Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0046 Transporter Info | ||||
| Gene Name | ABCA8 | ||||
| Transporter Name | ATP-binding cassette sub-family A member 8 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Atypical teratoid rhabdoid tumor |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA8 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg03850529) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 2.03E-08; Z-score: 1.57E+00 | ||
|
Methylation in Case |
7.82E-01 (Median) | Methylation in Control | 5.59E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA8 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
|
Location |
5'UTR (cg21660392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 5.47E-06; Z-score: 1.32E+00 | ||
|
Methylation in Case |
8.49E-01 (Median) | Methylation in Control | 6.95E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA8 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg03850529) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.07E-05; Z-score: -5.36E+00 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA8 in bladder cancer | [ 2 ] | |||
|
Location |
5'UTR (cg21660392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 7.09E-03; Z-score: 2.60E+00 | ||
|
Methylation in Case |
6.99E-01 (Median) | Methylation in Control | 5.80E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA8 in bladder cancer | [ 2 ] | |||
|
Location |
TSS200 (cg27464144) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 2.01E-02; Z-score: 1.07E+00 | ||
|
Methylation in Case |
5.01E-01 (Median) | Methylation in Control | 4.23E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA8 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg20561863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.99E+00 | Statistic Test | p-value: 9.03E-04; Z-score: -3.23E+00 | ||
|
Methylation in Case |
7.88E-02 (Median) | Methylation in Control | 3.14E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA8 in breast cancer | [ 3 ] | |||
|
Location |
5'UTR (cg03850529) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.25E-10; Z-score: -3.86E+00 | ||
|
Methylation in Case |
8.35E-01 (Median) | Methylation in Control | 9.01E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg17334372) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 4.93E-12; Z-score: -2.70E+00 | ||
|
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg17461670) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 5.21E-11; Z-score: -2.83E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA8 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg20561863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.67E+00 | Statistic Test | p-value: 4.41E-08; Z-score: 2.19E+00 | ||
|
Methylation in Case |
2.24E-01 (Median) | Methylation in Control | 1.34E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA8 in colorectal cancer | [ 4 ] | |||
|
Location |
5'UTR (cg21660392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 4.71E-07; Z-score: -2.37E+00 | ||
|
Methylation in Case |
7.56E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA8 in colorectal cancer | [ 4 ] | |||
|
Location |
5'UTR (cg03850529) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.07E-03; Z-score: -1.07E-01 | ||
|
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA8 in colorectal cancer | [ 4 ] | |||
|
Location |
Body (cg20561863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.75E+00 | Statistic Test | p-value: 1.16E-09; Z-score: -2.47E+00 | ||
|
Methylation in Case |
3.45E-01 (Median) | Methylation in Control | 6.05E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA8 in colorectal cancer | [ 4 ] | |||
|
Location |
Body (cg17461670) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 9.02E-06; Z-score: -1.72E+00 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCA8 in colorectal cancer | [ 4 ] | |||
|
Location |
Body (cg17334372) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 9.25E-04; Z-score: -5.19E-01 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA8 in HIV infection | [ 5 ] | |||
|
Location |
5'UTR (cg21660392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.12E-02; Z-score: -2.06E-01 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 9.08E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA8 in HIV infection | [ 5 ] | |||
|
Location |
TSS200 (cg27464144) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.83E-03; Z-score: -1.00E+00 | ||
|
Methylation in Case |
8.69E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA8 in HIV infection | [ 5 ] | |||
|
Location |
Body (cg20561863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.68E+00 | Statistic Test | p-value: 2.06E-06; Z-score: 2.84E+00 | ||
|
Methylation in Case |
3.45E-01 (Median) | Methylation in Control | 2.06E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA8 in HIV infection | [ 5 ] | |||
|
Location |
Body (cg17334372) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.86E-02; Z-score: -6.34E-01 | ||
|
Methylation in Case |
8.45E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA8 in panic disorder | [ 6 ] | |||
|
Location |
5'UTR (cg03850529) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 1.65E-04; Z-score: -6.51E-01 | ||
|
Methylation in Case |
1.61E+00 (Median) | Methylation in Control | 1.92E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA8 in panic disorder | [ 6 ] | |||
|
Location |
5'UTR (cg21660392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 3.72E-02; Z-score: -3.58E-01 | ||
|
Methylation in Case |
1.92E+00 (Median) | Methylation in Control | 2.09E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA8 in panic disorder | [ 6 ] | |||
|
Location |
TSS200 (cg27464144) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.98E+00 | Statistic Test | p-value: 3.64E-04; Z-score: -6.84E-01 | ||
|
Methylation in Case |
3.01E-01 (Median) | Methylation in Control | 5.97E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA8 in panic disorder | [ 6 ] | |||
|
Location |
Body (cg17334372) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -8.18E-01 | Statistic Test | p-value: 6.00E-03; Z-score: -3.39E-01 | ||
|
Methylation in Case |
-5.81E-01 (Median) | Methylation in Control | -4.75E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA8 in papillary thyroid cancer | [ 7 ] | |||
|
Location |
5'UTR (cg21660392) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.04E-04; Z-score: 9.25E-01 | ||
|
Methylation in Case |
8.62E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA8 in papillary thyroid cancer | [ 7 ] | |||
|
Location |
Body (cg20561863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.68E+00 | Statistic Test | p-value: 5.40E-19; Z-score: -3.00E+00 | ||
|
Methylation in Case |
3.45E-01 (Median) | Methylation in Control | 5.82E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA8 in papillary thyroid cancer | [ 7 ] | |||
|
Location |
Body (cg17334372) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.44E-03; Z-score: -5.49E-01 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA8 in prostate cancer | [ 8 ] | |||
|
Location |
5'UTR (cg23671196) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 2.35E-02; Z-score: 2.18E+00 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA8 in prostate cancer | [ 8 ] | |||
|
Location |
TSS1500 (cg14664759) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.74E+00 | Statistic Test | p-value: 2.13E-02; Z-score: 1.16E+01 | ||
|
Methylation in Case |
4.42E-01 (Median) | Methylation in Control | 1.18E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCA8 in prostate cancer | [ 8 ] | |||
|
Location |
Body (cg18629527) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 4.89E-02; Z-score: -1.70E+00 | ||
|
Methylation in Case |
1.30E-01 (Median) | Methylation in Control | 2.01E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCA8 in prostate cancer | [ 8 ] | |||
|
Location |
3'UTR (cg01442319) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 1.63E-02; Z-score: 2.31E+00 | ||
|
Methylation in Case |
8.64E-01 (Median) | Methylation in Control | 7.37E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA8 in hepatocellular carcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg27464144) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 3.76E-05; Z-score: -1.43E+00 | ||
|
Methylation in Case |
3.65E-01 (Median) | Methylation in Control | 4.70E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCA8 in hepatocellular carcinoma | [ 9 ] | |||
|
Location |
Body (cg12949769) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 2.46E-15; Z-score: -5.56E+00 | ||
|
Methylation in Case |
5.09E-01 (Median) | Methylation in Control | 7.54E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA8 in systemic lupus erythematosus | [ 10 ] | |||
|
Location |
TSS200 (cg27464144) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.77E-02; Z-score: -1.50E-01 | ||
|
Methylation in Case |
8.66E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCA8 in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg20561863) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 9.66E-03; Z-score: -1.23E+00 | ||
|
Methylation in Case |
3.46E-01 (Median) | Methylation in Control | 4.36E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-192 directly targets ABCA8 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-192 | miRNA Mature ID | miR-192-5p | ||
|
miRNA Sequence |
CUGACCUAUGAAUUGACAGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
miR-335 directly targets ABCA8 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.