Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0031 Transporter Info
Gene Name SLCO2B1
Transporter Name Organic anion transporting polypeptide 2B1
Gene ID
11309
UniProt ID
O94956
Epigenetic Regulations of This DT (EGR)

Methylation

  Non-alcoholic fatty liver disease

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of SLCO2B1 in non-alcoholic fatty liver disease [ 1 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method HumanMethylation450 BeadChip

Related Molecular Changes

 Down regulation of SLCO2B1 Experiment Method Microarrays

Studied Phenotype

 Non-alcoholic fatty liver disease [ ICD-11: DB92]

Experimental Material

 Patient tissue samples

Additional Notes

 SLCO2B1 had increased methylation and decreased expression in non-alcoholic fatty liver disease.

  Multilayered rosettes embryonal tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLCO2B1 in multilayered rosettes embryonal tumour than that in healthy individual

Studied Phenotype

 Multilayered rosettes embryonal tumour [ICD-11:2A00.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 5.43E-09; Fold-change: -0.228748579; Z-score: -1.540851362
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Lymphoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLCO2B1 in lymphoma than that in healthy individual

Studied Phenotype

 Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 4.54E-07; Fold-change: -0.339292475; Z-score: -1.699486422
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-4645 directly targets SLCO2B1 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4645 miRNA Mature ID miR-4645-5p

miRNA Sequence

 ACCAGGCAAGAAAUAUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-4673 directly targets SLCO2B1 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4673 miRNA Mature ID miR-4673

miRNA Sequence

 UCCAGGCAGGAGCCGGACUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-640 directly targets SLCO2B1 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-640 miRNA Mature ID miR-640

miRNA Sequence

 AUGAUCCAGGAACCUGCCUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 A targeted analysis reveals relevant shifts in the methylation and transcription of genes responsible for bile acid homeostasis and drug metabolism in non-alcoholic fatty liver disease. BMC Genomics. 2016 Jun 14;17:462.
2 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.