Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0037 Transporter Info
Gene Name ABCA10
Transporter Name ATP-binding cassette sub-family A member 10
Gene ID
10349
UniProt ID
Q8WWZ4
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA10 in bladder cancer [ 1 ]

Location

 5'UTR (cg14019757)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.37E+00 Statistic Test p-value: 2.82E-06; Z-score: -5.74E+00

Methylation in Case

 8.57E-02 (Median) Methylation in Control 2.03E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA10 in bladder cancer [ 1 ]

Location

 Body (cg13849142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 4.03E-11; Z-score: -1.04E+01

Methylation in Case

 6.86E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA10 in breast cancer [ 2 ]

Location

 5'UTR (cg14019757)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.70E+00 Statistic Test p-value: 1.18E-07; Z-score: -1.48E+00

Methylation in Case

 1.50E-01 (Median) Methylation in Control 2.56E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA10 in breast cancer [ 2 ]

Location

 Body (cg13849142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.84E-07; Z-score: -1.25E+00

Methylation in Case

 6.63E-01 (Median) Methylation in Control 6.98E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA10 in pancretic ductal adenocarcinoma [ 3 ]

Location

 5'UTR (cg07204550)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.26E+00 Statistic Test p-value: 8.92E-26; Z-score: 3.99E+00

Methylation in Case

 2.83E-01 (Median) Methylation in Control 8.68E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA10 in pancretic ductal adenocarcinoma [ 3 ]

Location

 5'UTR (cg22615730)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 4.82E-18; Z-score: -2.63E+00

Methylation in Case

 6.01E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA10 in papillary thyroid cancer [ 4 ]

Location

 5'UTR (cg14019757)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.35E+00 Statistic Test p-value: 2.13E-04; Z-score: -1.60E+00

Methylation in Case

 1.56E-01 (Median) Methylation in Control 2.11E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCA10 in papillary thyroid cancer [ 4 ]

Location

 Body (cg13849142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 8.86E-03; Z-score: -2.95E-01

Methylation in Case

 7.16E-01 (Median) Methylation in Control 7.24E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA10 in colorectal cancer [ 5 ]

Location

 Body (cg13849142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.36E-04; Z-score: -1.11E+00

Methylation in Case

 8.17E-01 (Median) Methylation in Control 8.42E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCA10 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg13849142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.27E-05; Z-score: -1.60E+00

Methylation in Case

 6.21E-01 (Median) Methylation in Control 6.73E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1281 directly targets ABCA10 [ 7 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1281 miRNA Mature ID miR-1281

miRNA Sequence

 UCGCCUCCUCCUCUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-6785 directly targets ABCA10 [ 7 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6785 miRNA Mature ID miR-6785-3p

miRNA Sequence

 ACAUCGCCCCACCUUCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
4 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.