Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0053 Transporter Info
Gene Name ABCB7
Transporter Name ABC transporter 7 protein
Gene ID
22
UniProt ID
O75027
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB7 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg25571414)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 7.39E-09; Z-score: 1.88E+00

Methylation in Case

 8.12E-01 (Median) Methylation in Control 7.20E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCB7 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS200 (cg24611631)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 9.04E-03; Z-score: -4.67E-01

Methylation in Case

 7.76E-02 (Median) Methylation in Control 8.83E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCB7 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg15371566)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 1.28E-07; Z-score: -1.43E+00

Methylation in Case

 4.35E-01 (Median) Methylation in Control 5.52E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCB7 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg06116236)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.35E+00 Statistic Test p-value: 4.52E-07; Z-score: 1.60E+00

Methylation in Case

 5.27E-01 (Median) Methylation in Control 3.90E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of ABCB7 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg05485968)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 6.43E-05; Z-score: 9.71E-01

Methylation in Case

 8.78E-01 (Median) Methylation in Control 7.91E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of ABCB7 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg15555712)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.41E-02; Z-score: -6.53E-01

Methylation in Case

 6.09E-01 (Median) Methylation in Control 6.35E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB7 in bladder cancer [ 2 ]

Location

 TSS1500 (cg21131239)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.78E+00 Statistic Test p-value: 1.11E-03; Z-score: 7.26E+00

Methylation in Case

 7.35E-01 (Median) Methylation in Control 4.13E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCB7 in bladder cancer [ 2 ]

Location

 TSS1500 (cg20208052)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.56E+00 Statistic Test p-value: 1.27E-03; Z-score: 5.13E+00

Methylation in Case

 5.38E-01 (Median) Methylation in Control 3.44E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCB7 in bladder cancer [ 2 ]

Location

 TSS200 (cg16227775)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 5.48E-03; Z-score: 5.54E-01

Methylation in Case

 6.76E-02 (Median) Methylation in Control 5.57E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCB7 in bladder cancer [ 2 ]

Location

 TSS200 (cg01717812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.68E+00 Statistic Test p-value: 5.92E-03; Z-score: 1.76E+00

Methylation in Case

 3.62E-02 (Median) Methylation in Control 2.15E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of ABCB7 in bladder cancer [ 2 ]

Location

 TSS200 (cg27419400)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 5.98E-03; Z-score: 2.52E+00

Methylation in Case

 7.14E-02 (Median) Methylation in Control 5.69E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of ABCB7 in bladder cancer [ 2 ]

Location

 TSS200 (cg11340371)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 4.15E-02; Z-score: -5.84E-01

Methylation in Case

 5.99E-02 (Median) Methylation in Control 6.82E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of ABCB7 in bladder cancer [ 2 ]

Location

 1stExon (cg19855812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 5.74E-03; Z-score: 6.96E-01

Methylation in Case

 2.27E-02 (Median) Methylation in Control 1.83E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of ABCB7 in bladder cancer [ 2 ]

Location

 1stExon (cg23279136)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 7.10E-03; Z-score: 2.44E+00

Methylation in Case

 5.09E-02 (Median) Methylation in Control 4.61E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of ABCB7 in bladder cancer [ 2 ]

Location

 Body (cg20972834)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.37E-02; Z-score: 2.23E-01

Methylation in Case

 4.33E-02 (Median) Methylation in Control 4.22E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB7 in breast cancer [ 3 ]

Location

 TSS1500 (cg20208052)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.30E+00 Statistic Test p-value: 4.13E-12; Z-score: 2.24E+00

Methylation in Case

 5.77E-01 (Median) Methylation in Control 4.44E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCB7 in breast cancer [ 3 ]

Location

 TSS1500 (cg21131239)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 1.47E-11; Z-score: 2.13E+00

Methylation in Case

 7.11E-01 (Median) Methylation in Control 5.91E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCB7 in breast cancer [ 3 ]

Location

 TSS1500 (cg11337462)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.53E-05; Z-score: -9.79E-01

Methylation in Case

 4.87E-01 (Median) Methylation in Control 5.45E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCB7 in breast cancer [ 3 ]

Location

 TSS200 (cg27419400)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 8.00E-05; Z-score: -9.89E-01

Methylation in Case

 2.21E-01 (Median) Methylation in Control 2.90E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of ABCB7 in breast cancer [ 3 ]

Location

 TSS200 (cg01717812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 1.03E-03; Z-score: -6.38E-01

Methylation in Case

 3.04E-01 (Median) Methylation in Control 3.56E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of ABCB7 in breast cancer [ 3 ]

Location

 TSS200 (cg11340371)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 3.27E-02; Z-score: -6.84E-01

Methylation in Case

 2.54E-01 (Median) Methylation in Control 3.13E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of ABCB7 in breast cancer [ 3 ]

Location

 1stExon (cg23279136)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 4.31E-05; Z-score: 1.19E+00

Methylation in Case

 3.38E-01 (Median) Methylation in Control 2.64E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of ABCB7 in breast cancer [ 3 ]

Location

 Body (cg20972834)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 2.51E-02; Z-score: -5.36E-01

Methylation in Case

 2.97E-01 (Median) Methylation in Control 3.34E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB7 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg21131239)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 4.62E-02; Z-score: 7.68E-01

Methylation in Case

 7.19E-01 (Median) Methylation in Control 6.50E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCB7 in hepatocellular carcinoma [ 4 ]

Location

 TSS200 (cg11340371)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 5.38E-03; Z-score: -1.25E-01

Methylation in Case

 1.07E-01 (Median) Methylation in Control 1.18E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCB7 in hepatocellular carcinoma [ 4 ]

Location

 TSS200 (cg27419400)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.98E-02; Z-score: -4.01E-02

Methylation in Case

 1.03E-01 (Median) Methylation in Control 1.07E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCB7 in hepatocellular carcinoma [ 4 ]

Location

 TSS200 (cg01717812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 4.20E-02; Z-score: 8.32E-03

Methylation in Case

 6.91E-02 (Median) Methylation in Control 6.79E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCB7 in prostate cancer [ 5 ]

Location

 TSS1500 (cg23113963)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 4.53E+00 Statistic Test p-value: 1.82E-02; Z-score: 6.02E+00

Methylation in Case

 4.33E-01 (Median) Methylation in Control 9.56E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCB7 in prostate cancer [ 5 ]

Location

 Body (cg19681897)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.58E-02; Z-score: 2.07E+00

Methylation in Case

 9.55E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          62 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1 directly targets ABCB7 [ 6 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-1 miRNA Mature ID miR-1-3p

miRNA Sequence

 UGGAAUGUAAAGAAGUAUGUAU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

 miR-10a directly targets ABCB7 [ 7 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-10a miRNA Mature ID miR-10a-5p

miRNA Sequence

 UACCCUGUAGAUCCGAAUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-1292 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1292 miRNA Mature ID miR-1292-3p

miRNA Sequence

 UCGCGCCCCGGCUCCCGUUC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 4

 miR-148b directly targets ABCB7 [ 9 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-148b miRNA Mature ID miR-148b-3p

miRNA Sequence

 UCAGUGCAUCACAGAACUUUGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 5

 miR-150 directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-150 miRNA Mature ID miR-150-5p

miRNA Sequence

 UCUCCCAACCCUUGUACCAGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-16 directly targets ABCB7 [ 7 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-17 directly targets ABCB7 [ 7 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-17 miRNA Mature ID miR-17-3p

miRNA Sequence

 ACUGCAGUGAAGGCACUUGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-1827 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1827 miRNA Mature ID miR-1827

miRNA Sequence

 UGAGGCAGUAGAUUGAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-195 directly targets ABCB7 [ 7 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

 UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-25 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-25 miRNA Mature ID miR-25-5p

miRNA Sequence

 AGGCGGAGACUUGGGCAAUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-26a directly targets ABCB7 [ 7 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-26a miRNA Mature ID miR-26a-5p

miRNA Sequence

 UUCAAGUAAUCCAGGAUAGGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-3127 directly targets ABCB7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3127 miRNA Mature ID miR-3127-3p

miRNA Sequence

 UCCCCUUCUGCAGGCCUGCUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-3192 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3192 miRNA Mature ID miR-3192-5p

miRNA Sequence

 UCUGGGAGGUUGUAGCAGUGGAA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 14

 miR-3929 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3929 miRNA Mature ID miR-3929

miRNA Sequence

 GAGGCUGAUGUGAGUAGACCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-4252 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4252 miRNA Mature ID miR-4252

miRNA Sequence

 GGCCACUGAGUCAGCACCA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 16

 miR-4327 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4327 miRNA Mature ID miR-4327

miRNA Sequence

 GGCUUGCAUGGGGGACUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-4478 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4478 miRNA Mature ID miR-4478

miRNA Sequence

 GAGGCUGAGCUGAGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-4495 directly targets ABCB7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4495 miRNA Mature ID miR-4495

miRNA Sequence

 AAUGUAAACAGGCUUUUUGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-4537 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4537 miRNA Mature ID miR-4537

miRNA Sequence

 UGAGCCGAGCUGAGCUUAGCUG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 20

 miR-4649 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4649 miRNA Mature ID miR-4649-3p

miRNA Sequence

 UCUGAGGCCUGCCUCUCCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-4695 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4695 miRNA Mature ID miR-4695-5p

miRNA Sequence

 CAGGAGGCAGUGGGCGAGCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-4722 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-5p

miRNA Sequence

 GGCAGGAGGGCUGUGCCAGGUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-4762 directly targets ABCB7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4762 miRNA Mature ID miR-4762-5p

miRNA Sequence

 CCAAAUCUUGAUCAGAAGCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-4768 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4768 miRNA Mature ID miR-4768-3p

miRNA Sequence

 CCAGGAGAUCCAGAGAGAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-4793 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4793 miRNA Mature ID miR-4793-3p

miRNA Sequence

 UCUGCACUGUGAGUUGGCUGGCU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 26

 miR-485 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

 AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-508 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-508 miRNA Mature ID miR-508-5p

miRNA Sequence

 UACUCCAGAGGGCGUCACUCAUG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 28

 miR-548a directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548a miRNA Mature ID miR-548a-3p

miRNA Sequence

 CAAAACUGGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-548ag directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548ag miRNA Mature ID miR-548ag

miRNA Sequence

 AAAGGUAAUUGUGGUUUCUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-548ai directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548ai miRNA Mature ID miR-548ai

miRNA Sequence

 AAAGGUAAUUGCAGUUUUUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-548ar directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548ar miRNA Mature ID miR-548ar-3p

miRNA Sequence

 UAAAACUGCAGUUAUUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-548az directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548az miRNA Mature ID miR-548az-3p

miRNA Sequence

 AAAAACUGCAAUCACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-548ba directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548ba miRNA Mature ID miR-548ba

miRNA Sequence

 AAAGGUAACUGUGAUUUUUGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-548e directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548e miRNA Mature ID miR-548e-3p

miRNA Sequence

 AAAAACUGAGACUACUUUUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-548f directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548f miRNA Mature ID miR-548f-3p

miRNA Sequence

 AAAAACUGUAAUUACUUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-5582 directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5582 miRNA Mature ID miR-5582-3p

miRNA Sequence

 UAAAACUUUAAGUGUGCCUAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-5692a directly targets ABCB7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5692a miRNA Mature ID miR-5692a

miRNA Sequence

 CAAAUAAUACCACAGUGGGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 38

 miR-570 directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-570 miRNA Mature ID miR-570-5p

miRNA Sequence

 AAAGGUAAUUGCAGUUUUUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-605 directly targets ABCB7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-605 miRNA Mature ID miR-605-5p

miRNA Sequence

 UAAAUCCCAUGGUGCCUUCUCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-6512 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6512 miRNA Mature ID miR-6512-3p

miRNA Sequence

 UUCCAGCCCUUCUAAUGGUAGG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 41

 miR-661 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-661 miRNA Mature ID miR-661

miRNA Sequence

 UGCCUGGGUCUCUGGCCUGCGCGU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 42

 miR-665 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-665 miRNA Mature ID miR-665

miRNA Sequence

 ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 43

 miR-6720 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6720 miRNA Mature ID miR-6720-5p

miRNA Sequence

 UUCCAGCCCUGGUAGGCGCCGCG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 44

 miR-6731 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6731 miRNA Mature ID miR-6731-5p

miRNA Sequence

 UGGGAGAGCAGGGUAUUGUGGA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 45

 miR-6749 directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6749 miRNA Mature ID miR-6749-3p

miRNA Sequence

 CUCCUCCCCUGCCUGGCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 46

 miR-6756 directly targets ABCB7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6756 miRNA Mature ID miR-6756-3p

miRNA Sequence

 UCCCCUUCCUCCCUGCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 47

 miR-6788 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6788 miRNA Mature ID miR-6788-5p

miRNA Sequence

 CUGGGAGAAGAGUGGUGAAGA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 48

 miR-6808 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6808 miRNA Mature ID miR-6808-5p

miRNA Sequence

 CAGGCAGGGAGGUGGGACCAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 49

 miR-6814 directly targets ABCB7 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6814 miRNA Mature ID miR-6814-5p

miRNA Sequence

 UCCCAAGGGUGAGAUGCUGCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 50

 miR-6832 directly targets ABCB7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6832 miRNA Mature ID miR-6832-3p

miRNA Sequence

 ACCCUUUUUCUCUUUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 51

 miR-6840 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6840 miRNA Mature ID miR-6840-3p

miRNA Sequence

 GCCCAGGACUUUGUGCGGGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 52

 miR-6849 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

 ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 53

 miR-6878 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6878 miRNA Mature ID miR-6878-5p

miRNA Sequence

 AGGGAGAAAGCUAGAAGCUGAAG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 54

 miR-6884 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6884 miRNA Mature ID miR-6884-5p

miRNA Sequence

 AGAGGCUGAGAAGGUGAUGUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 55

 miR-6893 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6893 miRNA Mature ID miR-6893-5p

miRNA Sequence

 CAGGCAGGUGUAGGGUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 56

 miR-7160 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7160 miRNA Mature ID miR-7160-5p

miRNA Sequence

 UGCUGAGGUCCGGGCUGUGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 57

 miR-766 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-766 miRNA Mature ID miR-766-3p

miRNA Sequence

 ACUCCAGCCCCACAGCCUCAGC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 58

 miR-7703 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7703 miRNA Mature ID miR-7703

miRNA Sequence

 UUGCACUCUGGCCUUCUCCCAGG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 59

 miR-8085 directly targets ABCB7 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8085 miRNA Mature ID miR-8085

miRNA Sequence

 UGGGAGAGAGGACUGUGAGGC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 60

 miR-888 directly targets ABCB7 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-888 miRNA Mature ID miR-888-5p

miRNA Sequence

 UACUCAAAAAGCUGUCAGUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 61

 miR-935 directly targets ABCB7 [ 7 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-935 miRNA Mature ID miR-935

miRNA Sequence

 CCAGUUACCGCUUCCGCUACCGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 62

 miR-940 directly targets ABCB7 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-940 miRNA Mature ID miR-940

miRNA Sequence

 AAGGCAGGGCCCCCGCUCCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
6 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
7 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
8 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
9 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
10 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
11 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
12 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.