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Frequency

62% of the studied tumor samples

Experimental Material

Patient tissue samples

Additional Notes

Aberrant methylation contributes to the reduced expression of OCT3 in prostate cancer.

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

TSS1500 (cg19936194)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.82E+00 Statistic Test p-value: 1.10E-04; Z-score: 8.72E+00

Methylation in Case

1.29E-01 (Median) Methylation in Control 7.08E-02 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

TSS1500 (cg27520549)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.12E+00 Statistic Test p-value: 2.31E-02; Z-score: 1.66E+00

Methylation in Case

9.17E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

TSS200 (cg07589968)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.41E+00 Statistic Test p-value: 7.97E-03; Z-score: 7.46E+00

Methylation in Case

6.61E-01 (Median) Methylation in Control 4.68E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

1stExon (cg06987672)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.00E+00 Statistic Test p-value: 2.23E-02; Z-score: 8.99E+00

Methylation in Case

1.78E-01 (Median) Methylation in Control 8.89E-02 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

1stExon (cg09840840)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.45E+00 Statistic Test p-value: 4.68E-02; Z-score: -2.18E+00

Methylation in Case

5.05E-02 (Median) Methylation in Control 7.30E-02 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

Body (cg03816707)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.12E+00 Statistic Test p-value: 2.57E-03; Z-score: 3.88E+00

Methylation in Case

5.43E-01 (Median) Methylation in Control 2.57E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

Body (cg03924551)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.24E+00 Statistic Test p-value: 3.15E-03; Z-score: 2.84E+00

Methylation in Case

8.75E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

Body (cg02114341)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.13E+00 Statistic Test p-value: 3.96E-03; Z-score: 3.03E+00

Methylation in Case

9.10E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

Body (cg12619347)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.27E+00 Statistic Test p-value: 9.34E-03; Z-score: -3.31E+00

Methylation in Case

6.03E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

Body (cg01432055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 9.92E-03; Z-score: 2.59E+00

Methylation in Case

9.52E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

Body (cg09790270)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.36E+00 Statistic Test p-value: 2.57E-02; Z-score: 2.30E+00

Methylation in Case

7.07E-01 (Median) Methylation in Control 5.19E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

Body (cg10125193)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.07E+00 Statistic Test p-value: 3.83E-02; Z-score: 1.93E+00

Methylation in Case

9.09E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

Body (cg20083442)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.48E+00 Statistic Test p-value: 3.92E-02; Z-score: -3.02E+00

Methylation in Case

4.19E-01 (Median) Methylation in Control 6.17E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC22A3 in prostate cancer [ 13 ]

Location

Body (cg22077670)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.27E+00 Statistic Test p-value: 4.81E-02; Z-score: 1.81E+00

Methylation in Case

8.28E-01 (Median) Methylation in Control 6.55E-01 (Median)

Studied Phenotype

Prostate cancer [ ICD-11: 2C82]

Experimental Material

Patient tissue samples

  Diabetes

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Hypermethylation of SLC22A3 in diabetes [ 2 ]

Location

Promoter (5 CpG sites)

Epigenetic Type

Methylation Experiment Method HumanMethylation450 BeadChip

Related Molecular Changes

Down regulation of SLC22A3 Experiment Method RT-qPCR

Studied Phenotype

Diabetes [ ICD-11: 5A10-5A14]

Experimental Material

Patient tissue samples

Additional Notes

Higher methylation in a CpG site located in SLC22A3 was associated with lower expression in the human liver and also with insulin plus metformin therapy, higher glucose levels, and BMI.

  Esophageal squamous cell carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Hypermethylation of SLC22A3 in esophageal squamous cell carcinoma [ 3 ]

Location

Promoter

Epigenetic Type

Methylation Experiment Method Methylation-specific PCR

Related Molecular Changes

Down regulation of SLC22A3 Experiment Method RT-qPCR

Studied Phenotype

Esophageal squamous cell carcinoma [ ICD-11: 2E60.1]

Experimental Material

Patient tissue samples

Additional Notes

SLC22A3 promoter Hypermethylation may directly suppresses its gene transcription, resulting in increased susceptibility to ESCC in high-risk individuals.

  Pancretic ductal adenocarcinoma

         10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in pancretic ductal adenocarcinoma [ 4 ]

Location

5'UTR (cg27403989)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.14E+00 Statistic Test p-value: 1.51E-05; Z-score: -1.23E+00

Methylation in Case

7.10E-01 (Median) Methylation in Control 8.11E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in pancretic ductal adenocarcinoma [ 4 ]

Location

5'UTR (cg07007420)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 2.87E-04; Z-score: -4.82E-01

Methylation in Case

8.93E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in pancretic ductal adenocarcinoma [ 4 ]

Location

TSS1500 (cg13875111)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.20E+00 Statistic Test p-value: 3.67E-02; Z-score: -6.99E-01

Methylation in Case

1.48E-01 (Median) Methylation in Control 1.78E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in pancretic ductal adenocarcinoma [ 4 ]

Location

TSS200 (cg04431946)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.39E+00 Statistic Test p-value: 2.19E-31; Z-score: 5.00E+00

Methylation in Case

5.04E-01 (Median) Methylation in Control 2.11E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in pancretic ductal adenocarcinoma [ 4 ]

Location

TSS200 (cg17920479)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.39E+00 Statistic Test p-value: 3.81E-18; Z-score: 2.96E+00

Methylation in Case

4.49E-01 (Median) Methylation in Control 3.22E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC22A3 in pancretic ductal adenocarcinoma [ 4 ]

Location

TSS200 (cg18313899)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.72E+00 Statistic Test p-value: 7.48E-17; Z-score: 3.10E+00

Methylation in Case

2.60E-01 (Median) Methylation in Control 1.51E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC22A3 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg27315497)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.25E+00 Statistic Test p-value: 1.32E-11; Z-score: 2.34E+00

Methylation in Case

5.50E-01 (Median) Methylation in Control 4.41E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC22A3 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg09359103)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.44E+00 Statistic Test p-value: 3.74E-10; Z-score: -1.71E+00

Methylation in Case

3.31E-01 (Median) Methylation in Control 4.76E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC22A3 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg04860674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 5.68E-09; Z-score: -9.67E-01

Methylation in Case

8.47E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC22A3 in pancretic ductal adenocarcinoma [ 4 ]

Location

Body (cg04036777)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.16E+00 Statistic Test p-value: 3.60E-03; Z-score: -6.49E-01

Methylation in Case

4.40E-01 (Median) Methylation in Control 5.12E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Bladder cancer

         13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

TSS1500 (cg25313204)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.32E+00 Statistic Test p-value: 1.83E-03; Z-score: -2.09E+00

Methylation in Case

4.05E-01 (Median) Methylation in Control 5.35E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

TSS1500 (cg22117918)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.27E+00 Statistic Test p-value: 3.83E-02; Z-score: 1.40E+00

Methylation in Case

2.03E-01 (Median) Methylation in Control 1.60E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

Body (cg23898998)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.46E+00 Statistic Test p-value: 2.00E-07; Z-score: -1.15E+01

Methylation in Case

4.58E-01 (Median) Methylation in Control 6.68E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

Body (cg09226986)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.69E+00 Statistic Test p-value: 3.02E-05; Z-score: 5.16E+00

Methylation in Case

7.96E-01 (Median) Methylation in Control 4.72E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

Body (cg04794858)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.16E+00 Statistic Test p-value: 2.64E-04; Z-score: -5.28E+00

Methylation in Case

7.45E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

Body (cg13280882)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 1.33E-03; Z-score: -1.96E+00

Methylation in Case

8.01E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

Body (cg01923312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.22E+00 Statistic Test p-value: 1.79E-03; Z-score: -3.77E+00

Methylation in Case

6.32E-01 (Median) Methylation in Control 7.70E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

Body (cg15363979)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 5.22E-03; Z-score: -3.02E+00

Methylation in Case

8.95E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

Body (cg24358785)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.19E+00 Statistic Test p-value: 7.04E-03; Z-score: 3.45E+00

Methylation in Case

6.73E-01 (Median) Methylation in Control 5.67E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

Body (cg06295784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.09E+00 Statistic Test p-value: 1.23E-02; Z-score: -1.89E+00

Methylation in Case

6.17E-01 (Median) Methylation in Control 6.75E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

Body (cg14255768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 3.15E-02; Z-score: -6.38E-01

Methylation in Case

5.07E-01 (Median) Methylation in Control 5.23E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

Body (cg17768600)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.14E+00 Statistic Test p-value: 4.23E-02; Z-score: 1.81E+00

Methylation in Case

7.28E-01 (Median) Methylation in Control 6.41E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC22A3 in bladder cancer [ 5 ]

Location

3'UTR (cg00321824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.41E+00 Statistic Test p-value: 9.40E-08; Z-score: -1.35E+01

Methylation in Case

5.70E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Breast cancer

         22 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

TSS1500 (cg22117918)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.26E+00 Statistic Test p-value: 6.87E-09; Z-score: 1.49E+00

Methylation in Case

2.80E-01 (Median) Methylation in Control 2.22E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

TSS1500 (cg07883823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.32E+00 Statistic Test p-value: 8.44E-08; Z-score: 1.48E+00

Methylation in Case

3.14E-01 (Median) Methylation in Control 2.37E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

TSS1500 (cg21110739)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 2.79E-07; Z-score: -1.26E+00

Methylation in Case

7.68E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

TSS1500 (cg25313204)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 2.50E-03; Z-score: -7.53E-01

Methylation in Case

5.95E-01 (Median) Methylation in Control 6.44E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

TSS200 (cg17364114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.41E+00 Statistic Test p-value: 3.71E-08; Z-score: 1.16E+00

Methylation in Case

1.44E-01 (Median) Methylation in Control 5.98E-02 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

1stExon (cg07237939)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.63E+00 Statistic Test p-value: 2.56E-10; Z-score: 1.90E+00

Methylation in Case

1.07E-01 (Median) Methylation in Control 4.05E-02 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg23898998)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.50E+00 Statistic Test p-value: 2.93E-24; Z-score: -5.02E+00

Methylation in Case

4.70E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg15020894)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.55E+00 Statistic Test p-value: 4.72E-22; Z-score: -3.09E+00

Methylation in Case

3.70E-01 (Median) Methylation in Control 5.74E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg04794858)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.37E+00 Statistic Test p-value: 5.42E-20; Z-score: -6.89E+00

Methylation in Case

6.27E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg15363979)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.10E+00 Statistic Test p-value: 1.53E-14; Z-score: -3.09E+00

Methylation in Case

8.14E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg09226986)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.61E+00 Statistic Test p-value: 3.47E-14; Z-score: 2.89E+00

Methylation in Case

5.65E-01 (Median) Methylation in Control 3.51E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg13280882)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.14E+00 Statistic Test p-value: 7.63E-11; Z-score: -2.96E+00

Methylation in Case

7.44E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg02042585)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.17E+00 Statistic Test p-value: 1.04E-10; Z-score: -1.73E+00

Methylation in Case

6.36E-01 (Median) Methylation in Control 7.46E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg17768600)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.18E+00 Statistic Test p-value: 8.44E-09; Z-score: -1.60E+00

Methylation in Case

5.70E-01 (Median) Methylation in Control 6.70E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg14255768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.43E+00 Statistic Test p-value: 2.97E-08; Z-score: -1.87E+00

Methylation in Case

3.72E-01 (Median) Methylation in Control 5.31E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 16

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg19149031)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.13E+00 Statistic Test p-value: 3.69E-07; Z-score: -1.32E+00

Methylation in Case

7.54E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 17

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg18126027)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 2.74E-06; Z-score: -1.25E+00

Methylation in Case

8.08E-01 (Median) Methylation in Control 8.72E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 18

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg24358785)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.12E+00 Statistic Test p-value: 5.55E-06; Z-score: -1.28E+00

Methylation in Case

5.57E-01 (Median) Methylation in Control 6.23E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 19

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg08303612)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.20E+00 Statistic Test p-value: 1.40E-05; Z-score: 5.41E-01

Methylation in Case

1.39E-01 (Median) Methylation in Control 1.17E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 20

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg11696576)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.09E+00 Statistic Test p-value: 4.87E-04; Z-score: -5.11E-01

Methylation in Case

6.61E-01 (Median) Methylation in Control 7.23E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 21

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

Body (cg06295784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.01E+00 Statistic Test p-value: 1.43E-02; Z-score: 1.15E-01

Methylation in Case

6.69E-01 (Median) Methylation in Control 6.64E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 22

Methylation of SLC22A3 in breast cancer [ 6 ]

Location

3'UTR (cg00321824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.36E+00 Statistic Test p-value: 8.19E-16; Z-score: -3.48E+00

Methylation in Case

5.82E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in clear cell renal cell carcinoma [ 7 ]

Location

TSS1500 (cg21110739)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 1.42E-04; Z-score: -1.09E+00

Methylation in Case

8.93E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in clear cell renal cell carcinoma [ 7 ]

Location

TSS1500 (cg22117918)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.16E+00 Statistic Test p-value: 2.44E-02; Z-score: 5.00E-01

Methylation in Case

1.61E-01 (Median) Methylation in Control 1.39E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in clear cell renal cell carcinoma [ 7 ]

Location

TSS200 (cg17364114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.29E+00 Statistic Test p-value: 3.51E-02; Z-score: 2.07E-01

Methylation in Case

2.36E-02 (Median) Methylation in Control 1.83E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in clear cell renal cell carcinoma [ 7 ]

Location

1stExon (cg07237939)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.16E+00 Statistic Test p-value: 2.53E-02; Z-score: 2.01E-01

Methylation in Case

2.13E-02 (Median) Methylation in Control 1.83E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in clear cell renal cell carcinoma [ 7 ]

Location

Body (cg15363979)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 1.51E-06; Z-score: -1.34E+00

Methylation in Case

9.14E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC22A3 in clear cell renal cell carcinoma [ 7 ]

Location

Body (cg13280882)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 1.25E-02; Z-score: -6.79E-01

Methylation in Case

8.78E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC22A3 in clear cell renal cell carcinoma [ 7 ]

Location

Body (cg02042585)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 1.81E-02; Z-score: -6.75E-01

Methylation in Case

8.61E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in colorectal cancer [ 8 ]

Location

TSS1500 (cg21110739)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 6.15E-04; Z-score: -9.57E-01

Methylation in Case

9.30E-01 (Median) Methylation in Control 9.38E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in colorectal cancer [ 8 ]

Location

Body (cg15363979)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 6.80E-04; Z-score: -1.16E+00

Methylation in Case

9.27E-01 (Median) Methylation in Control 9.37E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in colorectal cancer [ 8 ]

Location

Body (cg23898998)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 1.75E-02; Z-score: -4.43E-01

Methylation in Case

8.50E-01 (Median) Methylation in Control 8.68E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in colorectal cancer [ 8 ]

Location

Body (cg14255768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 3.20E-02; Z-score: -6.66E-01

Methylation in Case

8.01E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in colorectal cancer [ 8 ]

Location

Body (cg11696576)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 4.56E-02; Z-score: -3.56E-01

Methylation in Case

8.90E-01 (Median) Methylation in Control 9.08E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC22A3 in colorectal cancer [ 8 ]

Location

Body (cg06295784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.13E+00 Statistic Test p-value: 4.93E-02; Z-score: -7.32E-01

Methylation in Case

6.67E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC22A3 in colorectal cancer [ 8 ]

Location

3'UTR (cg00321824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 4.46E-03; Z-score: -3.83E-01

Methylation in Case

7.98E-01 (Median) Methylation in Control 8.14E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

         18 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

TSS1500 (cg26489057)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.77E+00 Statistic Test p-value: 1.47E-13; Z-score: 3.67E+00

Methylation in Case

5.21E-01 (Median) Methylation in Control 2.94E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

TSS1500 (cg07883823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.43E+00 Statistic Test p-value: 3.54E-04; Z-score: -1.05E+00

Methylation in Case

1.21E-01 (Median) Methylation in Control 1.72E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

TSS1500 (cg22117918)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.33E+00 Statistic Test p-value: 2.10E-03; Z-score: -9.30E-01

Methylation in Case

1.18E-01 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

TSS200 (cg17364114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -2.08E+00 Statistic Test p-value: 4.44E-04; Z-score: -5.64E-01

Methylation in Case

2.35E-02 (Median) Methylation in Control 4.91E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

1stExon (cg07237939)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.43E+00 Statistic Test p-value: 1.91E-04; Z-score: -5.09E-01

Methylation in Case

3.13E-02 (Median) Methylation in Control 4.48E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg00706648)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.25E+00 Statistic Test p-value: 8.10E-25; Z-score: -7.57E+00

Methylation in Case

6.38E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg14387909)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.69E+00 Statistic Test p-value: 8.57E-17; Z-score: -7.87E+00

Methylation in Case

5.26E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg03912954)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.41E+00 Statistic Test p-value: 5.76E-16; Z-score: 5.00E+00

Methylation in Case

2.70E-01 (Median) Methylation in Control 1.12E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg09226986)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.05E+00 Statistic Test p-value: 1.32E-08; Z-score: 9.32E-01

Methylation in Case

8.31E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg15020894)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.28E+00 Statistic Test p-value: 3.42E-08; Z-score: -1.85E+00

Methylation in Case

3.56E-01 (Median) Methylation in Control 4.56E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg11696576)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.28E+00 Statistic Test p-value: 3.62E-08; Z-score: -1.35E+00

Methylation in Case

4.35E-01 (Median) Methylation in Control 5.57E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg13280882)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.13E+00 Statistic Test p-value: 3.47E-07; Z-score: -1.29E+00

Methylation in Case

7.15E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 13

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg06295784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.23E+00 Statistic Test p-value: 1.53E-05; Z-score: -1.07E+00

Methylation in Case

4.25E-01 (Median) Methylation in Control 5.22E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 14

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg08303612)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.23E+00 Statistic Test p-value: 2.82E-05; Z-score: -7.84E-01

Methylation in Case

6.81E-02 (Median) Methylation in Control 8.34E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 15

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg02042585)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 7.03E-05; Z-score: 6.58E-01

Methylation in Case

8.12E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 16

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg07349212)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.17E+00 Statistic Test p-value: 6.88E-04; Z-score: -7.22E-01

Methylation in Case

5.95E-02 (Median) Methylation in Control 6.94E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 17

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg17768600)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 1.02E-02; Z-score: 4.12E-01

Methylation in Case

7.32E-01 (Median) Methylation in Control 7.05E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 18

Methylation of SLC22A3 in hepatocellular carcinoma [ 9 ]

Location

Body (cg18126027)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 4.86E-02; Z-score: -1.42E-01

Methylation in Case

8.64E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  HIV infection

         11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in HIV infection [ 10 ]

Location

TSS1500 (cg07883823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.59E+00 Statistic Test p-value: 2.26E-06; Z-score: 2.66E+00

Methylation in Case

2.44E-01 (Median) Methylation in Control 1.54E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in HIV infection [ 10 ]

Location

TSS1500 (cg22117918)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.29E+00 Statistic Test p-value: 1.39E-05; Z-score: 1.68E+00

Methylation in Case

2.15E-01 (Median) Methylation in Control 1.66E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in HIV infection [ 10 ]

Location

TSS200 (cg17364114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 6.68E+00 Statistic Test p-value: 1.28E-03; Z-score: 2.10E+00

Methylation in Case

1.05E-01 (Median) Methylation in Control 1.57E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in HIV infection [ 10 ]

Location

1stExon (cg07237939)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.79E+00 Statistic Test p-value: 1.88E-04; Z-score: 2.08E+00

Methylation in Case

5.40E-02 (Median) Methylation in Control 1.93E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in HIV infection [ 10 ]

Location

Body (cg04794858)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 1.40E-04; Z-score: -1.04E+00

Methylation in Case

8.88E-01 (Median) Methylation in Control 9.20E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC22A3 in HIV infection [ 10 ]

Location

Body (cg15020894)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.13E+00 Statistic Test p-value: 2.20E-04; Z-score: -1.03E+00

Methylation in Case

4.67E-01 (Median) Methylation in Control 5.26E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC22A3 in HIV infection [ 10 ]

Location

Body (cg08303612)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.29E+00 Statistic Test p-value: 5.28E-04; Z-score: 1.21E+00

Methylation in Case

1.06E-01 (Median) Methylation in Control 8.20E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC22A3 in HIV infection [ 10 ]

Location

Body (cg15363979)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.02E+00 Statistic Test p-value: 6.38E-04; Z-score: 1.19E+00

Methylation in Case

9.41E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC22A3 in HIV infection [ 10 ]

Location

Body (cg23898998)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 8.23E-04; Z-score: -8.32E-01

Methylation in Case

8.10E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC22A3 in HIV infection [ 10 ]

Location

Body (cg07349212)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.09E+00 Statistic Test p-value: 1.27E-02; Z-score: 4.39E-01

Methylation in Case

7.00E-02 (Median) Methylation in Control 6.43E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC22A3 in HIV infection [ 10 ]

Location

Body (cg06295784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.02E+00 Statistic Test p-value: 1.88E-02; Z-score: 4.69E-01

Methylation in Case

7.91E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Lung adenocarcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in lung adenocarcinoma [ 11 ]

Location

TSS1500 (cg22117918)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.49E+00 Statistic Test p-value: 6.40E-03; Z-score: 2.54E+00

Methylation in Case

3.18E-01 (Median) Methylation in Control 2.14E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in lung adenocarcinoma [ 11 ]

Location

TSS1500 (cg07883823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.39E+00 Statistic Test p-value: 7.87E-03; Z-score: 1.91E+00

Methylation in Case

3.37E-01 (Median) Methylation in Control 2.42E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in lung adenocarcinoma [ 11 ]

Location

TSS200 (cg17364114)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 3.83E+00 Statistic Test p-value: 4.07E-04; Z-score: 7.16E+00

Methylation in Case

3.25E-01 (Median) Methylation in Control 8.50E-02 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in lung adenocarcinoma [ 11 ]

Location

1stExon (cg07237939)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 3.07E+00 Statistic Test p-value: 1.25E-03; Z-score: 6.50E+00

Methylation in Case

2.05E-01 (Median) Methylation in Control 6.68E-02 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in lung adenocarcinoma [ 11 ]

Location

Body (cg08303612)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.37E+00 Statistic Test p-value: 1.66E-02; Z-score: 2.49E+00

Methylation in Case

1.68E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in papillary thyroid cancer [ 12 ]

Location

TSS1500 (cg21110739)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 2.00E-05; Z-score: -1.25E+00

Methylation in Case

8.76E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in papillary thyroid cancer [ 12 ]

Location

TSS1500 (cg22117918)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.09E+00 Statistic Test p-value: 3.61E-04; Z-score: 5.18E-01

Methylation in Case

1.90E-01 (Median) Methylation in Control 1.74E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in papillary thyroid cancer [ 12 ]

Location

TSS1500 (cg07883823)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.10E+00 Statistic Test p-value: 2.36E-03; Z-score: 5.50E-01

Methylation in Case

2.21E-01 (Median) Methylation in Control 2.00E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in papillary thyroid cancer [ 12 ]

Location

Body (cg04794858)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 2.01E-04; Z-score: -7.11E-01

Methylation in Case

8.89E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in papillary thyroid cancer [ 12 ]

Location

Body (cg13280882)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 6.45E-04; Z-score: -8.51E-01

Methylation in Case

9.40E-01 (Median) Methylation in Control 9.51E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC22A3 in papillary thyroid cancer [ 12 ]

Location

Body (cg15363979)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 2.75E-03; Z-score: -4.56E-01

Methylation in Case

8.89E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC22A3 in papillary thyroid cancer [ 12 ]

Location

Body (cg06295784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 1.39E-02; Z-score: -3.89E-01

Methylation in Case

8.43E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC22A3 in papillary thyroid cancer [ 12 ]

Location

Body (cg18126027)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 2.68E-02; Z-score: -8.29E-01

Methylation in Case

8.96E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Colon cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in colon adenocarcinoma [ 14 ]

Location

TSS200 (cg13028471)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.20E+00 Statistic Test p-value: 3.50E-03; Z-score: -3.04E-01

Methylation in Case

6.58E-02 (Median) Methylation in Control 7.87E-02 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in colon adenocarcinoma [ 14 ]

Location

Body (cg04186249)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.31E+00 Statistic Test p-value: 1.73E-06; Z-score: -4.75E+00

Methylation in Case

5.55E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in colon adenocarcinoma [ 14 ]

Location

Body (cg05275995)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 1.97E-03; Z-score: -1.88E+00

Methylation in Case

7.43E-01 (Median) Methylation in Control 7.98E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in colon adenocarcinoma [ 14 ]

Location

Body (cg16523422)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.14E+00 Statistic Test p-value: 2.60E-03; Z-score: -2.01E+00

Methylation in Case

6.40E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in colon adenocarcinoma [ 14 ]

Location

Body (cg13071812)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.12E+00 Statistic Test p-value: 3.57E-03; Z-score: -6.98E-01

Methylation in Case

1.49E-01 (Median) Methylation in Control 1.67E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC22A3 in colon adenocarcinoma [ 14 ]

Location

3'UTR (cg20678043)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.29E+00 Statistic Test p-value: 4.17E-05; Z-score: -3.56E+00

Methylation in Case

5.67E-01 (Median) Methylation in Control 7.30E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

         12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in atypical teratoid rhabdoid tumor [ 15 ]

Location

1stExon (cg07237939)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.42E+00 Statistic Test p-value: 2.39E-21; Z-score: -3.90E+00

Methylation in Case

5.59E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in atypical teratoid rhabdoid tumor [ 15 ]

Location

Body (cg01923312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.19E+00 Statistic Test p-value: 1.03E-04; Z-score: -8.99E-01

Methylation in Case

6.58E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in atypical teratoid rhabdoid tumor [ 15 ]

Location

Body (cg02042585)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 1.11E-04; Z-score: -9.25E-01

Methylation in Case

7.57E-01 (Median) Methylation in Control 8.11E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in atypical teratoid rhabdoid tumor [ 15 ]

Location

Body (cg04794858)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 9.54E-04; Z-score: 7.88E-01

Methylation in Case

8.89E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in atypical teratoid rhabdoid tumor [ 15 ]

Location

Body (cg06295784)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.02E+00 Statistic Test p-value: 2.27E-03; Z-score: 6.78E-01

Methylation in Case

9.31E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of SLC22A3 in atypical teratoid rhabdoid tumor [ 15 ]

Location

Body (cg07349212)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 3.84E-03; Z-score: -6.99E-01

Methylation in Case

7.37E-01 (Median) Methylation in Control 7.90E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of SLC22A3 in atypical teratoid rhabdoid tumor [ 15 ]

Location

Body (cg08303612)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.17E+00 Statistic Test p-value: 5.74E-03; Z-score: 4.06E-01

Methylation in Case

1.43E-01 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of SLC22A3 in atypical teratoid rhabdoid tumor [ 15 ]

Location

Body (cg09226986)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 9.57E-03; Z-score: -4.48E-01

Methylation in Case

9.19E-01 (Median) Methylation in Control 9.27E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of SLC22A3 in atypical teratoid rhabdoid tumor [ 15 ]

Location

Body (cg11696576)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 2.46E-02; Z-score: -4.55E-01

Methylation in Case

7.03E-01 (Median) Methylation in Control 7.40E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 10

Methylation of SLC22A3 in atypical teratoid rhabdoid tumor [ 15 ]

Location

Body (cg13280882)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 3.38E-02; Z-score: -1.20E-01

Methylation in Case

9.68E-01 (Median) Methylation in Control 9.72E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 11

Methylation of SLC22A3 in atypical teratoid rhabdoid tumor [ 15 ]

Location

Body (cg14255768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.07E+00 Statistic Test p-value: 4.39E-02; Z-score: 5.86E-01

Methylation in Case

8.00E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 12

Methylation of SLC22A3 in atypical teratoid rhabdoid tumor [ 15 ]

Location

3'UTR (cg00321824)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.28E+00 Statistic Test p-value: 9.49E-16; Z-score: -2.45E+00

Methylation in Case

5.95E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Panic disorder

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in panic disorder [ 16 ]

Location

Body (cg18126027)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.18E+00 Statistic Test p-value: 6.78E-03; Z-score: 7.21E-01

Methylation in Case

1.71E+00 (Median) Methylation in Control 1.45E+00 (Median)

Studied Phenotype

Panic disorder [ ICD-11: 6B01]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in panic disorder [ 16 ]

Location

Body (cg01923312)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -5.04E-01 Statistic Test p-value: 2.49E-02; Z-score: -3.16E-01

Methylation in Case

-2.68E-01 (Median) Methylation in Control -1.35E-01 (Median)

Studied Phenotype

Panic disorder [ ICD-11: 6B01]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC22A3 in systemic lupus erythematosus [ 17 ]

Location

Body (cg14255768)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 6.48E-04; Z-score: -1.39E-01

Methylation in Case

5.99E-01 (Median) Methylation in Control 6.07E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC22A3 in systemic lupus erythematosus [ 17 ]

Location

Body (cg15363979)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 2.56E-02; Z-score: -1.17E-01

Methylation in Case

9.10E-01 (Median) Methylation in Control 9.12E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC22A3 in systemic lupus erythematosus [ 17 ]

Location

Body (cg04794858)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 2.59E-02; Z-score: -2.29E-01

Methylation in Case

8.66E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of SLC22A3 in systemic lupus erythematosus [ 17 ]

Location

Body (cg23898998)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 3.27E-02; Z-score: -1.47E-01

Methylation in Case

7.86E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of SLC22A3 in systemic lupus erythematosus [ 17 ]

Location

Body (cg19149031)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.00E+00 Statistic Test p-value: 4.01E-02; Z-score: 6.60E-02

Methylation in Case

8.69E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

microRNA

  Coronary artery disease

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

miR-147a downregulates SLC22A3 expression in coronary artery disease [ 18 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

Down regulation of SLC22A3 Experiment Method RT-qPCR

miRNA Stemloop ID

miR-147a miRNA Mature ID Unclear

miRNA Target Type

Direct

Studied Phenotype

Coronary artery disease [ ICD-11: BA6Z]

Experimental Material

Multiple cell lines of human

Additional Notes

The rs3088442 G allele might suppress miR-147a binding to the 3'-UTR region of SLC22A3, resulting in altered SLC22A3 and LPA gene expression.

  Unclear Phenotype

         24 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

miR-124 directly targets SLC22A3 [ 19 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

miR-1272 directly targets SLC22A3 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1272 miRNA Mature ID miR-1272

miRNA Sequence

GAUGAUGAUGGCAGCAAAUUCUGAAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 3

miR-130b directly targets SLC22A3 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-130b miRNA Mature ID miR-130b-5p

miRNA Sequence

ACUCUUUCCCUGUUGCACUAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 4

miR-1322 directly targets SLC22A3 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1322 miRNA Mature ID miR-1322

miRNA Sequence

GAUGAUGCUGCUGAUGCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 5

miR-147a directly targets SLC22A3 [ 18 ]

Epigenetic Type

microRNA Experiment Method Luciferase reporter assay

miRNA Stemloop ID

miR-147a miRNA Mature ID miR-147a

miRNA Sequence

GUGUGUGGAAAUGCUUCUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 6

miR-148b directly targets SLC22A3 [ 21 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-148b miRNA Mature ID miR-148b-3p

miRNA Sequence

UCAGUGCAUCACAGAACUUUGU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 7

miR-23a directly targets SLC22A3 [ 22 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-23a miRNA Mature ID miR-23a-5p

miRNA Sequence

GGGGUUCCUGGGGAUGGGAUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 8

miR-23b directly targets SLC22A3 [ 22 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-23b miRNA Mature ID miR-23b-5p

miRNA Sequence

UGGGUUCCUGGCAUGCUGAUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 9

miR-3940 directly targets SLC22A3 [ 22 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3940 miRNA Mature ID miR-3940-5p

miRNA Sequence

GUGGGUUGGGGCGGGCUCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 10

miR-4291 directly targets SLC22A3 [ 22 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4291 miRNA Mature ID miR-4291

miRNA Sequence

UUCAGCAGGAACAGCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 11

miR-4330 directly targets SLC22A3 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4330 miRNA Mature ID miR-4330

miRNA Sequence

CCUCAGAUCAGAGCCUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 12

miR-4494 directly targets SLC22A3 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4494 miRNA Mature ID miR-4494

miRNA Sequence

CCAGACUGUGGCUGACCAGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 13

miR-4507 directly targets SLC22A3 [ 22 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4507 miRNA Mature ID miR-4507

miRNA Sequence

CUGGGUUGGGCUGGGCUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 14

miR-452 directly targets SLC22A3 [ 22 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-452 miRNA Mature ID miR-452-3p

miRNA Sequence

CUCAUCUGCAAAGAAGUAAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 15

miR-4639 directly targets SLC22A3 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4639 miRNA Mature ID miR-4639-3p

miRNA Sequence

UCACUCUCACCUUGCUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 16

miR-4753 directly targets SLC22A3 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4753 miRNA Mature ID miR-4753-3p

miRNA Sequence

UUCUCUUUCUUUAGCCUUGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 17

miR-499b directly targets SLC22A3 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-499b miRNA Mature ID miR-499b-5p

miRNA Sequence

ACAGACUUGCUGUGAUGUUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 18

miR-515 directly targets SLC22A3 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-515 miRNA Mature ID miR-515-5p

miRNA Sequence

UUCUCCAAAAGAAAGCACUUUCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 19

miR-519d directly targets SLC22A3 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-519d miRNA Mature ID miR-519d-5p

miRNA Sequence

CCUCCAAAGGGAAGCGCUUUCUGUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 20

miR-519e directly targets SLC22A3 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-519e miRNA Mature ID miR-519e-5p

miRNA Sequence

UUCUCCAAAAGGGAGCACUUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 21

miR-545 directly targets SLC22A3 [ 22 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-545 miRNA Mature ID miR-545-3p

miRNA Sequence

UCAGCAAACAUUUAUUGUGUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 22

miR-5695 directly targets SLC22A3 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5695 miRNA Mature ID miR-5695

miRNA Sequence

ACUCCAAGAAGAAUCUAGACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 23

miR-6839 directly targets SLC22A3 [ 22 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6839 miRNA Mature ID miR-6839-3p

miRNA Sequence

UUGGGUUUUCUCUUCAAUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 24

miR-9 directly targets SLC22A3 [ 21 ]

Epigenetic Type

microRNA Experiment Method Microarray

miRNA Stemloop ID

miR-9 miRNA Mature ID miR-9-5p

miRNA Sequence

UCUUUGGUUAUCUAGCUGUAUGA

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)
References
1 Genetic and epigenetic regulation of the organic cation transporter 3, SLC22A3. Pharmacogenomics J. 2013 Apr;13(2):110-20.
2 Diabetes medication associates with DNA methylation of metformin transporter genes in the human liver. Clin Epigenetics. 2017 Sep 21;9:102.
3 Epigenetic alterations of a novel antioxidant gene SLC22A3 predispose susceptible individuals to increased risk of esophageal cancer. Int J Biol Sci. 2018 Sep 7;14(12):1658-1668.
4 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
5 DNA Methylation Dynamics in Urological Tumors.
6 Genome-wide Scan for Methylation Profiles in Breast Cancer
7 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
8 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
15 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
16 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
17 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
18 Functional Variant in the SLC22A3-LPAL2-LPA Gene Cluster Contributes to the Severity of Coronary Artery Disease. Arterioscler Thromb Vasc Biol. 2016 Sep;36(9):1989-96.
19 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
20 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
21 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
22 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.