Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0016 Transporter Info
Gene Name	ABCC5
Transporter Name	Multidrug resistance-associated protein 5
Gene ID	10057
UniProt ID	O15440

Epigenetic Regulations of This DT (EGR)
Methylation
Nasopharyngeal carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of ABCC5 in nasopharyngeal cancer (compare to taxol-resistance counterpart cells)			[ 1 ]
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation of ABCC5	Experiment Method	RT-qPCR
Studied Phenotype	Nasopharyngeal carcinoma [ ICD-11: 2B6B]
Experimental Material	Multiple cell lines of human
Additional Notes	ABCC5 is hypomethylated and upregulated 1.6 fold in taxol-resistant nasopharyngreal carcinoma cell lines.
Pancretic ductal adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC5 in pancretic ductal adenocarcinoma			[ 2 ]
Location	5'UTR (cg25285433)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 4.51E-03; Z-score: 1.22E+00
Methylation in Case	7.12E-01 (Median)	Methylation in Control	6.10E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC5 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg11360755)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 1.56E-06; Z-score: 1.56E+00
Methylation in Case	7.72E-01 (Median)	Methylation in Control	6.59E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC5 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg14331316)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 2.36E-04; Z-score: 1.16E+00
Methylation in Case	7.92E-01 (Median)	Methylation in Control	6.25E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC5 in pancretic ductal adenocarcinoma			[ 2 ]
Location	3'UTR (cg10024478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 3.59E-04; Z-score: 1.30E+00
Methylation in Case	5.88E-01 (Median)	Methylation in Control	4.08E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC5 in prostate cancer			[ 3 ]
Location	TSS1500 (cg25468058)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 3.84E-02; Z-score: 1.49E+00
Methylation in Case	9.40E-01 (Median)	Methylation in Control	9.20E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC5 in atypical teratoid rhabdoid tumor			[ 4 ]
Location	Body (cg02915290)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 2.36E-04; Z-score: 6.68E-01
Methylation in Case	9.31E-01 (Median)	Methylation in Control	8.97E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC5 in atypical teratoid rhabdoid tumor			[ 4 ]
Location	Body (cg03176305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 2.59E-04; Z-score: -7.27E-01
Methylation in Case	1.12E-01 (Median)	Methylation in Control	1.53E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC5 in atypical teratoid rhabdoid tumor			[ 4 ]
Location	Body (cg13341498)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 3.41E-02; Z-score: 6.70E-01
Methylation in Case	8.74E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC5 in atypical teratoid rhabdoid tumor			[ 4 ]
Location	Body (cg13435758)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 3.61E-02; Z-score: 4.25E-01
Methylation in Case	9.12E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCC5 in atypical teratoid rhabdoid tumor			[ 4 ]
Location	Body (cg14652434)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 4.90E-02; Z-score: -3.50E-01
Methylation in Case	7.97E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCC5 in atypical teratoid rhabdoid tumor			[ 4 ]
Location	3'UTR (cg18728109)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.46E+00	Statistic Test	p-value: 2.06E-10; Z-score: 1.73E+00
Methylation in Case	6.70E-01 (Median)	Methylation in Control	4.58E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of ABCC5 in atypical teratoid rhabdoid tumor			[ 4 ]
Location	3'UTR (cg22599229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.62E+00	Statistic Test	p-value: 6.49E-10; Z-score: -1.46E+00
Methylation in Case	3.57E-01 (Median)	Methylation in Control	5.77E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of ABCC5 in atypical teratoid rhabdoid tumor			[ 4 ]
Location	3'UTR (cg24375736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.15E+00	Statistic Test	p-value: 1.43E-09; Z-score: -1.79E+00
Methylation in Case	1.86E-01 (Median)	Methylation in Control	3.99E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC5 in bladder cancer			[ 5 ]
Location	Body (cg15127656)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 1.14E-07; Z-score: -6.58E+00
Methylation in Case	7.09E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC5 in bladder cancer			[ 5 ]
Location	Body (cg02915290)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.38E-04; Z-score: -3.13E+00
Methylation in Case	9.66E-01 (Median)	Methylation in Control	9.74E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC5 in bladder cancer			[ 5 ]
Location	Body (cg14652434)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 5.97E-03; Z-score: -1.51E+00
Methylation in Case	9.81E-01 (Median)	Methylation in Control	9.84E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC5 in bladder cancer			[ 5 ]
Location	3'UTR (cg24375736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 8.03E-03; Z-score: -2.15E+00
Methylation in Case	8.58E-01 (Median)	Methylation in Control	8.79E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCC5 in bladder cancer			[ 5 ]
Location	3'UTR (cg18728109)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.41E-02; Z-score: -8.72E-01
Methylation in Case	8.76E-01 (Median)	Methylation in Control	8.86E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of ABCC5 in bladder cancer			[ 5 ]
Location	3'UTR (cg22599229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.12E-02; Z-score: -5.30E-01
Methylation in Case	8.43E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC5 in breast cancer			[ 6 ]
Location	Body (cg15127656)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 7.19E-09; Z-score: -1.47E+00
Methylation in Case	8.40E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC5 in breast cancer			[ 6 ]
Location	Body (cg03176305)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.55E-04; Z-score: -7.86E-01
Methylation in Case	7.35E-01 (Median)	Methylation in Control	7.57E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of ABCC5 in breast cancer			[ 6 ]
Location	Body (cg18478891)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.84E-03; Z-score: -5.91E-01
Methylation in Case	8.09E-01 (Median)	Methylation in Control	8.26E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of ABCC5 in breast cancer			[ 6 ]
Location	Body (cg13435758)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.57E-02; Z-score: -5.09E-01
Methylation in Case	8.34E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of ABCC5 in breast cancer			[ 6 ]
Location	3'UTR (cg22599229)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.22E-03; Z-score: -5.91E-01
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC5 in colorectal cancer			[ 7 ]
Location	Body (cg15127656)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 4.33E-02; Z-score: -1.38E-01
Methylation in Case	9.12E-01 (Median)	Methylation in Control	9.15E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC5 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg15127656)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 6.79E-05; Z-score: -7.07E-01
Methylation in Case	8.16E-01 (Median)	Methylation in Control	8.41E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC5 in HIV infection			[ 9 ]
Location	Body (cg14652434)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 9.88E-03; Z-score: -5.92E-01
Methylation in Case	9.90E-01 (Median)	Methylation in Control	9.93E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC5 in papillary thyroid cancer			[ 10 ]
Location	Body (cg13341498)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.84E-02; Z-score: -5.17E-01
Methylation in Case	9.36E-01 (Median)	Methylation in Control	9.42E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of ABCC5 in systemic lupus erythematosus			[ 11 ]
Location	Body (cg15732221)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.90E-02; Z-score: 1.92E-01
Methylation in Case	4.47E-01 (Median)	Methylation in Control	4.35E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of ABCC5 in systemic lupus erythematosus			[ 11 ]
Location	Body (cg14652434)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 3.45E-02; Z-score: -1.36E-02
Methylation in Case	9.77E-01 (Median)	Methylation in Control	9.78E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Melanocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of ABCC5 in melanocytoma than that in healthy individual
Studied Phenotype	Melanocytoma [ICD-11:2F36.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.74E-05; Fold-change: -0.224893603; Z-score: -11.20490909
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Vestibular melanotic schwannoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of ABCC5 in vestibular melanotic schwannoma than that in healthy individual
Studied Phenotype	Vestibular melanotic schwannoma [ICD-11:2A02.3]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000147308; Fold-change: -0.464446493; Z-score: -5.137119704
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
microRNA
Gastric cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-129-5p downregulates of ABCC5 in gastric cancer			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of ABCC5	Experiment Method	Western Blot
miRNA Stemloop ID	miR-129	miRNA Mature ID	miR-129-5p
miRNA Sequence	CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type	Direct
Studied Phenotype	Gastric cancer [ ICD-11: 2B72]
Experimental Material	Human gastric adenocarcinoma cell line (SGC7901)
Additional Notes	miR-129-5p regulates ABCC5 expression in vivo at the post-transcriptional level.
Unclear Phenotype	51 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1199 directly targets ABCC5			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1199	miRNA Mature ID	miR-1199-3p
miRNA Sequence	UGCGGCCGGUGCUCAACCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-1224 directly targets ABCC5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1224	miRNA Mature ID	miR-1224-3p
miRNA Sequence	CCCCACCUCCUCUCUCCUCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 3	miR-1226 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1226	miRNA Mature ID	miR-1226-5p
miRNA Sequence	GUGAGGGCAUGCAGGCCUGGAUGGGG
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 4	miR-1229 directly targets ABCC5			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-1229	miRNA Mature ID	miR-1229-3p
miRNA Sequence	CUCUCACCACUGCCCUCCCACAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 5	miR-1273h directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1273h	miRNA Mature ID	miR-1273h-3p
miRNA Sequence	CUGCAGACUCGACCUCCCAGGC
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 6	miR-129 directly targets ABCC5			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	Immunohistochemistry//Luciferase reporter assay//Microarray//qRT-PCR//Western blot
miRNA Stemloop ID	miR-129	miRNA Mature ID	miR-129-5p
miRNA Sequence	CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type	Direct
Experimental Material	Human gastric adenocarcinoma cell line (SGC7901)
Epigenetic Phenomenon 7	miR-1304 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1304	miRNA Mature ID	miR-1304-5p
miRNA Sequence	UUUGAGGCUACAGUGAGAUGUG
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 8	miR-1343 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1343	miRNA Mature ID	miR-1343-5p
miRNA Sequence	UGGGGAGCGGCCCCCGGGUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-185 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-185	miRNA Mature ID	miR-185-3p
miRNA Sequence	AGGGGCUGGCUUUCCUCUGGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-185 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-185	miRNA Mature ID	miR-185-5p
miRNA Sequence	UGGAGAGAAAGGCAGUUCCUGA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 11	miR-188 directly targets ABCC5			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-188	miRNA Mature ID	miR-188-5p
miRNA Sequence	CAUCCCUUGCAUGGUGGAGGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 12	miR-1914 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1914	miRNA Mature ID	miR-1914-3p
miRNA Sequence	GGAGGGGUCCCGCACUGGGAGG
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 13	miR-2467 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-2467	miRNA Mature ID	miR-2467-3p
miRNA Sequence	AGCAGAGGCAGAGAGGCUCAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-3150a directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3150a	miRNA Mature ID	miR-3150a-3p
miRNA Sequence	CUGGGGAGAUCCUCGAGGUUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-3166 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3166	miRNA Mature ID	miR-3166
miRNA Sequence	CGCAGACAAUGCCUACUGGCCUA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 16	miR-3175 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3175	miRNA Mature ID	miR-3175
miRNA Sequence	CGGGGAGAGAACGCAGUGACGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-3184 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3184	miRNA Mature ID	miR-3184-5p
miRNA Sequence	UGAGGGGCCUCAGACCGAGCUUUU
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 18	miR-3622a directly targets ABCC5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3622a	miRNA Mature ID	miR-3622a-3p
miRNA Sequence	UCACCUGACCUCCCAUGCCUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 19	miR-3622b directly targets ABCC5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3622b	miRNA Mature ID	miR-3622b-3p
miRNA Sequence	UCACCUGAGCUCCCGUGCCUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 20	miR-423 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-423	miRNA Mature ID	miR-423-5p
miRNA Sequence	UGAGGGGCAGAGAGCGAGACUUU
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 21	miR-4254 directly targets ABCC5			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4254	miRNA Mature ID	miR-4254
miRNA Sequence	GCCUGGAGCUACUCCACCAUCUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-4306 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4306	miRNA Mature ID	miR-4306
miRNA Sequence	UGGAGAGAAAGGCAGUA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 23	miR-4308 directly targets ABCC5			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4308	miRNA Mature ID	miR-4308
miRNA Sequence	UCCCUGGAGUUUCUUCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-4323 directly targets ABCC5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4323	miRNA Mature ID	miR-4323
miRNA Sequence	CAGCCCCACAGCCUCAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 25	miR-4644 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4644	miRNA Mature ID	miR-4644
miRNA Sequence	UGGAGAGAGAAAAGAGACAGAAG
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 26	miR-4675 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4675	miRNA Mature ID	miR-4675
miRNA Sequence	GGGGCUGUGAUUGACCAGCAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-4741 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4741	miRNA Mature ID	miR-4741
miRNA Sequence	CGGGCUGUCCGGAGGGGUCGGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-4758 directly targets ABCC5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4758	miRNA Mature ID	miR-4758-3p
miRNA Sequence	UGCCCCACCUGCUGACCACCCUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 29	miR-4771 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4771	miRNA Mature ID	miR-4771
miRNA Sequence	AGCAGACUUGACCUACAAUUA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 30	miR-491 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-491	miRNA Mature ID	miR-491-5p
miRNA Sequence	AGUGGGGAACCCUUCCAUGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-499b directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-499b	miRNA Mature ID	miR-499b-5p
miRNA Sequence	ACAGACUUGCUGUGAUGUUCA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 32	miR-5194 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5194	miRNA Mature ID	miR-5194
miRNA Sequence	UGAGGGGUUUGGAAUGGGAUGG
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 33	miR-610 directly targets ABCC5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-610	miRNA Mature ID	miR-610
miRNA Sequence	UGAGCUAAAUGUGUGCUGGGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 34	miR-634 directly targets ABCC5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-634	miRNA Mature ID	miR-634
miRNA Sequence	AACCAGCACCCCAACUUUGGAC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 35	miR-6510 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6510	miRNA Mature ID	miR-6510-5p
miRNA Sequence	CAGCAGGGGAGAGAGAGGAGUC
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 36	miR-6731 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6731	miRNA Mature ID	miR-6731-5p
miRNA Sequence	UGGGAGAGCAGGGUAUUGUGGA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 37	miR-6734 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6734	miRNA Mature ID	miR-6734-5p
miRNA Sequence	UUGAGGGGAGAAUGAGGUGGAGA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 38	miR-6738 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6738	miRNA Mature ID	miR-6738-5p
miRNA Sequence	CGAGGGGUAGAAGAGCACAGGGG
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 39	miR-6763 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6763	miRNA Mature ID	miR-6763-5p
miRNA Sequence	CUGGGGAGUGGCUGGGGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 40	miR-6805 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6805	miRNA Mature ID	miR-6805-5p
miRNA Sequence	UAGGGGGCGGCUUGUGGAGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 41	miR-6820 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6820	miRNA Mature ID	miR-6820-5p
miRNA Sequence	UGCGGCAGAGCUGGGGUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 42	miR-6825 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6825	miRNA Mature ID	miR-6825-5p
miRNA Sequence	UGGGGAGGUGUGGAGUCAGCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 43	miR-6834 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6834	miRNA Mature ID	miR-6834-5p
miRNA Sequence	GUGAGGGACUGGGAUUUGUGG
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 44	miR-6846 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6846	miRNA Mature ID	miR-6846-5p
miRNA Sequence	UGGGGGCUGGAUGGGGUAGAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 45	miR-6848 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6848	miRNA Mature ID	miR-6848-5p
miRNA Sequence	UGGGGGCUGGGAUGGGCCAUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 46	miR-766 directly targets ABCC5			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-766	miRNA Mature ID	miR-766-3p
miRNA Sequence	ACUCCAGCCCCACAGCCUCAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 47	miR-8085 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8085	miRNA Mature ID	miR-8085
miRNA Sequence	UGGGAGAGAGGACUGUGAGGC
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 48	miR-873 directly targets ABCC5			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-873	miRNA Mature ID	miR-873-3p
miRNA Sequence	GGAGACUGAUGAGUUCCCGGGA
miRNA Target Type	Direct
Experimental Material	Human breast adenocarcinoma cell line (MCF-7)
Epigenetic Phenomenon 49	miR-935 directly targets ABCC5			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-935	miRNA Mature ID	miR-935
miRNA Sequence	CCAGUUACCGCUUCCGCUACCGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 50	miR-939 directly targets ABCC5			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-939	miRNA Mature ID	miR-939-5p
miRNA Sequence	UGGGGAGCUGAGGCUCUGGGGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 51	miR-98 directly targets ABCC5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-98	miRNA Mature ID	miR-98-5p
miRNA Sequence	UGAGGUAGUAAGUUGUAUUGUU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)

References
1	Genomic methylation profiling combined with gene expression microarray reveals the aberrant methylation mechanism involved in nasopharyngeal carcinoma taxol resistance. Anticancer Drugs. 2012 Sep;23(8):856-64.
2	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
4	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
5	DNA Methylation Dynamics in Urological Tumors.
6	Genome-wide Scan for Methylation Profiles in Breast Cancer
7	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12	Methylation of miR-129-5p CpG island modulates multi-drug resistance in gastric cancer by targeting ABC transporters. Oncotarget. 2014 Nov 30;5(22):11552-63.
13	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
14	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
15	Identification of distinct miRNA target regulation between breast cancer molecular subtypes using AGO2-PAR-CLIP and patient datasets. Genome Biol. 2014 Jan 7;15(1):R9.
16	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
17	TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
18	MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence