General Information of Drug Transporter (DT)
DT ID DTD0054 Transporter Info
Gene Name ABCB8
Transporter Name ATP-binding cassette sub-family B member 8
Gene ID
11194
UniProt ID
Q9NUT2
Epigenetic Regulations of This DT (EGR)

Methylation

  Renal cell carcinoma

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in clear cell renal cell carcinoma [ 1 ]

Location

TSS1500 (cg20456055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.20E+00 Statistic Test p-value: 4.24E-04; Z-score: 8.92E-01

Methylation in Case

2.01E-02 (Median) Methylation in Control 1.67E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of ABCB8 in clear cell renal cell carcinoma [ 1 ]

Location

TSS200 (cg05429359)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.25E+00 Statistic Test p-value: 1.12E-10; Z-score: -1.16E+00

Methylation in Case

8.81E-02 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of ABCB8 in clear cell renal cell carcinoma [ 1 ]

Location

TSS200 (cg20798412)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.30E+00 Statistic Test p-value: 2.75E-07; Z-score: 1.38E+00

Methylation in Case

1.30E-02 (Median) Methylation in Control 1.00E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of ABCB8 in clear cell renal cell carcinoma [ 1 ]

Location

TSS200 (cg15447715)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.36E+00 Statistic Test p-value: 4.36E-04; Z-score: -4.88E-01

Methylation in Case

3.77E-02 (Median) Methylation in Control 5.12E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of ABCB8 in clear cell renal cell carcinoma [ 1 ]

Location

TSS200 (cg02615599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.12E+00 Statistic Test p-value: 2.15E-02; Z-score: -3.71E-01

Methylation in Case

7.98E-02 (Median) Methylation in Control 8.97E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of ABCB8 in clear cell renal cell carcinoma [ 1 ]

Location

Body (cg09884940)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 1.32E-04; Z-score: -9.27E-01

Methylation in Case

9.66E-01 (Median) Methylation in Control 9.72E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of ABCB8 in clear cell renal cell carcinoma [ 1 ]

Location

Body (cg01166674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.13E+00 Statistic Test p-value: 9.18E-04; Z-score: 7.73E-01

Methylation in Case

2.60E-02 (Median) Methylation in Control 2.31E-02 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of ABCB8 in clear cell renal cell carcinoma [ 1 ]

Location

Body (cg00139389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 1.43E-02; Z-score: -3.53E-01

Methylation in Case

9.80E-01 (Median) Methylation in Control 9.80E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of ABCB8 in clear cell renal cell carcinoma [ 1 ]

Location

Body (cg11367539)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 1.64E-02; Z-score: -5.39E-01

Methylation in Case

9.76E-01 (Median) Methylation in Control 9.78E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Colon cancer

           9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in colon adenocarcinoma [ 2 ]

Location

TSS1500 (cg21923525)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.29E+00 Statistic Test p-value: 6.94E-07; Z-score: -5.59E+00

Methylation in Case

5.71E-01 (Median) Methylation in Control 7.35E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of ABCB8 in colon adenocarcinoma [ 2 ]

Location

TSS1500 (cg18194306)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.58E+00 Statistic Test p-value: 3.95E-05; Z-score: 1.75E+00

Methylation in Case

4.66E-01 (Median) Methylation in Control 2.94E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of ABCB8 in colon adenocarcinoma [ 2 ]

Location

Body (cg19377250)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.71E+00 Statistic Test p-value: 1.90E-08; Z-score: -1.09E+01

Methylation in Case

4.61E-01 (Median) Methylation in Control 7.90E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of ABCB8 in colon adenocarcinoma [ 2 ]

Location

Body (cg20949198)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.23E+00 Statistic Test p-value: 1.02E-04; Z-score: -2.78E+00

Methylation in Case

6.87E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of ABCB8 in colon adenocarcinoma [ 2 ]

Location

Body (cg01347553)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.26E+00 Statistic Test p-value: 1.80E-04; Z-score: -9.38E-01

Methylation in Case

2.36E-01 (Median) Methylation in Control 2.96E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of ABCB8 in colon adenocarcinoma [ 2 ]

Location

Body (cg11224188)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 2.14E-03; Z-score: -2.47E+00

Methylation in Case

6.54E-01 (Median) Methylation in Control 6.99E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of ABCB8 in colon adenocarcinoma [ 2 ]

Location

Body (cg25232795)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 3.25E-03; Z-score: 4.42E-01

Methylation in Case

7.72E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of ABCB8 in colon adenocarcinoma [ 2 ]

Location

3'UTR (cg05548393)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.16E+00 Statistic Test p-value: 1.00E-04; Z-score: -5.14E+00

Methylation in Case

6.79E-01 (Median) Methylation in Control 7.90E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 9

Methylation of ABCB8 in colon adenocarcinoma [ 2 ]

Location

3'UTR (cg07737682)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.09E+00 Statistic Test p-value: 2.39E-03; Z-score: -2.06E+00

Methylation in Case

6.63E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in colorectal cancer [ 3 ]

Location

TSS1500 (cg18541211)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.10E+00 Statistic Test p-value: 2.88E-02; Z-score: -4.44E-01

Methylation in Case

1.27E-01 (Median) Methylation in Control 1.39E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of ABCB8 in colorectal cancer [ 3 ]

Location

Body (cg21964637)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.01E+00 Statistic Test p-value: 6.79E-04; Z-score: 5.50E-01

Methylation in Case

9.39E-01 (Median) Methylation in Control 9.30E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of ABCB8 in colorectal cancer [ 3 ]

Location

Body (cg23160428)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 1.52E-03; Z-score: -9.90E-01

Methylation in Case

9.04E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of ABCB8 in colorectal cancer [ 3 ]

Location

Body (cg09884940)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 4.04E-03; Z-score: -6.09E-02

Methylation in Case

9.51E-01 (Median) Methylation in Control 9.51E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of ABCB8 in colorectal cancer [ 3 ]

Location

Body (cg17112266)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.07E+00 Statistic Test p-value: 8.56E-03; Z-score: -7.19E-01

Methylation in Case

7.35E-01 (Median) Methylation in Control 7.84E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of ABCB8 in colorectal cancer [ 3 ]

Location

Body (cg11367539)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 1.40E-02; Z-score: -3.22E-01

Methylation in Case

9.48E-01 (Median) Methylation in Control 9.50E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of ABCB8 in colorectal cancer [ 3 ]

Location

Body (cg02501120)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.14E+00 Statistic Test p-value: 1.57E-02; Z-score: -5.76E-01

Methylation in Case

8.08E-02 (Median) Methylation in Control 9.18E-02 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Depression

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in depression [ 4 ]

Location

TSS1500 (cg18541211)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 3.86E-02; Z-score: -2.90E-01

Methylation in Case

6.06E-02 (Median) Methylation in Control 6.35E-02 (Median)

Studied Phenotype

Depression [ ICD-11: 6A8Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of ABCB8 in depression [ 4 ]

Location

Body (cg01166674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.03E+00 Statistic Test p-value: 2.75E-02; Z-score: 3.91E-01

Methylation in Case

5.58E-02 (Median) Methylation in Control 5.40E-02 (Median)

Studied Phenotype

Depression [ ICD-11: 6A8Z]

Experimental Material

Patient tissue samples

  HIV infection

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in HIV infection [ 5 ]

Location

TSS1500 (cg20456055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 4.79E-02; Z-score: -4.41E-01

Methylation in Case

5.28E-02 (Median) Methylation in Control 5.68E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of ABCB8 in HIV infection [ 5 ]

Location

Body (cg17112266)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.40E+00 Statistic Test p-value: 2.46E-07; Z-score: 3.25E+00

Methylation in Case

5.43E-01 (Median) Methylation in Control 3.87E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of ABCB8 in HIV infection [ 5 ]

Location

Body (cg26175729)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.06E+00 Statistic Test p-value: 3.61E-04; Z-score: 8.14E-01

Methylation in Case

7.88E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of ABCB8 in HIV infection [ 5 ]

Location

Body (cg02501120)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.31E+00 Statistic Test p-value: 1.05E-02; Z-score: 1.04E+00

Methylation in Case

8.54E-02 (Median) Methylation in Control 6.54E-02 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of ABCB8 in HIV infection [ 5 ]

Location

Body (cg23160428)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.01E+00 Statistic Test p-value: 1.69E-02; Z-score: 3.49E-01

Methylation in Case

8.86E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of ABCB8 in HIV infection [ 5 ]

Location

Body (cg19414780)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.01E+00 Statistic Test p-value: 4.39E-02; Z-score: 4.33E-01

Methylation in Case

9.24E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of ABCB8 in HIV infection [ 5 ]

Location

3'UTR (cg09330923)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 4.54E-03; Z-score: -1.25E+00

Methylation in Case

8.82E-01 (Median) Methylation in Control 9.08E-01 (Median)

Studied Phenotype

HIV infection [ ICD-11: 1C62.Z]

Experimental Material

Patient tissue samples

  Papillary thyroid cancer

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in papillary thyroid cancer [ 6 ]

Location

TSS1500 (cg20456055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.03E+00 Statistic Test p-value: 3.41E-02; Z-score: 2.65E-01

Methylation in Case

5.36E-02 (Median) Methylation in Control 5.20E-02 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of ABCB8 in papillary thyroid cancer [ 6 ]

Location

Body (cg17112266)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.25E+00 Statistic Test p-value: 2.39E-11; Z-score: -2.24E+00

Methylation in Case

5.19E-01 (Median) Methylation in Control 6.47E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of ABCB8 in papillary thyroid cancer [ 6 ]

Location

Body (cg02501120)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.39E+00 Statistic Test p-value: 9.15E-10; Z-score: -1.36E+00

Methylation in Case

5.03E-02 (Median) Methylation in Control 6.98E-02 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of ABCB8 in papillary thyroid cancer [ 6 ]

Location

Body (cg21964637)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 2.95E-02; Z-score: -3.35E-01

Methylation in Case

9.31E-01 (Median) Methylation in Control 9.35E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of ABCB8 in papillary thyroid cancer [ 6 ]

Location

3'UTR (cg09330923)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.06E+00 Statistic Test p-value: 8.48E-04; Z-score: 1.26E+00

Methylation in Case

9.30E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in systemic lupus erythematosus [ 7 ]

Location

TSS1500 (cg20456055)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 2.24E-02; Z-score: -1.67E-01

Methylation in Case

7.25E-02 (Median) Methylation in Control 7.45E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of ABCB8 in systemic lupus erythematosus [ 7 ]

Location

TSS200 (cg20798412)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 2.13E-03; Z-score: -2.03E-01

Methylation in Case

5.97E-02 (Median) Methylation in Control 6.23E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of ABCB8 in systemic lupus erythematosus [ 7 ]

Location

TSS200 (cg12500498)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.04E+00 Statistic Test p-value: 4.64E-03; Z-score: -1.72E-01

Methylation in Case

7.32E-02 (Median) Methylation in Control 7.61E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of ABCB8 in systemic lupus erythematosus [ 7 ]

Location

TSS200 (cg07222181)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 8.54E-03; Z-score: -2.73E-01

Methylation in Case

6.64E-02 (Median) Methylation in Control 6.98E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of ABCB8 in systemic lupus erythematosus [ 7 ]

Location

Body (cg01166674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 3.66E-03; Z-score: -1.90E-01

Methylation in Case

8.48E-02 (Median) Methylation in Control 8.76E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of ABCB8 in systemic lupus erythematosus [ 7 ]

Location

Body (cg26175729)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 1.31E-02; Z-score: -2.43E-01

Methylation in Case

7.34E-01 (Median) Methylation in Control 7.49E-01 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of ABCB8 in systemic lupus erythematosus [ 7 ]

Location

Body (cg13396382)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.03E+00 Statistic Test p-value: 3.80E-02; Z-score: -1.30E-01

Methylation in Case

7.41E-02 (Median) Methylation in Control 7.63E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Breast cancer

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in breast cancer [ 8 ]

Location

TSS200 (cg02615599)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.06E+00 Statistic Test p-value: 4.07E-02; Z-score: 2.87E-01

Methylation in Case

1.65E-01 (Median) Methylation in Control 1.55E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of ABCB8 in breast cancer [ 8 ]

Location

Body (cg26175729)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.42E+00 Statistic Test p-value: 3.20E-04; Z-score: 1.20E+00

Methylation in Case

2.40E-01 (Median) Methylation in Control 1.68E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of ABCB8 in breast cancer [ 8 ]

Location

Body (cg23160428)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 3.53E-04; Z-score: 7.73E-01

Methylation in Case

8.01E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of ABCB8 in breast cancer [ 8 ]

Location

Body (cg17112266)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.09E+00 Statistic Test p-value: 1.06E-03; Z-score: 6.33E-01

Methylation in Case

5.03E-01 (Median) Methylation in Control 4.62E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of ABCB8 in breast cancer [ 8 ]

Location

Body (cg13396382)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.14E+00 Statistic Test p-value: 2.02E-02; Z-score: -4.66E-01

Methylation in Case

5.23E-02 (Median) Methylation in Control 5.94E-02 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of ABCB8 in breast cancer [ 8 ]

Location

3'UTR (cg09330923)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 3.03E-03; Z-score: -2.56E-01

Methylation in Case

8.49E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in pancretic ductal adenocarcinoma [ 9 ]

Location

TSS200 (cg21041514)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.13E+00 Statistic Test p-value: 6.95E-05; Z-score: -7.07E-01

Methylation in Case

9.14E-02 (Median) Methylation in Control 1.03E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of ABCB8 in pancretic ductal adenocarcinoma [ 9 ]

Location

Body (cg02043000)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.20E+00 Statistic Test p-value: 9.46E-06; Z-score: -1.01E+00

Methylation in Case

4.30E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of ABCB8 in pancretic ductal adenocarcinoma [ 9 ]

Location

Body (cg23013931)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.11E+00 Statistic Test p-value: 3.89E-04; Z-score: -5.63E-01

Methylation in Case

9.87E-02 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of ABCB8 in pancretic ductal adenocarcinoma [ 9 ]

Location

Body (cg09672032)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.03E+00 Statistic Test p-value: 6.38E-03; Z-score: 3.30E-01

Methylation in Case

8.32E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of ABCB8 in pancretic ductal adenocarcinoma [ 9 ]

Location

3'UTR (cg07658508)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.13E+00 Statistic Test p-value: 7.75E-06; Z-score: -1.12E+00

Methylation in Case

7.37E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of ABCB8 in pancretic ductal adenocarcinoma [ 9 ]

Location

3'UTR (cg10841077)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.00E+00 Statistic Test p-value: 1.89E-02; Z-score: -2.34E-01

Methylation in Case

9.15E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Atypical teratoid rhabdoid tumor

           8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg00139389)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.11E+00 Statistic Test p-value: 1.78E-05; Z-score: 1.51E+00

Methylation in Case

8.19E-01 (Median) Methylation in Control 7.38E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of ABCB8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg00373422)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.06E+00 Statistic Test p-value: 2.30E-05; Z-score: -9.44E-01

Methylation in Case

8.11E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of ABCB8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg01166674)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.45E+00 Statistic Test p-value: 5.15E-05; Z-score: -7.50E-01

Methylation in Case

2.26E-01 (Median) Methylation in Control 3.27E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of ABCB8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg02501120)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.19E+00 Statistic Test p-value: 1.71E-04; Z-score: 7.78E-01

Methylation in Case

3.92E-01 (Median) Methylation in Control 3.30E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of ABCB8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg09884940)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 2.17E+00 Statistic Test p-value: 1.23E-02; Z-score: 8.24E-01

Methylation in Case

2.77E-01 (Median) Methylation in Control 1.27E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of ABCB8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg11367539)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 2.19E-02; Z-score: -3.71E-01

Methylation in Case

9.34E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of ABCB8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

Body (cg13396382)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.03E+00 Statistic Test p-value: 3.58E-02; Z-score: 1.33E-01

Methylation in Case

9.10E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 8

Methylation of ABCB8 in atypical teratoid rhabdoid tumor [ 10 ]

Location

3'UTR (cg09330923)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.29E+00 Statistic Test p-value: 1.28E-12; Z-score: -2.35E+00

Methylation in Case

5.74E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

Patient tissue samples

  Bladder cancer

           7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in bladder cancer [ 11 ]

Location

Body (cg22134611)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.22E+00 Statistic Test p-value: 1.76E-05; Z-score: -6.07E+00

Methylation in Case

6.64E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of ABCB8 in bladder cancer [ 11 ]

Location

Body (cg17112266)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.30E+00 Statistic Test p-value: 6.17E-05; Z-score: -8.04E+00

Methylation in Case

3.59E-01 (Median) Methylation in Control 4.68E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of ABCB8 in bladder cancer [ 11 ]

Location

Body (cg02501120)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.15E+00 Statistic Test p-value: 1.23E-02; Z-score: -1.16E+00

Methylation in Case

4.60E-02 (Median) Methylation in Control 5.28E-02 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of ABCB8 in bladder cancer [ 11 ]

Location

Body (cg00373422)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 2.11E-02; Z-score: -6.50E-01

Methylation in Case

8.42E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of ABCB8 in bladder cancer [ 11 ]

Location

Body (cg13396382)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.09E+00 Statistic Test p-value: 3.12E-02; Z-score: -1.34E+00

Methylation in Case

6.07E-02 (Median) Methylation in Control 6.64E-02 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 6

Methylation of ABCB8 in bladder cancer [ 11 ]

Location

Body (cg11367539)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 4.34E-02; Z-score: -8.40E-01

Methylation in Case

8.85E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 7

Methylation of ABCB8 in bladder cancer [ 11 ]

Location

3'UTR (cg09330923)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.10E+00 Statistic Test p-value: 3.95E-04; Z-score: 2.83E+00

Methylation in Case

8.59E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in hepatocellular carcinoma [ 12 ]

Location

Body (cg22134611)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.02E+00 Statistic Test p-value: 1.59E-04; Z-score: -9.35E-01

Methylation in Case

8.26E-01 (Median) Methylation in Control 8.42E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of ABCB8 in hepatocellular carcinoma [ 12 ]

Location

Body (cg26175729)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.25E+00 Statistic Test p-value: 5.81E-04; Z-score: -1.20E+00

Methylation in Case

3.09E-01 (Median) Methylation in Control 3.86E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of ABCB8 in hepatocellular carcinoma [ 12 ]

Location

Body (cg02501120)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.32E+00 Statistic Test p-value: 8.71E-04; Z-score: -8.57E-01

Methylation in Case

6.62E-02 (Median) Methylation in Control 8.74E-02 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 4

Methylation of ABCB8 in hepatocellular carcinoma [ 12 ]

Location

Body (cg23160428)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 1.76E-03; Z-score: -5.55E-01

Methylation in Case

8.05E-01 (Median) Methylation in Control 8.13E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 5

Methylation of ABCB8 in hepatocellular carcinoma [ 12 ]

Location

Body (cg17112266)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.05E+00 Statistic Test p-value: 1.03E-02; Z-score: 6.12E-01

Methylation in Case

5.79E-01 (Median) Methylation in Control 5.52E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Panic disorder

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of ABCB8 in panic disorder [ 13 ]

Location

Body (cg23160428)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.04E+00 Statistic Test p-value: 2.10E-02; Z-score: 2.30E-01

Methylation in Case

2.31E+00 (Median) Methylation in Control 2.22E+00 (Median)

Studied Phenotype

Panic disorder [ ICD-11: 6B01]

Experimental Material

Patient tissue samples

microRNA

  Unclear Phenotype

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

let-7b directly targets ABCB8 [ 14 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)
References
1 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
2 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
8 Genome-wide Scan for Methylation Profiles in Breast Cancer
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 DNA Methylation Dynamics in Urological Tumors.
12 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.