Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0052 Transporter Info | ||||
| Gene Name | ABCB6 | ||||
| Transporter Name | ATP-binding cassette sub-family B member 6 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Hepatocellular carcinoma |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypermethylation of ABCB6 in hepatitis C virus-related hepatocellular carcinoma | [ 1 ] | |||
|
Epigenetic Type |
Methylation | Experiment Method | Methylation-specific PCR | ||
|
Related Molecular Changes |
Down regulation of ABCB6 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples; Multiple cell lines of human | ||||
|
Additional Notes |
The percentage of DNA methylation of ABCB6 was inversely correlated with the ABCB6 mRNA levels in hepatoma cell lines and clinical samples. | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg13800769) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.55E+00 | Statistic Test | p-value: 1.33E-11; Z-score: -2.61E+00 | ||
|
Methylation in Case |
2.33E-01 (Median) | Methylation in Control | 3.61E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCB6 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg06716437) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 7.94E-05; Z-score: 1.00E+00 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 1.99E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCB6 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg23153680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 6.13E-03; Z-score: 2.72E-01 | ||
|
Methylation in Case |
2.29E-01 (Median) | Methylation in Control | 2.08E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCB6 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
TSS200 (cg07920064) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.94E-02; Z-score: 7.78E-02 | ||
|
Methylation in Case |
3.56E-02 (Median) | Methylation in Control | 3.44E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCB6 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
TSS200 (cg07100128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.17E-02; Z-score: 7.98E-02 | ||
|
Methylation in Case |
5.82E-02 (Median) | Methylation in Control | 5.74E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCB6 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg22167704) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.44E+00 | Statistic Test | p-value: 1.26E-16; Z-score: -9.74E+00 | ||
|
Methylation in Case |
5.59E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCB6 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg19412109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.43E+00 | Statistic Test | p-value: 8.34E-05; Z-score: -1.12E+00 | ||
|
Methylation in Case |
1.03E-01 (Median) | Methylation in Control | 1.47E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCB6 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
3'UTR (cg02776283) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.76E-04; Z-score: 1.13E+00 | ||
|
Methylation in Case |
7.07E-01 (Median) | Methylation in Control | 6.61E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg13425422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.61E-03; Z-score: -2.14E-01 | ||
|
Methylation in Case |
8.59E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg06652199) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.40E+00 | Statistic Test | p-value: 5.50E-28; Z-score: 4.49E+00 | ||
|
Methylation in Case |
2.86E-01 (Median) | Methylation in Control | 6.50E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCB6 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg06417752) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 1.25E-07; Z-score: -1.33E+00 | ||
|
Methylation in Case |
2.20E-01 (Median) | Methylation in Control | 2.65E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCB6 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg25771897) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.55E-02; Z-score: -1.24E-01 | ||
|
Methylation in Case |
1.13E-01 (Median) | Methylation in Control | 1.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCB6 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg25841634) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.05E-02; Z-score: -5.05E-01 | ||
|
Methylation in Case |
7.42E-02 (Median) | Methylation in Control | 7.96E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCB6 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg07920064) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.40E-02; Z-score: -4.11E-01 | ||
|
Methylation in Case |
6.21E-02 (Median) | Methylation in Control | 6.57E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCB6 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
1stExon (cg13925011) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.37E-03; Z-score: 6.16E-01 | ||
|
Methylation in Case |
6.95E-01 (Median) | Methylation in Control | 6.56E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCB6 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg00089550) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 7.11E-03; Z-score: -7.65E-01 | ||
|
Methylation in Case |
3.77E-01 (Median) | Methylation in Control | 4.12E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in bladder cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg23153680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.08E+00 | Statistic Test | p-value: 1.16E-05; Z-score: 4.26E+00 | ||
|
Methylation in Case |
3.35E-01 (Median) | Methylation in Control | 1.61E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in bladder cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg06716437) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.14E+00 | Statistic Test | p-value: 1.26E-05; Z-score: 5.40E+00 | ||
|
Methylation in Case |
2.92E-01 (Median) | Methylation in Control | 1.37E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCB6 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg19964303) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.71E-05; Z-score: 4.79E+00 | ||
|
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 8.25E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCB6 in bladder cancer | [ 3 ] | |||
|
Location |
3'UTR (cg02776283) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 1.07E-03; Z-score: 3.49E+00 | ||
|
Methylation in Case |
8.32E-01 (Median) | Methylation in Control | 6.70E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg23153680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.21E+00 | Statistic Test | p-value: 1.01E-12; Z-score: 3.24E+00 | ||
|
Methylation in Case |
2.30E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg06716437) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.52E+00 | Statistic Test | p-value: 3.09E-09; Z-score: 2.11E+00 | ||
|
Methylation in Case |
2.18E-01 (Median) | Methylation in Control | 1.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCB6 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg24775454) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 1.37E-02; Z-score: 2.17E-01 | ||
|
Methylation in Case |
1.17E-02 (Median) | Methylation in Control | 9.60E-03 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCB6 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg08290072) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 2.05E-02; Z-score: 1.93E-01 | ||
|
Methylation in Case |
9.20E-03 (Median) | Methylation in Control | 7.92E-03 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCB6 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg18014247) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 2.16E-02; Z-score: 4.61E-01 | ||
|
Methylation in Case |
6.39E-02 (Median) | Methylation in Control | 5.73E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCB6 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg26544277) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 2.70E-02; Z-score: 2.68E-01 | ||
|
Methylation in Case |
3.46E-02 (Median) | Methylation in Control | 3.08E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCB6 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg19412109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 1.03E-07; Z-score: 1.51E+00 | ||
|
Methylation in Case |
1.34E-01 (Median) | Methylation in Control | 9.57E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCB6 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg19964303) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.13E-05; Z-score: 8.20E-01 | ||
|
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 8.16E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg23153680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.90E+00 | Statistic Test | p-value: 6.12E-06; Z-score: 1.00E+00 | ||
|
Methylation in Case |
1.09E-01 (Median) | Methylation in Control | 5.76E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg06716437) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.03E+00 | Statistic Test | p-value: 1.09E-05; Z-score: 1.19E+00 | ||
|
Methylation in Case |
1.15E-01 (Median) | Methylation in Control | 5.66E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCB6 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
1stExon (cg23547073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 2.74E-06; Z-score: 1.49E+00 | ||
|
Methylation in Case |
4.88E-02 (Median) | Methylation in Control | 4.04E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCB6 in clear cell renal cell carcinoma | [ 5 ] | |||
|
Location |
Body (cg19412109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.74E+00 | Statistic Test | p-value: 9.03E-06; Z-score: 1.55E+00 | ||
|
Methylation in Case |
8.44E-02 (Median) | Methylation in Control | 4.84E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg16703956) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 2.77E-06; Z-score: 1.35E+00 | ||
|
Methylation in Case |
6.73E-01 (Median) | Methylation in Control | 5.22E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
1stExon (cg20302133) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 7.58E-06; Z-score: 9.13E-01 | ||
|
Methylation in Case |
6.69E-01 (Median) | Methylation in Control | 5.49E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCB6 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg16146033) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 4.79E-06; Z-score: -1.09E+00 | ||
|
Methylation in Case |
2.91E-01 (Median) | Methylation in Control | 3.78E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCB6 in colon adenocarcinoma | [ 6 ] | |||
|
Location |
Body (cg05367173) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 6.74E-06; Z-score: -4.91E+00 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 8.63E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg06716437) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.42E+00 | Statistic Test | p-value: 3.27E-02; Z-score: -1.22E+00 | ||
|
Methylation in Case |
2.75E-01 (Median) | Methylation in Control | 3.89E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS200 (cg07100128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 2.49E-02; Z-score: 4.57E-01 | ||
|
Methylation in Case |
8.34E-02 (Median) | Methylation in Control | 7.90E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCB6 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS200 (cg07920064) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 4.39E-02; Z-score: 6.41E-01 | ||
|
Methylation in Case |
2.69E-02 (Median) | Methylation in Control | 2.28E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCB6 in colorectal cancer | [ 7 ] | |||
|
Location |
1stExon (cg23547073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.52E-02; Z-score: 2.64E-01 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in HIV infection | [ 9 ] | |||
|
Location |
TSS1500 (cg23153680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.27E+00 | Statistic Test | p-value: 1.36E-09; Z-score: 3.32E+00 | ||
|
Methylation in Case |
3.51E-01 (Median) | Methylation in Control | 1.55E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in HIV infection | [ 9 ] | |||
|
Location |
TSS1500 (cg06716437) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 2.29E-07; Z-score: 1.92E+00 | ||
|
Methylation in Case |
2.31E-01 (Median) | Methylation in Control | 1.47E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCB6 in HIV infection | [ 9 ] | |||
|
Location |
TSS200 (cg26544277) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.65E+00 | Statistic Test | p-value: 1.47E-03; Z-score: 1.26E+00 | ||
|
Methylation in Case |
4.68E-02 (Median) | Methylation in Control | 2.83E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCB6 in HIV infection | [ 9 ] | |||
|
Location |
TSS200 (cg07920064) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 1.27E-02; Z-score: 7.46E-01 | ||
|
Methylation in Case |
4.70E-02 (Median) | Methylation in Control | 3.78E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCB6 in HIV infection | [ 9 ] | |||
|
Location |
TSS200 (cg08290072) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.52E+00 | Statistic Test | p-value: 1.39E-02; Z-score: 1.45E+00 | ||
|
Methylation in Case |
2.26E-02 (Median) | Methylation in Control | 8.97E-03 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCB6 in HIV infection | [ 9 ] | |||
|
Location |
TSS200 (cg24775454) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.53E+00 | Statistic Test | p-value: 2.92E-02; Z-score: 1.15E+00 | ||
|
Methylation in Case |
1.55E-02 (Median) | Methylation in Control | 6.14E-03 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of ABCB6 in HIV infection | [ 9 ] | |||
|
Location |
TSS200 (cg07100128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 3.39E-02; Z-score: 6.02E-01 | ||
|
Methylation in Case |
6.94E-02 (Median) | Methylation in Control | 6.18E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of ABCB6 in HIV infection | [ 9 ] | |||
|
Location |
TSS200 (cg18014247) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 4.33E-02; Z-score: 4.95E-01 | ||
|
Methylation in Case |
7.32E-02 (Median) | Methylation in Control | 6.53E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of ABCB6 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg19412109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 1.35E-04; Z-score: 1.82E+00 | ||
|
Methylation in Case |
2.42E-01 (Median) | Methylation in Control | 1.88E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of ABCB6 in HIV infection | [ 9 ] | |||
|
Location |
3'UTR (cg02776283) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.72E+00 | Statistic Test | p-value: 8.14E-07; Z-score: 2.92E+00 | ||
|
Methylation in Case |
3.91E-01 (Median) | Methylation in Control | 2.27E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
TSS1500 (cg06716437) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.36E+00 | Statistic Test | p-value: 8.20E-04; Z-score: 1.97E+00 | ||
|
Methylation in Case |
2.64E-01 (Median) | Methylation in Control | 1.94E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
TSS1500 (cg23153680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.54E+00 | Statistic Test | p-value: 6.64E-03; Z-score: 2.32E+00 | ||
|
Methylation in Case |
2.77E-01 (Median) | Methylation in Control | 1.80E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCB6 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg08290072) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.56E+00 | Statistic Test | p-value: 2.90E-02; Z-score: 1.45E+00 | ||
|
Methylation in Case |
3.81E-02 (Median) | Methylation in Control | 2.45E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCB6 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg19412109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 3.60E-04; Z-score: 2.88E+00 | ||
|
Methylation in Case |
2.12E-01 (Median) | Methylation in Control | 1.47E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in panic disorder | [ 11 ] | |||
|
Location |
TSS1500 (cg23153680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -8.47E-01 | Statistic Test | p-value: 2.65E-04; Z-score: -7.56E-01 | ||
|
Methylation in Case |
-3.52E+00 (Median) | Methylation in Control | -2.98E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in panic disorder | [ 11 ] | |||
|
Location |
TSS200 (cg07100128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 9.65E-01 | Statistic Test | p-value: 7.88E-03; Z-score: 4.83E-01 | ||
|
Methylation in Case |
-4.36E+00 (Median) | Methylation in Control | -4.51E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
TSS1500 (cg23153680) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.47E+00 | Statistic Test | p-value: 1.27E-09; Z-score: 2.06E+00 | ||
|
Methylation in Case |
2.20E-01 (Median) | Methylation in Control | 1.50E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
TSS1500 (cg06716437) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.38E+00 | Statistic Test | p-value: 9.34E-07; Z-score: 1.48E+00 | ||
|
Methylation in Case |
1.13E-01 (Median) | Methylation in Control | 8.18E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCB6 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
TSS200 (cg07100128) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 4.34E-02; Z-score: 4.04E-01 | ||
|
Methylation in Case |
5.25E-02 (Median) | Methylation in Control | 4.81E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of ABCB6 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
TSS200 (cg26544277) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 4.66E-02; Z-score: 1.36E-01 | ||
|
Methylation in Case |
7.06E-02 (Median) | Methylation in Control | 6.91E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of ABCB6 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg19964303) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 7.58E-03; Z-score: 1.03E+00 | ||
|
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of ABCB6 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg00719108) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 7.91E-03; Z-score: 7.02E-01 | ||
|
Methylation in Case |
9.46E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
1stExon (cg23547073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 1.02E-16; Z-score: -2.19E+00 | ||
|
Methylation in Case |
5.14E-01 (Median) | Methylation in Control | 6.90E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg00719108) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.38E+00 | Statistic Test | p-value: 3.64E-05; Z-score: 1.23E+00 | ||
|
Methylation in Case |
6.89E-02 (Median) | Methylation in Control | 4.98E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of ABCB6 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
3'UTR (cg02776283) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 4.33E-15; Z-score: -2.72E+00 | ||
|
Methylation in Case |
4.79E-01 (Median) | Methylation in Control | 7.10E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in systemic lupus erythematosus | [ 14 ] | |||
|
Location |
1stExon (cg23547073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.75E-04; Z-score: -2.66E-01 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 1.36E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCB6 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg21506819) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 1.38E-02; Z-score: 2.01E+00 | ||
|
Methylation in Case |
8.50E-01 (Median) | Methylation in Control | 6.58E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCB6 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg05394840) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.52E-02; Z-score: 1.99E+00 | ||
|
Methylation in Case |
9.36E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-1 directly targets ABCB6 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
|
miRNA Stemloop ID |
miR-1 | miRNA Mature ID | miR-1-3p | ||
|
miRNA Sequence |
UGGAAUGUAAAGAAGUAUGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon 2 |
miR-26b directly targets ABCB6 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
|
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon 3 |
miR-7113 directly targets ABCB6 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7113 | miRNA Mature ID | miR-7113-5p | ||
|
miRNA Sequence |
UCCAGGGAGACAGUGUGUGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.