Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0029 Transporter Info | ||||
| Gene Name | SLCO1A2 | ||||
| Transporter Name | Organic anion transporting polypeptide 1A2 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Atypical teratoid rhabdoid tumor |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO1A2 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg11704114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 3.40E-07; Z-score: -1.57E+00 | ||
|
Methylation in Case |
4.77E-01 (Median) | Methylation in Control | 6.22E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO1A2 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg11704114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.95E+00 | Statistic Test | p-value: 2.70E-12; Z-score: -1.12E+01 | ||
|
Methylation in Case |
2.13E-01 (Median) | Methylation in Control | 6.29E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO1A2 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg11704114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.46E-04; Z-score: -1.08E+00 | ||
|
Methylation in Case |
5.34E-01 (Median) | Methylation in Control | 5.88E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO1A2 in colorectal cancer | [ 4 ] | |||
|
Location |
5'UTR (cg11704114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 1.05E-12; Z-score: -2.67E+00 | ||
|
Methylation in Case |
6.48E-01 (Median) | Methylation in Control | 8.11E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO1A2 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
5'UTR (cg11704114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 6.50E-05; Z-score: -7.08E-01 | ||
|
Methylation in Case |
6.71E-01 (Median) | Methylation in Control | 7.21E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO1A2 in HIV infection | [ 6 ] | |||
|
Location |
5'UTR (cg11704114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.50E-02; Z-score: -5.90E-01 | ||
|
Methylation in Case |
7.49E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO1A2 in panic disorder | [ 7 ] | |||
|
Location |
5'UTR (cg11704114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -6.41E+00 | Statistic Test | p-value: 1.56E-07; Z-score: -9.06E-01 | ||
|
Methylation in Case |
8.71E-02 (Median) | Methylation in Control | 5.58E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO1A2 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
5'UTR (cg11704114) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 5.56E-07; Z-score: -9.56E-01 | ||
|
Methylation in Case |
6.77E-01 (Median) | Methylation in Control | 7.31E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLCO1A2 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg26743024) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 1.31E-06; Z-score: -1.27E+00 | ||
|
Methylation in Case |
3.68E-01 (Median) | Methylation in Control | 4.64E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLCO1A2 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 5.65E-16; Fold-change: -0.37396627; Z-score: -8.589943892 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
microRNA |
|||||
|
B-cell acute lymphoblastic leukemia |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-595 downregulates SLCO1A2 in B-cell acute lymphoblastic leukemia | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | In-silico analysis | ||
|
Related Molecular Changes |
Down regulation of SLCO1A2 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-595 | miRNA Mature ID | miR-595 | ||
|
miRNA Sequence |
GAAGUGUGCCGUGGUGUGUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
B-cell acute lymphoblastic leukemia [ ICD-11: 2A82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
SNPs in miR-595 that might affect SLCO1A2 MTX transport gene regulation and could affect MTX levels in patients with pediatric B-cell ALL. | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples