Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0045 Transporter Info | ||||
| Gene Name | ABCA7 | ||||
| Transporter Name | ATP-binding cassette sub-family A member 7 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Breast cancer |
14 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
5'UTR (cg10749413) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 4.07E-03; Z-score: -5.04E-01 | ||
|
Methylation in Case |
5.31E-02 (Median) | Methylation in Control | 6.63E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
TSS1500 (cg06730721) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 1.49E-02; Z-score: -4.94E-01 | ||
|
Methylation in Case |
4.10E-02 (Median) | Methylation in Control | 4.93E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg06169110) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 2.28E-11; Z-score: 1.50E+00 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 6.69E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg02986791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 9.79E-07; Z-score: 8.92E-01 | ||
|
Methylation in Case |
8.15E-01 (Median) | Methylation in Control | 7.54E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg26576206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 1.21E-04; Z-score: 4.86E-01 | ||
|
Methylation in Case |
6.33E-02 (Median) | Methylation in Control | 4.98E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg12082025) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 1.44E-04; Z-score: 6.58E-01 | ||
|
Methylation in Case |
7.62E-01 (Median) | Methylation in Control | 6.55E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg05372495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 7.80E-04; Z-score: 6.48E-01 | ||
|
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg02253236) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 1.43E-03; Z-score: 1.47E+00 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 6.34E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg02959678) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 2.97E-03; Z-score: 1.40E+00 | ||
|
Methylation in Case |
8.38E-01 (Median) | Methylation in Control | 7.56E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg24145486) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.01E-02; Z-score: -8.89E-01 | ||
|
Methylation in Case |
8.35E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg02807077) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.44E-02; Z-score: 8.58E-01 | ||
|
Methylation in Case |
8.65E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg18529892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.58E-02; Z-score: -2.58E-02 | ||
|
Methylation in Case |
6.86E-01 (Median) | Methylation in Control | 6.87E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg23027715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 4.02E-02; Z-score: 5.42E-01 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 7.74E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCA7 in breast cancer | [ 1 ] | |||
|
Location |
Body (cg13761375) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 4.93E-02; Z-score: 2.56E-01 | ||
|
Methylation in Case |
2.62E-02 (Median) | Methylation in Control | 2.40E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA7 in colorectal cancer | [ 2 ] | |||
|
Location |
5'UTR (cg10749413) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.46E-02; Z-score: -5.95E-01 | ||
|
Methylation in Case |
8.36E-02 (Median) | Methylation in Control | 9.60E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA7 in colorectal cancer | [ 2 ] | |||
|
Location |
TSS200 (cg21590311) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 1.74E-03; Z-score: 7.14E-01 | ||
|
Methylation in Case |
1.10E-01 (Median) | Methylation in Control | 9.39E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA7 in colorectal cancer | [ 2 ] | |||
|
Location |
Body (cg23027715) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.06E-04; Z-score: -4.72E-01 | ||
|
Methylation in Case |
9.22E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA7 in colorectal cancer | [ 2 ] | |||
|
Location |
Body (cg05372495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 5.43E-04; Z-score: -5.61E-01 | ||
|
Methylation in Case |
8.20E-01 (Median) | Methylation in Control | 8.64E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA7 in colorectal cancer | [ 2 ] | |||
|
Location |
Body (cg10406526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.30E-03; Z-score: -7.40E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 9.19E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA7 in colorectal cancer | [ 2 ] | |||
|
Location |
Body (cg00874873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.23E-03; Z-score: -5.58E-01 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.42E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA7 in colorectal cancer | [ 2 ] | |||
|
Location |
Body (cg18529892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 8.94E-03; Z-score: -8.52E-01 | ||
|
Methylation in Case |
8.21E-01 (Median) | Methylation in Control | 8.60E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA7 in colorectal cancer | [ 2 ] | |||
|
Location |
Body (cg12082025) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 3.47E-02; Z-score: -8.28E-01 | ||
|
Methylation in Case |
5.26E-01 (Median) | Methylation in Control | 6.89E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA7 in colorectal cancer | [ 2 ] | |||
|
Location |
Body (cg13761375) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.96E-02; Z-score: -1.28E-01 | ||
|
Methylation in Case |
3.00E-02 (Median) | Methylation in Control | 3.15E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA7 in colorectal cancer | [ 2 ] | |||
|
Location |
Body (cg24145486) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.38E-02; Z-score: -5.43E-03 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg10749413) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 9.62E-06; Z-score: -1.72E-02 | ||
|
Methylation in Case |
6.07E-02 (Median) | Methylation in Control | 6.09E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg05989429) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 2.51E-05; Z-score: 2.01E-01 | ||
|
Methylation in Case |
5.23E-02 (Median) | Methylation in Control | 5.02E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg04957628) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.02E+00 | Statistic Test | p-value: 4.64E-16; Z-score: 8.59E+00 | ||
|
Methylation in Case |
4.37E-01 (Median) | Methylation in Control | 1.09E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg26263477) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.61E-02; Z-score: -5.48E-01 | ||
|
Methylation in Case |
8.44E-02 (Median) | Methylation in Control | 8.99E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg10527010) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.69E+00 | Statistic Test | p-value: 3.38E-10; Z-score: 6.56E+00 | ||
|
Methylation in Case |
3.89E-01 (Median) | Methylation in Control | 1.05E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg04923840) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.81E+00 | Statistic Test | p-value: 3.58E-18; Z-score: -3.87E+00 | ||
|
Methylation in Case |
3.25E-01 (Median) | Methylation in Control | 5.90E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg18529892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.13E-05; Z-score: -6.55E-01 | ||
|
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg21995147) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.52E-05; Z-score: 4.50E-01 | ||
|
Methylation in Case |
9.62E-01 (Median) | Methylation in Control | 9.42E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg12082025) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 4.66E-05; Z-score: 5.54E-01 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg02959678) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.60E-03; Z-score: 7.07E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.70E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg00874873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.79E-03; Z-score: -2.87E-01 | ||
|
Methylation in Case |
8.59E-01 (Median) | Methylation in Control | 8.80E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg10406526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.37E-03; Z-score: -1.07E-01 | ||
|
Methylation in Case |
9.50E-01 (Median) | Methylation in Control | 9.59E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg02986791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 9.60E-03; Z-score: 4.88E-01 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg05372495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.92E-02; Z-score: 2.47E-01 | ||
|
Methylation in Case |
9.51E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of ABCA7 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg21318380) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.72E+00 | Statistic Test | p-value: 8.52E-12; Z-score: -2.83E+00 | ||
|
Methylation in Case |
2.71E-01 (Median) | Methylation in Control | 4.65E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA7 in lung adenocarcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg10749413) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 4.10E-03; Z-score: -1.81E+00 | ||
|
Methylation in Case |
7.90E-02 (Median) | Methylation in Control | 9.19E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA7 in lung adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg02253236) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 7.70E-03; Z-score: -1.87E+00 | ||
|
Methylation in Case |
7.88E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA7 in lung adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg02986791) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 2.78E-02; Z-score: 1.28E+00 | ||
|
Methylation in Case |
9.02E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA7 in lung adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg05372495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.23E-02; Z-score: 4.42E-01 | ||
|
Methylation in Case |
9.45E-01 (Median) | Methylation in Control | 9.34E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA7 in papillary thyroid cancer | [ 5 ] | |||
|
Location |
5'UTR (cg10749413) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 2.87E-06; Z-score: -6.63E-01 | ||
|
Methylation in Case |
4.25E-02 (Median) | Methylation in Control | 4.86E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA7 in papillary thyroid cancer | [ 5 ] | |||
|
Location |
5'UTR (cg07951348) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.22E-02; Z-score: -1.98E-01 | ||
|
Methylation in Case |
1.64E-01 (Median) | Methylation in Control | 1.70E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA7 in papillary thyroid cancer | [ 5 ] | |||
|
Location |
TSS200 (cg07726048) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 7.54E-04; Z-score: 7.58E-01 | ||
|
Methylation in Case |
4.85E-02 (Median) | Methylation in Control | 4.42E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA7 in papillary thyroid cancer | [ 5 ] | |||
|
Location |
Body (cg26576206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 2.47E-03; Z-score: 5.07E-01 | ||
|
Methylation in Case |
9.38E-02 (Median) | Methylation in Control | 8.50E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA7 in papillary thyroid cancer | [ 5 ] | |||
|
Location |
Body (cg02807077) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.97E-02; Z-score: 4.45E-01 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA7 in papillary thyroid cancer | [ 5 ] | |||
|
Location |
Body (cg05372495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.12E-02; Z-score: 6.30E-01 | ||
|
Methylation in Case |
8.61E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA7 in papillary thyroid cancer | [ 5 ] | |||
|
Location |
Body (cg02253236) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.15E-02; Z-score: -2.73E-01 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA7 in papillary thyroid cancer | [ 5 ] | |||
|
Location |
Body (cg24145486) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.76E-02; Z-score: -2.70E-01 | ||
|
Methylation in Case |
9.38E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA7 in papillary thyroid cancer | [ 5 ] | |||
|
Location |
Body (cg13761375) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 4.23E-02; Z-score: -5.99E-01 | ||
|
Methylation in Case |
6.13E-02 (Median) | Methylation in Control | 6.78E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA7 in bladder cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg05504606) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 2.21E-02; Z-score: -1.65E+00 | ||
|
Methylation in Case |
6.10E-02 (Median) | Methylation in Control | 7.16E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA7 in bladder cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg26263477) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 4.47E-02; Z-score: -1.99E+00 | ||
|
Methylation in Case |
9.29E-02 (Median) | Methylation in Control | 1.11E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA7 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg18529892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 6.96E-06; Z-score: -8.93E+00 | ||
|
Methylation in Case |
5.68E-01 (Median) | Methylation in Control | 7.03E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA7 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg24145486) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 9.54E-06; Z-score: -6.98E+00 | ||
|
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA7 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg02253236) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.87E+00 | Statistic Test | p-value: 9.58E-06; Z-score: -5.34E+00 | ||
|
Methylation in Case |
4.07E-01 (Median) | Methylation in Control | 7.58E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA7 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg02959678) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.64E-03; Z-score: -1.69E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA7 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg10406526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 9.71E-03; Z-score: -8.25E-01 | ||
|
Methylation in Case |
8.42E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA7 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg23657707) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.59E-02; Z-score: -2.71E+00 | ||
|
Methylation in Case |
9.78E-01 (Median) | Methylation in Control | 9.84E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA7 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg26576206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.59E+00 | Statistic Test | p-value: 1.65E-02; Z-score: -2.19E+00 | ||
|
Methylation in Case |
5.31E-02 (Median) | Methylation in Control | 8.45E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA7 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg02817925) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.89E-02; Z-score: -2.73E+00 | ||
|
Methylation in Case |
9.77E-01 (Median) | Methylation in Control | 9.83E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA7 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg06730721) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 2.39E-03; Z-score: 7.52E-01 | ||
|
Methylation in Case |
1.56E-02 (Median) | Methylation in Control | 1.37E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA7 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg07726048) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.88E-04; Z-score: 7.93E-01 | ||
|
Methylation in Case |
1.79E-02 (Median) | Methylation in Control | 1.58E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA7 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg21590311) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.03E-03; Z-score: 4.11E-01 | ||
|
Methylation in Case |
2.40E-02 (Median) | Methylation in Control | 2.25E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA7 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg18529892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.23E-03; Z-score: -3.14E-01 | ||
|
Methylation in Case |
8.69E-01 (Median) | Methylation in Control | 8.74E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA7 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg26576206) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.39E+00 | Statistic Test | p-value: 5.00E-03; Z-score: 4.44E-01 | ||
|
Methylation in Case |
4.71E-02 (Median) | Methylation in Control | 3.39E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA7 in clear cell renal cell carcinoma | [ 7 ] | |||
|
Location |
Body (cg02817925) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 3.00E-02; Z-score: 9.08E-02 | ||
|
Methylation in Case |
9.72E-01 (Median) | Methylation in Control | 9.72E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA7 in colon adenocarcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg18543242) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 5.33E-05; Z-score: -1.62E+00 | ||
|
Methylation in Case |
5.16E-01 (Median) | Methylation in Control | 5.86E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA7 in colon adenocarcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg13126638) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 4.08E-04; Z-score: -1.29E+00 | ||
|
Methylation in Case |
4.75E-01 (Median) | Methylation in Control | 5.57E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA7 in colon adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg15573830) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 5.21E-04; Z-score: -1.46E+00 | ||
|
Methylation in Case |
3.95E-01 (Median) | Methylation in Control | 4.93E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA7 in colon adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg03771731) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 6.45E-04; Z-score: -5.11E+00 | ||
|
Methylation in Case |
7.05E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA7 in colon adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg14634247) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 7.89E-04; Z-score: -7.33E-01 | ||
|
Methylation in Case |
1.10E-01 (Median) | Methylation in Control | 1.23E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA7 in colon adenocarcinoma | [ 8 ] | |||
|
Location |
Body (cg24585559) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.38E-03; Z-score: -1.25E+00 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg11826452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 3.62E-03; Z-score: -7.37E-01 | ||
|
Methylation in Case |
5.32E-01 (Median) | Methylation in Control | 5.66E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS1500 (cg24977541) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.53E-02; Z-score: 8.80E-01 | ||
|
Methylation in Case |
7.58E-01 (Median) | Methylation in Control | 6.82E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg13177758) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 7.79E-14; Z-score: 1.20E+00 | ||
|
Methylation in Case |
1.45E-01 (Median) | Methylation in Control | 1.13E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg13433302) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.27E-06; Z-score: 7.08E-01 | ||
|
Methylation in Case |
2.38E-01 (Median) | Methylation in Control | 2.00E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg01227078) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 3.96E-03; Z-score: -3.92E-01 | ||
|
Methylation in Case |
1.19E-01 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg16484020) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.00E-06; Z-score: -1.00E+00 | ||
|
Methylation in Case |
6.40E-01 (Median) | Methylation in Control | 7.08E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg09467487) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.00E-05; Z-score: 1.16E+00 | ||
|
Methylation in Case |
7.53E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg01856752) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.74E-04; Z-score: 9.13E-01 | ||
|
Methylation in Case |
7.72E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg12853184) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 7.13E-04; Z-score: -8.76E-01 | ||
|
Methylation in Case |
2.19E-01 (Median) | Methylation in Control | 2.79E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg00893603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.09E-03; Z-score: -6.43E-01 | ||
|
Methylation in Case |
7.51E-01 (Median) | Methylation in Control | 8.02E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
Body (cg07525751) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.83E-02; Z-score: 4.97E-01 | ||
|
Methylation in Case |
8.18E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
3'UTR (cg24697925) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.03E-04; Z-score: 9.58E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of ABCA7 in pancretic ductal adenocarcinoma | [ 9 ] | |||
|
Location |
3'UTR (cg01923881) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 2.47E-02; Z-score: 4.34E-01 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA7 in panic disorder | [ 10 ] | |||
|
Location |
TSS1500 (cg05504606) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 9.92E-01 | Statistic Test | p-value: 4.07E-02; Z-score: 1.30E-01 | ||
|
Methylation in Case |
-4.86E+00 (Median) | Methylation in Control | -4.89E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA7 in panic disorder | [ 10 ] | |||
|
Location |
Body (cg00874873) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 2.04E-02; Z-score: 3.99E-01 | ||
|
Methylation in Case |
3.60E+00 (Median) | Methylation in Control | 3.39E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA7 in panic disorder | [ 10 ] | |||
|
Location |
Body (cg10406526) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.52E-02; Z-score: -3.93E-01 | ||
|
Methylation in Case |
5.49E+00 (Median) | Methylation in Control | 5.56E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA7 in panic disorder | [ 10 ] | |||
|
Location |
Body (cg02817925) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.36E-02; Z-score: -2.94E-01 | ||
|
Methylation in Case |
5.26E+00 (Median) | Methylation in Control | 5.31E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA7 in panic disorder | [ 10 ] | |||
|
Location |
Body (cg18529892) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 3.53E-02; Z-score: 3.62E-01 | ||
|
Methylation in Case |
1.68E+00 (Median) | Methylation in Control | 1.56E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCA7 in panic disorder | [ 10 ] | |||
|
Location |
Body (cg21995147) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.01E-02; Z-score: -2.33E-01 | ||
|
Methylation in Case |
4.96E+00 (Median) | Methylation in Control | 5.04E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA7 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg04100956) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 1.94E-02; Z-score: 1.91E+00 | ||
|
Methylation in Case |
8.50E-01 (Median) | Methylation in Control | 7.61E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-335 directly targets ABCA7 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.