Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0023 Transporter Info
Gene Name	SLC22A5
Transporter Name	Organic cation/carnitine transporter 2
Gene ID	6584
UniProt ID	O76082

Epigenetic Regulations of This DT (EGR)
Methylation
Colon cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC22A5 in colon cancer			[ 1 ]
Location	Promoter (-84 to +591, +1275 to 1492 bp)
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation of SLC22A5	Experiment Method	RT-qPCR
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Human colon cancer cell line (LS174T)
Additional Notes	Hypermethylation within the OCTN2 promoter is responsible for the down-regulation of OCTN2 in HepG2.
Hepatocellular carcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC22A5 in hepatpcellular carcinoma			[ 1 ]
Location	Promoter (-274 to -97, +1275 to +1492 bp)
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Related Molecular Changes	Down regulation of SLC22A5	Experiment Method	RT-qPCR
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Human hepatocellular carcinoma cell line (HepG2)
Additional Notes	Hypermethylation within the OCTN2 promoter is responsible for the down-regulation of OCTN2 in HepG2.
Epigenetic Phenomenon 2	Methylation of SLC22A5 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg06746492)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.57E+00	Statistic Test	p-value: 2.05E-16; Z-score: -3.28E+00
Methylation in Case	4.76E-01 (Median)	Methylation in Control	7.47E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A5 in hepatocellular carcinoma			[ 8 ]
Location	TSS1500 (cg14196790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 1.07E-02; Z-score: -3.77E-01
Methylation in Case	1.10E-01 (Median)	Methylation in Control	1.24E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A5 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg17989736)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.05E+00	Statistic Test	p-value: 5.49E-25; Z-score: -7.00E+00
Methylation in Case	3.59E-01 (Median)	Methylation in Control	7.36E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A5 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg06588735)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 7.48E-15; Z-score: -4.28E+00
Methylation in Case	5.33E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A5 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg24642933)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 1.55E-12; Z-score: -2.68E+00
Methylation in Case	4.73E-01 (Median)	Methylation in Control	5.99E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A5 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg16647868)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 3.25E-06; Z-score: -1.01E+00
Methylation in Case	1.01E-01 (Median)	Methylation in Control	1.21E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A5 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg12558347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 2.16E-02; Z-score: 3.56E-01
Methylation in Case	5.64E-01 (Median)	Methylation in Control	5.42E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Colon cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in colon adenocarcinoma			[ 2 ]
Location	5'UTR (cg19918022)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 3.20E-04; Z-score: -2.78E+00
Methylation in Case	7.67E-01 (Median)	Methylation in Control	8.31E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in colon adenocarcinoma			[ 2 ]
Location	1stExon (cg15668691)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 6.84E-04; Z-score: -1.38E+00
Methylation in Case	8.28E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A5 in colon adenocarcinoma			[ 2 ]
Location	Body (cg21803141)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 2.49E-05; Z-score: -2.53E+00
Methylation in Case	5.32E-01 (Median)	Methylation in Control	5.96E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in pancretic ductal adenocarcinoma			[ 3 ]
Location	5'UTR (cg10589249)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.89E-05; Z-score: 3.48E-01
Methylation in Case	3.13E-02 (Median)	Methylation in Control	2.92E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in bladder cancer			[ 4 ]
Location	TSS1500 (cg14196790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.57E+00	Statistic Test	p-value: 4.50E-02; Z-score: -1.72E+00
Methylation in Case	8.99E-02 (Median)	Methylation in Control	1.41E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in bladder cancer			[ 4 ]
Location	TSS200 (cg21911579)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 4.37E-02; Z-score: -1.34E+00
Methylation in Case	3.26E-02 (Median)	Methylation in Control	3.99E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A5 in bladder cancer			[ 4 ]
Location	Body (cg19040266)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.63E+00	Statistic Test	p-value: 1.06E-07; Z-score: -1.81E+01
Methylation in Case	2.88E-01 (Median)	Methylation in Control	4.70E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A5 in bladder cancer			[ 4 ]
Location	Body (cg18104539)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 4.43E-06; Z-score: -7.34E+00
Methylation in Case	8.10E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A5 in bladder cancer			[ 4 ]
Location	Body (cg23475112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.02E-02; Z-score: -7.98E-01
Methylation in Case	9.58E-01 (Median)	Methylation in Control	9.65E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A5 in bladder cancer			[ 4 ]
Location	Body (cg16647868)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 4.58E-02; Z-score: -1.13E+00
Methylation in Case	1.09E-01 (Median)	Methylation in Control	1.30E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A5 in bladder cancer			[ 4 ]
Location	3'UTR (cg12481567)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.42E-02; Z-score: -2.29E+00
Methylation in Case	8.63E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Renal cell carcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg06968155)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 6.58E-05; Z-score: 1.21E+00
Methylation in Case	6.09E-02 (Median)	Methylation in Control	5.38E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in clear cell renal cell carcinoma			[ 5 ]
Location	TSS1500 (cg14196790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 4.34E-03; Z-score: -8.25E-01
Methylation in Case	7.03E-02 (Median)	Methylation in Control	9.74E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A5 in clear cell renal cell carcinoma			[ 5 ]
Location	Body (cg16647868)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 1.81E-03; Z-score: 6.35E-01
Methylation in Case	7.79E-02 (Median)	Methylation in Control	6.90E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg07538946)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 2.20E-03; Z-score: -1.13E+00
Methylation in Case	2.63E-02 (Median)	Methylation in Control	3.46E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg06968155)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 2.24E-02; Z-score: 5.79E-01
Methylation in Case	1.67E-01 (Median)	Methylation in Control	1.55E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A5 in colorectal cancer			[ 6 ]
Location	Body (cg23475112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.83E-05; Z-score: -1.49E+00
Methylation in Case	9.36E-01 (Median)	Methylation in Control	9.56E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A5 in colorectal cancer			[ 6 ]
Location	Body (cg12558347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 5.04E-03; Z-score: 6.82E-01
Methylation in Case	6.07E-01 (Median)	Methylation in Control	5.39E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Depression	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in depression			[ 7 ]
Location	TSS1500 (cg06968155)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 3.40E-02; Z-score: 4.55E-01
Methylation in Case	8.75E-02 (Median)	Methylation in Control	8.40E-02 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in depression			[ 7 ]
Location	TSS200 (cg24060327)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 4.46E-02; Z-score: 3.98E-01
Methylation in Case	5.77E-02 (Median)	Methylation in Control	5.43E-02 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A5 in depression			[ 7 ]
Location	Body (cg12558347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 2.88E-02; Z-score: 3.11E-01
Methylation in Case	7.72E-01 (Median)	Methylation in Control	7.64E-01 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
HIV infection	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in HIV infection			[ 9 ]
Location	TSS1500 (cg07538946)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.50E+00	Statistic Test	p-value: 8.81E-06; Z-score: 1.76E+00
Methylation in Case	3.12E-02 (Median)	Methylation in Control	2.08E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in HIV infection			[ 9 ]
Location	TSS1500 (cg14196790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 1.98E-03; Z-score: 1.27E+00
Methylation in Case	1.68E-01 (Median)	Methylation in Control	1.31E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A5 in HIV infection			[ 9 ]
Location	TSS1500 (cg21948465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 2.38E-02; Z-score: 3.86E-01
Methylation in Case	2.06E-02 (Median)	Methylation in Control	1.53E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A5 in HIV infection			[ 9 ]
Location	Body (cg12558347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 1.04E-08; Z-score: 1.34E+00
Methylation in Case	8.99E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A5 in HIV infection			[ 9 ]
Location	Body (cg16647868)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 3.69E-02; Z-score: 6.04E-01
Methylation in Case	1.36E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in lung adenocarcinoma			[ 10 ]
Location	TSS1500 (cg14196790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 6.87E-03; Z-score: -1.28E+00
Methylation in Case	2.03E-01 (Median)	Methylation in Control	2.72E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in lung adenocarcinoma			[ 10 ]
Location	TSS1500 (cg07538946)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 1.11E-02; Z-score: -1.92E+00
Methylation in Case	4.30E-02 (Median)	Methylation in Control	5.59E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A5 in lung adenocarcinoma			[ 10 ]
Location	Body (cg12558347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.37E+00	Statistic Test	p-value: 1.24E-03; Z-score: 4.01E+00
Methylation in Case	5.97E-01 (Median)	Methylation in Control	4.37E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A5 in lung adenocarcinoma			[ 10 ]
Location	Body (cg19040266)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 2.24E-02; Z-score: 1.65E+00
Methylation in Case	5.92E-01 (Median)	Methylation in Control	5.12E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in panic disorder			[ 11 ]
Location	TSS1500 (cg21948465)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.69E-01	Statistic Test	p-value: 3.55E-02; Z-score: 4.52E-01
Methylation in Case	-4.12E+00 (Median)	Methylation in Control	-4.25E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in panic disorder			[ 11 ]
Location	TSS200 (cg24060327)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.94E-01	Statistic Test	p-value: 4.49E-02; Z-score: 1.51E-01
Methylation in Case	-5.39E+00 (Median)	Methylation in Control	-5.43E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg07538946)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 3.27E-03; Z-score: -5.31E-01
Methylation in Case	5.75E-02 (Median)	Methylation in Control	6.24E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in papillary thyroid cancer			[ 12 ]
Location	Body (cg19040266)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 2.23E-16; Z-score: -3.04E+00
Methylation in Case	5.87E-01 (Median)	Methylation in Control	7.08E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A5 in papillary thyroid cancer			[ 12 ]
Location	Body (cg23475112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.82E-05; Z-score: -1.03E+00
Methylation in Case	9.34E-01 (Median)	Methylation in Control	9.44E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A5 in papillary thyroid cancer			[ 12 ]
Location	3'UTR (cg12481567)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.31E-05; Z-score: -9.23E-01
Methylation in Case	9.33E-01 (Median)	Methylation in Control	9.46E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in prostate cancer			[ 13 ]
Location	TSS1500 (cg00748432)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 3.74E-02; Z-score: 1.68E+00
Methylation in Case	8.16E-01 (Median)	Methylation in Control	6.88E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in prostate cancer			[ 13 ]
Location	Body (cg20706711)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 1.90E-02; Z-score: 2.81E+00
Methylation in Case	8.60E-01 (Median)	Methylation in Control	7.39E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in systemic lupus erythematosus			[ 14 ]
Location	TSS1500 (cg14196790)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 4.85E-02; Z-score: 3.08E-01
Methylation in Case	2.51E-01 (Median)	Methylation in Control	2.16E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in systemic lupus erythematosus			[ 14 ]
Location	TSS200 (cg21911579)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.53E-02; Z-score: 1.78E-01
Methylation in Case	3.72E-02 (Median)	Methylation in Control	3.55E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A5 in systemic lupus erythematosus			[ 14 ]
Location	1stExon (cg20453264)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 5.45E-03; Z-score: -8.28E-02
Methylation in Case	8.06E-02 (Median)	Methylation in Control	8.19E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A5 in systemic lupus erythematosus			[ 14 ]
Location	Body (cg12558347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.26E-02; Z-score: -2.85E-01
Methylation in Case	9.01E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	1stExon (cg20453264)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.02E+00	Statistic Test	p-value: 4.70E-17; Z-score: 2.80E+00
Methylation in Case	7.25E-01 (Median)	Methylation in Control	3.59E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	Body (cg12558347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 2.80E-02; Z-score: -8.21E-01
Methylation in Case	7.53E-02 (Median)	Methylation in Control	9.65E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A5 in atypical teratoid rhabdoid tumor			[ 15 ]
Location	3'UTR (cg12481567)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 1.49E-11; Z-score: -2.16E+00
Methylation in Case	7.52E-01 (Median)	Methylation in Control	8.51E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Breast cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A5 in breast cancer			[ 16 ]
Location	Body (cg12558347)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.85E+00	Statistic Test	p-value: 1.92E-11; Z-score: 2.72E+00
Methylation in Case	3.99E-01 (Median)	Methylation in Control	2.15E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A5 in breast cancer			[ 16 ]
Location	Body (cg23475112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 5.17E-09; Z-score: -2.39E+00
Methylation in Case	8.45E-01 (Median)	Methylation in Control	9.51E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A5 in breast cancer			[ 16 ]
Location	Body (cg18104539)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 5.52E-04; Z-score: -7.61E-01
Methylation in Case	8.69E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Asthma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hypermethylation of SLC22A5 in asthma			[ 17 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Bisulfite pyrosequencing
Studied Phenotype	Asthma [ ICD-11: CA23]
Experimental Material	Patient tissue samples
Additional Notes	Genotype influences DNA methylation levels at the SLC22A5 gene promoter region in LCLs.
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC22A5 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.03E-15; Fold-change: 0.262467257; Z-score: 6.744378667
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-124 directly targets SLC22A5			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-124	miRNA Mature ID	miR-124-3p
miRNA Sequence	UAAGGCACGCGGUGAAUGCCAA
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 2	miR-148b directly targets SLC22A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-148b	miRNA Mature ID	miR-148b-3p
miRNA Sequence	UCAGUGCAUCACAGAACUUUGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 3	miR-9 directly targets SLC22A5			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-9	miRNA Mature ID	miR-9-5p
miRNA Sequence	UCUUUGGUUAUCUAGCUGUAUGA
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)

References
1	Different involvement of promoter methylation in the expression of organic cation/carnitine transporter 2 (OCTN2) in cancer cell lines. PLoS One. 2013 Oct 16;8(10):e76474.
2	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
3	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
4	DNA Methylation Dynamics in Urological Tumors.
5	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
8	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
16	Genome-wide Scan for Methylation Profiles in Breast Cancer
17	Local genotype influences DNA methylation at two asthma-associated regions, 5q31 and 17q21, in a founder effect population. J Med Genet. 2016 Apr;53(4):232-41.
18	The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
19	MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence