Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0034 Transporter Info | ||||
| Gene Name | SLC18A2 | ||||
| Transporter Name | Vesicular amine transporter 2 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Prostate cancer |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypermethylation of SLC18A2 in prostate cancer | [ 1 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | HumanMethylation450 BeadChip | ||
|
Related Molecular Changes |
Down regulation of SLC18A2 | Experiment Method | Microarrays | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
SLC18A2 promoter Hypermethylation is highly cancerspecific, and that SLC18A2 mRNA and protein levels are significantly decreased in prostate cancer. | ||||
|
Epigenetic Phenomenon 2 |
Hypermethylation of SLC18A2 in prostate cancer | [ 1 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | HumanMethylation450 BeadChip | ||
|
Related Molecular Changes |
Down regulation of SLC18A2 | Experiment Method | Western Blot | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
SLC18A2 promoter Hypermethylation is highly cancerspecific, and that SLC18A2 mRNA and protein levels are significantly decreased in prostate cancer. | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC18A2 in prostate cancer | [ 12 ] | |||
|
Location |
5'UTR (cg01790523) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.91E+00 | Statistic Test | p-value: 2.79E-02; Z-score: -2.20E+00 | ||
|
Methylation in Case |
3.48E-01 (Median) | Methylation in Control | 6.65E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC18A2 in prostate cancer | [ 12 ] | |||
|
Location |
5'UTR (cg05919690) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.16E-02; Z-score: -1.56E+00 | ||
|
Methylation in Case |
8.00E-01 (Median) | Methylation in Control | 8.25E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC18A2 in prostate cancer | [ 12 ] | |||
|
Location |
TSS1500 (cg26062856) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 4.93E-02; Z-score: 5.88E+00 | ||
|
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC18A2 in prostate cancer | [ 12 ] | |||
|
Location |
TSS200 (cg22928082) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.05E+00 | Statistic Test | p-value: 4.52E-04; Z-score: 7.67E+00 | ||
|
Methylation in Case |
7.33E-01 (Median) | Methylation in Control | 3.58E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC18A2 in prostate cancer | [ 12 ] | |||
|
Location |
TSS200 (cg18158438) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.83E+00 | Statistic Test | p-value: 3.25E-02; Z-score: 2.53E+00 | ||
|
Methylation in Case |
5.97E-01 (Median) | Methylation in Control | 3.26E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC18A2 in prostate cancer | [ 12 ] | |||
|
Location |
Body (cg19807207) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.81E-02; Z-score: 1.76E+00 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 8.58E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC18A2 in prostate cancer | [ 12 ] | |||
|
Location |
Body (cg15829073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.36E-02; Z-score: 1.60E+00 | ||
|
Methylation in Case |
9.04E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC18A2 in prostate cancer | [ 12 ] | |||
|
Location |
3'UTR (cg13605398) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.95E+00 | Statistic Test | p-value: 3.96E-02; Z-score: 1.29E+01 | ||
|
Methylation in Case |
4.97E-01 (Median) | Methylation in Control | 1.00E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Hypermethylation of SLC18A2 in prostate cancer | [ 17 ] | |||
|
Location |
Promoter (cg00498305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | HumanMethylation450 BeadChip | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
A novel four-gene (AOX1xGSTP1xHAPLN3xSLC18A2) epigenetic field effect signature with over 30% sensitivity for PC at 100% fixed specificity. | ||||
|
Atypical teratoid rhabdoid tumor |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
5'UTR (cg00512279) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 5.20E-09; Z-score: -1.42E+00 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC18A2 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
5'UTR (cg08521987) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.68E+00 | Statistic Test | p-value: 1.38E-07; Z-score: -1.64E+00 | ||
|
Methylation in Case |
1.49E-01 (Median) | Methylation in Control | 4.00E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC18A2 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
5'UTR (cg19721867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 3.35E-06; Z-score: 1.54E+00 | ||
|
Methylation in Case |
7.28E-01 (Median) | Methylation in Control | 5.47E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC18A2 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
Body (cg01043119) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 4.53E-05; Z-score: 1.28E+00 | ||
|
Methylation in Case |
9.09E-01 (Median) | Methylation in Control | 8.17E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC18A2 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
Body (cg10245915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.43E-02; Z-score: 3.55E-01 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC18A2 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
3'UTR (cg14995160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 5.64E-11; Z-score: -2.04E+00 | ||
|
Methylation in Case |
6.97E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in bladder cancer | [ 3 ] | |||
|
Location |
5'UTR (cg00512279) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.35E+00 | Statistic Test | p-value: 1.91E-03; Z-score: 5.16E+00 | ||
|
Methylation in Case |
1.75E-01 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC18A2 in bladder cancer | [ 3 ] | |||
|
Location |
5'UTR (cg08521987) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.74E+00 | Statistic Test | p-value: 2.91E-03; Z-score: 3.00E+00 | ||
|
Methylation in Case |
1.05E-01 (Median) | Methylation in Control | 6.02E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC18A2 in bladder cancer | [ 3 ] | |||
|
Location |
5'UTR (cg19721867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.42E+00 | Statistic Test | p-value: 7.40E-03; Z-score: 3.03E+00 | ||
|
Methylation in Case |
1.53E-02 (Median) | Methylation in Control | 1.07E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC18A2 in bladder cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg15806304) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 1.98E-02; Z-score: 2.75E+00 | ||
|
Methylation in Case |
4.87E-01 (Median) | Methylation in Control | 4.19E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC18A2 in bladder cancer | [ 3 ] | |||
|
Location |
TSS200 (cg15173134) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.61E+00 | Statistic Test | p-value: 3.51E-03; Z-score: 1.82E+00 | ||
|
Methylation in Case |
1.20E-01 (Median) | Methylation in Control | 7.49E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC18A2 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg15520443) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -4.26E+00 | Statistic Test | p-value: 2.78E-08; Z-score: -7.77E+00 | ||
|
Methylation in Case |
9.29E-02 (Median) | Methylation in Control | 3.95E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC18A2 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg10245915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 4.41E-04; Z-score: -4.92E+00 | ||
|
Methylation in Case |
8.75E-02 (Median) | Methylation in Control | 1.08E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC18A2 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg01043119) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 5.98E-04; Z-score: -2.56E+00 | ||
|
Methylation in Case |
6.31E-02 (Median) | Methylation in Control | 8.21E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC18A2 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg20102878) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.45E-02; Z-score: -7.98E-01 | ||
|
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 8.30E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC18A2 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg26583753) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.20E-02; Z-score: -5.57E-01 | ||
|
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC18A2 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg19617377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 3.23E-02; Z-score: -1.38E+00 | ||
|
Methylation in Case |
7.73E-02 (Median) | Methylation in Control | 9.27E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
5'UTR (cg00512279) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 5.34E-10; Z-score: 2.14E+00 | ||
|
Methylation in Case |
1.65E-01 (Median) | Methylation in Control | 1.14E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
5'UTR (cg08521987) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.99E+00 | Statistic Test | p-value: 2.10E-09; Z-score: 2.10E+00 | ||
|
Methylation in Case |
1.32E-01 (Median) | Methylation in Control | 6.62E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
5'UTR (cg19721867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+00 | Statistic Test | p-value: 1.92E-04; Z-score: 3.45E-01 | ||
|
Methylation in Case |
1.88E-02 (Median) | Methylation in Control | 1.34E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg15806304) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 1.71E-09; Z-score: 1.82E+00 | ||
|
Methylation in Case |
6.19E-01 (Median) | Methylation in Control | 5.25E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg00498305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 8.88E-09; Z-score: 2.10E+00 | ||
|
Methylation in Case |
3.77E-01 (Median) | Methylation in Control | 2.83E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg13980799) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.30E+00 | Statistic Test | p-value: 2.25E-08; Z-score: 2.42E+00 | ||
|
Methylation in Case |
5.29E-01 (Median) | Methylation in Control | 4.08E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg15173134) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.52E+00 | Statistic Test | p-value: 5.87E-10; Z-score: 2.35E+00 | ||
|
Methylation in Case |
2.80E-01 (Median) | Methylation in Control | 1.11E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg15225091) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 4.75E-08; Z-score: -1.64E+00 | ||
|
Methylation in Case |
3.01E-01 (Median) | Methylation in Control | 4.21E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg15520443) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.25E+00 | Statistic Test | p-value: 2.11E-06; Z-score: -2.00E+00 | ||
|
Methylation in Case |
1.32E-01 (Median) | Methylation in Control | 2.98E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg20102878) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 9.03E-05; Z-score: -4.75E-01 | ||
|
Methylation in Case |
8.19E-01 (Median) | Methylation in Control | 8.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg01043119) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.38E+00 | Statistic Test | p-value: 6.22E-04; Z-score: -8.55E-01 | ||
|
Methylation in Case |
7.77E-02 (Median) | Methylation in Control | 1.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg16099210) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 2.73E-02; Z-score: 2.37E-01 | ||
|
Methylation in Case |
4.05E-02 (Median) | Methylation in Control | 3.58E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC18A2 in breast cancer | [ 4 ] | |||
|
Location |
3'UTR (cg14995160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.72E-03; Z-score: -5.93E-01 | ||
|
Methylation in Case |
7.75E-01 (Median) | Methylation in Control | 7.99E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
5'UTR (cg08521987) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 3.93E-04; Z-score: 8.39E-01 | ||
|
Methylation in Case |
3.33E-02 (Median) | Methylation in Control | 2.53E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC18A2 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
5'UTR (cg00512279) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 5.22E-04; Z-score: 5.51E-01 | ||
|
Methylation in Case |
1.23E-01 (Median) | Methylation in Control | 1.05E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC18A2 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
5'UTR (cg19721867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.08E-02; Z-score: 5.31E-01 | ||
|
Methylation in Case |
1.78E-02 (Median) | Methylation in Control | 1.64E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC18A2 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg15806304) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 7.46E-06; Z-score: 2.35E+00 | ||
|
Methylation in Case |
6.54E-01 (Median) | Methylation in Control | 5.57E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC18A2 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg13980799) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.45E+00 | Statistic Test | p-value: 1.12E-03; Z-score: 2.21E+00 | ||
|
Methylation in Case |
5.58E-01 (Median) | Methylation in Control | 3.85E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC18A2 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg00498305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 2.83E-03; Z-score: 1.10E+00 | ||
|
Methylation in Case |
2.99E-01 (Median) | Methylation in Control | 2.43E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC18A2 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
TSS200 (cg15173134) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 2.30E-02; Z-score: 1.95E-01 | ||
|
Methylation in Case |
5.20E-02 (Median) | Methylation in Control | 4.53E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC18A2 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg10245915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 1.12E-02; Z-score: -7.55E-01 | ||
|
Methylation in Case |
8.80E-02 (Median) | Methylation in Control | 1.08E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC18A2 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg19617377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.42E-02; Z-score: -1.10E-02 | ||
|
Methylation in Case |
3.64E-02 (Median) | Methylation in Control | 3.65E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC18A2 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg16099210) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.99E-02; Z-score: -1.08E-01 | ||
|
Methylation in Case |
2.75E-02 (Median) | Methylation in Control | 2.85E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
14 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
5'UTR (cg08521987) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.43E+00 | Statistic Test | p-value: 4.59E-15; Z-score: 9.06E+00 | ||
|
Methylation in Case |
6.31E-01 (Median) | Methylation in Control | 1.84E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
5'UTR (cg19721867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+01 | Statistic Test | p-value: 2.72E-13; Z-score: 2.84E+01 | ||
|
Methylation in Case |
2.98E-01 (Median) | Methylation in Control | 2.12E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
5'UTR (cg00512279) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.15E+00 | Statistic Test | p-value: 6.62E-13; Z-score: 5.65E+00 | ||
|
Methylation in Case |
5.79E-01 (Median) | Methylation in Control | 2.70E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg13980799) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 8.59E-07; Z-score: 1.88E+00 | ||
|
Methylation in Case |
7.15E-01 (Median) | Methylation in Control | 5.83E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg00498305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 8.62E-07; Z-score: 1.74E+00 | ||
|
Methylation in Case |
4.96E-01 (Median) | Methylation in Control | 3.88E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS200 (cg15173134) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 6.90E+00 | Statistic Test | p-value: 1.02E-15; Z-score: 9.97E+00 | ||
|
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 8.17E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg01043119) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.70E+00 | Statistic Test | p-value: 7.94E-13; Z-score: 7.87E+00 | ||
|
Methylation in Case |
5.00E-01 (Median) | Methylation in Control | 1.85E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg16099210) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 6.42E+00 | Statistic Test | p-value: 4.07E-12; Z-score: 1.60E+01 | ||
|
Methylation in Case |
2.64E-01 (Median) | Methylation in Control | 4.11E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg15520443) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.29E+00 | Statistic Test | p-value: 9.49E-12; Z-score: -2.75E+00 | ||
|
Methylation in Case |
2.26E-01 (Median) | Methylation in Control | 5.17E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg19617377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.26E+00 | Statistic Test | p-value: 2.48E-11; Z-score: 8.40E+00 | ||
|
Methylation in Case |
2.89E-01 (Median) | Methylation in Control | 1.28E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg10245915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.99E+00 | Statistic Test | p-value: 5.50E-11; Z-score: 5.51E+00 | ||
|
Methylation in Case |
3.93E-01 (Median) | Methylation in Control | 1.97E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg15225091) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.31E+00 | Statistic Test | p-value: 3.62E-06; Z-score: 2.52E+00 | ||
|
Methylation in Case |
6.74E-01 (Median) | Methylation in Control | 5.13E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg20102878) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.90E-03; Z-score: -9.63E-01 | ||
|
Methylation in Case |
9.29E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC18A2 in colorectal cancer | [ 6 ] | |||
|
Location |
3'UTR (cg14995160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.61E-03; Z-score: -8.11E-01 | ||
|
Methylation in Case |
8.55E-01 (Median) | Methylation in Control | 8.79E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
18 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg00512279) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.60E+00 | Statistic Test | p-value: 1.05E-07; Z-score: 2.92E+00 | ||
|
Methylation in Case |
2.73E-01 (Median) | Methylation in Control | 1.70E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
5'UTR (cg08521987) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.48E+00 | Statistic Test | p-value: 1.59E-06; Z-score: 2.04E+00 | ||
|
Methylation in Case |
1.54E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg11826452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 2.64E-13; Z-score: -2.16E+00 | ||
|
Methylation in Case |
6.03E-01 (Median) | Methylation in Control | 7.13E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg19024632) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.46E+00 | Statistic Test | p-value: 1.43E-10; Z-score: 2.03E+00 | ||
|
Methylation in Case |
3.97E-01 (Median) | Methylation in Control | 2.71E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg15173134) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.09E-03; Z-score: 1.74E-01 | ||
|
Methylation in Case |
7.69E-02 (Median) | Methylation in Control | 6.93E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg08701543) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.62E+00 | Statistic Test | p-value: 9.74E-20; Z-score: -4.09E+00 | ||
|
Methylation in Case |
3.96E-01 (Median) | Methylation in Control | 6.41E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg19000612) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.49E+00 | Statistic Test | p-value: 9.29E-18; Z-score: -5.51E+00 | ||
|
Methylation in Case |
5.71E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg17493839) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 4.62E-17; Z-score: -2.18E+01 | ||
|
Methylation in Case |
6.28E-01 (Median) | Methylation in Control | 9.66E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg20122943) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.61E+00 | Statistic Test | p-value: 5.61E-16; Z-score: 1.19E+01 | ||
|
Methylation in Case |
3.54E-01 (Median) | Methylation in Control | 7.67E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg23880589) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.59E+00 | Statistic Test | p-value: 2.33E-13; Z-score: 3.53E+00 | ||
|
Methylation in Case |
4.80E-01 (Median) | Methylation in Control | 3.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg15520443) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.01E+00 | Statistic Test | p-value: 2.89E-09; Z-score: -1.98E+00 | ||
|
Methylation in Case |
1.18E-01 (Median) | Methylation in Control | 2.38E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg16099210) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.03E+00 | Statistic Test | p-value: 5.62E-08; Z-score: 3.21E+00 | ||
|
Methylation in Case |
1.33E-01 (Median) | Methylation in Control | 6.52E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg10245915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+00 | Statistic Test | p-value: 1.28E-06; Z-score: 2.54E+00 | ||
|
Methylation in Case |
1.89E-01 (Median) | Methylation in Control | 1.34E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg15225091) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 4.41E-05; Z-score: 1.65E+00 | ||
|
Methylation in Case |
3.28E-01 (Median) | Methylation in Control | 2.55E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg01043119) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 2.29E-04; Z-score: 9.10E-01 | ||
|
Methylation in Case |
1.18E-01 (Median) | Methylation in Control | 1.01E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg19617377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 5.37E-03; Z-score: 4.12E-01 | ||
|
Methylation in Case |
8.86E-02 (Median) | Methylation in Control | 8.30E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
3'UTR (cg10838500) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.65E+00 | Statistic Test | p-value: 2.32E-19; Z-score: -4.12E+00 | ||
|
Methylation in Case |
3.27E-01 (Median) | Methylation in Control | 5.39E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC18A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
3'UTR (cg14995160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.08E-03; Z-score: -4.92E-01 | ||
|
Methylation in Case |
7.59E-01 (Median) | Methylation in Control | 7.83E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg00512279) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.46E+00 | Statistic Test | p-value: 7.70E-05; Z-score: 1.62E+00 | ||
|
Methylation in Case |
1.32E-01 (Median) | Methylation in Control | 9.07E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg08521987) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.67E+00 | Statistic Test | p-value: 9.85E-05; Z-score: 1.21E+00 | ||
|
Methylation in Case |
1.12E-01 (Median) | Methylation in Control | 6.73E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
5'UTR (cg19721867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.90E+00 | Statistic Test | p-value: 4.13E-03; Z-score: 1.70E+00 | ||
|
Methylation in Case |
1.99E-02 (Median) | Methylation in Control | 1.04E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg15806304) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 1.54E-06; Z-score: 1.80E+00 | ||
|
Methylation in Case |
7.77E-01 (Median) | Methylation in Control | 7.11E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg00498305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.48E-02; Z-score: 1.22E+00 | ||
|
Methylation in Case |
5.08E-01 (Median) | Methylation in Control | 4.50E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
TSS200 (cg15173134) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.67E+00 | Statistic Test | p-value: 1.64E-03; Z-score: 2.07E+00 | ||
|
Methylation in Case |
1.32E-01 (Median) | Methylation in Control | 7.90E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg10245915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 2.00E-04; Z-score: 1.21E+00 | ||
|
Methylation in Case |
9.86E-02 (Median) | Methylation in Control | 7.64E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg15225091) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 6.82E-04; Z-score: 1.35E+00 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 1.75E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg19617377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 7.16E-04; Z-score: 8.22E-01 | ||
|
Methylation in Case |
8.41E-02 (Median) | Methylation in Control | 7.26E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg16099210) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.65E+00 | Statistic Test | p-value: 1.04E-03; Z-score: 1.01E+00 | ||
|
Methylation in Case |
4.38E-02 (Median) | Methylation in Control | 2.66E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg01043119) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 4.69E-03; Z-score: 4.13E-01 | ||
|
Methylation in Case |
7.90E-02 (Median) | Methylation in Control | 6.99E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg15520443) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.58E+00 | Statistic Test | p-value: 1.25E-02; Z-score: 1.01E+00 | ||
|
Methylation in Case |
6.92E-02 (Median) | Methylation in Control | 4.37E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC18A2 in HIV infection | [ 8 ] | |||
|
Location |
3'UTR (cg14995160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.40E-02; Z-score: 4.17E-01 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 7.17E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
5'UTR (cg08521987) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.46E+00 | Statistic Test | p-value: 6.15E-03; Z-score: 7.97E+00 | ||
|
Methylation in Case |
3.34E-01 (Median) | Methylation in Control | 1.36E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC18A2 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
5'UTR (cg00512279) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.79E+00 | Statistic Test | p-value: 7.85E-03; Z-score: 4.34E+00 | ||
|
Methylation in Case |
2.88E-01 (Median) | Methylation in Control | 1.61E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC18A2 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
5'UTR (cg19721867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.54E+00 | Statistic Test | p-value: 1.84E-02; Z-score: 9.58E+00 | ||
|
Methylation in Case |
1.00E-01 (Median) | Methylation in Control | 3.93E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC18A2 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg15806304) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 1.31E-04; Z-score: 3.92E+00 | ||
|
Methylation in Case |
6.41E-01 (Median) | Methylation in Control | 5.13E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC18A2 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg00498305) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 8.41E-04; Z-score: 4.29E+00 | ||
|
Methylation in Case |
4.43E-01 (Median) | Methylation in Control | 3.17E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC18A2 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg13980799) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 2.79E-03; Z-score: 2.88E+00 | ||
|
Methylation in Case |
6.15E-01 (Median) | Methylation in Control | 4.38E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC18A2 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg15173134) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.60E+00 | Statistic Test | p-value: 2.60E-03; Z-score: 8.38E+00 | ||
|
Methylation in Case |
4.13E-01 (Median) | Methylation in Control | 1.59E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC18A2 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg15225091) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 4.74E-03; Z-score: 2.58E+00 | ||
|
Methylation in Case |
3.69E-01 (Median) | Methylation in Control | 2.68E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC18A2 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg16099210) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.41E+00 | Statistic Test | p-value: 1.78E-02; Z-score: 4.66E+00 | ||
|
Methylation in Case |
1.37E-01 (Median) | Methylation in Control | 5.71E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC18A2 in lung adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg10245915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 3.83E-02; Z-score: 2.40E+00 | ||
|
Methylation in Case |
1.64E-01 (Median) | Methylation in Control | 1.28E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
5'UTR (cg18003231) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 6.19E-07; Z-score: -1.52E+00 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC18A2 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
TSS1500 (cg02915746) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 2.70E-12; Z-score: 1.29E+00 | ||
|
Methylation in Case |
7.61E-02 (Median) | Methylation in Control | 6.06E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC18A2 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
TSS1500 (cg05907949) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.05E-02; Z-score: -3.74E-02 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 1.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC18A2 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg00292986) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 1.07E-02; Z-score: -2.25E-01 | ||
|
Methylation in Case |
8.42E-02 (Median) | Methylation in Control | 9.43E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC18A2 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
1stExon (cg11915641) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 2.49E-05; Z-score: -8.69E-01 | ||
|
Methylation in Case |
1.15E-01 (Median) | Methylation in Control | 1.54E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC18A2 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
1stExon (cg06662991) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 3.31E-04; Z-score: -8.48E-01 | ||
|
Methylation in Case |
9.98E-02 (Median) | Methylation in Control | 1.19E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC18A2 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg24529484) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.43E+00 | Statistic Test | p-value: 4.45E-02; Z-score: -1.33E+00 | ||
|
Methylation in Case |
1.76E-01 (Median) | Methylation in Control | 2.51E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC18A2 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
3'UTR (cg00321824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 2.83E-06; Z-score: 1.68E+00 | ||
|
Methylation in Case |
8.09E-01 (Median) | Methylation in Control | 7.40E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
5'UTR (cg19721867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.29E-02; Z-score: 6.35E-01 | ||
|
Methylation in Case |
4.87E-02 (Median) | Methylation in Control | 4.40E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC18A2 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
TSS1500 (cg15806304) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 2.75E-03; Z-score: 9.61E-01 | ||
|
Methylation in Case |
4.70E-01 (Median) | Methylation in Control | 4.11E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC18A2 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg20102878) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 5.81E-04; Z-score: -7.54E-01 | ||
|
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC18A2 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg10245915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.23E-02; Z-score: 2.58E-01 | ||
|
Methylation in Case |
9.67E-02 (Median) | Methylation in Control | 9.17E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC18A2 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg19617377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.75E-02; Z-score: 2.83E-01 | ||
|
Methylation in Case |
6.87E-02 (Median) | Methylation in Control | 6.57E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in systemic lupus erythematosus | [ 13 ] | |||
|
Location |
5'UTR (cg19721867) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.96E-02; Z-score: -4.99E-02 | ||
|
Methylation in Case |
1.36E-02 (Median) | Methylation in Control | 1.43E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC18A2 in systemic lupus erythematosus | [ 13 ] | |||
|
Location |
Body (cg19617377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.16E-02; Z-score: -7.02E-02 | ||
|
Methylation in Case |
9.25E-02 (Median) | Methylation in Control | 9.45E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in colon adenocarcinoma | [ 14 ] | |||
|
Location |
TSS1500 (cg13202751) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 9.23E-05; Z-score: 1.39E+00 | ||
|
Methylation in Case |
5.85E-01 (Median) | Methylation in Control | 5.05E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC18A2 in colon adenocarcinoma | [ 14 ] | |||
|
Location |
TSS1500 (cg09177518) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 2.06E-04; Z-score: 1.95E+00 | ||
|
Methylation in Case |
3.67E-01 (Median) | Methylation in Control | 2.54E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC18A2 in colon adenocarcinoma | [ 14 ] | |||
|
Location |
TSS1500 (cg26153885) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.69E-03; Z-score: -1.50E+00 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC18A2 in colon adenocarcinoma | [ 14 ] | |||
|
Location |
TSS1500 (cg08072251) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.38E+00 | Statistic Test | p-value: 2.12E-03; Z-score: 1.85E+00 | ||
|
Methylation in Case |
1.25E-01 (Median) | Methylation in Control | 9.05E-02 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC18A2 in colon adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg23274660) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.60E+00 | Statistic Test | p-value: 5.67E-06; Z-score: -1.47E+00 | ||
|
Methylation in Case |
1.79E-01 (Median) | Methylation in Control | 2.86E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC18A2 in colon adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg08362628) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 1.19E-04; Z-score: -2.85E+00 | ||
|
Methylation in Case |
7.15E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC18A2 in colon adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg06070755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.64E-03; Z-score: -2.19E+00 | ||
|
Methylation in Case |
8.45E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC18A2 in colon adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg10091752) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 3.41E-03; Z-score: -9.05E-01 | ||
|
Methylation in Case |
2.81E-01 (Median) | Methylation in Control | 3.33E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC18A2 in colon adenocarcinoma | [ 14 ] | |||
|
Location |
3'UTR (cg03234405) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 4.60E-04; Z-score: -3.04E+00 | ||
|
Methylation in Case |
7.47E-01 (Median) | Methylation in Control | 8.29E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in depression | [ 15 ] | |||
|
Location |
Body (cg10245915) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 5.26E-03; Z-score: 6.15E-01 | ||
|
Methylation in Case |
6.86E-02 (Median) | Methylation in Control | 6.33E-02 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC18A2 in panic disorder | [ 16 ] | |||
|
Location |
Body (cg15225091) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -9.28E-01 | Statistic Test | p-value: 2.59E-02; Z-score: -3.94E-01 | ||
|
Methylation in Case |
-3.22E+00 (Median) | Methylation in Control | -2.99E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-431 directly targets SLC18A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-431 | miRNA Mature ID | miR-431-5p | ||
|
miRNA Sequence |
UGUCUUGCAGGCCGUCAUGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 2 |
miR-4639 directly targets SLC18A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4639 | miRNA Mature ID | miR-4639-5p | ||
|
miRNA Sequence |
UUGCUAAGUAGGCUGAGAUUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 3 |
miR-6507 directly targets SLC18A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6507 | miRNA Mature ID | miR-6507-5p | ||
|
miRNA Sequence |
GAAGAAUAGGAGGGACUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.