Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0057 Transporter Info | ||||
| Gene Name | ABCC11 | ||||
| Transporter Name | Multidrug resistance-associated protein 8 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Histone acetylation |
|||||
|
Acute myeloid leukemia |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypoacetylation of ABCB11 in acute myeloid leukemia (compare with valproate treatment counterpart cells) | [ 1 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes |
Up regulation of ABCC11 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Acute myeloid leukemia [ ICD-11: 2A60] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
Chromatin immunoprecipitation revealed the hyperacetylation of histone proteins in the promoter regions of MDR1, BCRP, and MRP8 on valproate treatment. | ||||
|
Epigenetic Phenomenon 2 |
Hypoacetylation of ABCB11 in acute myeloid leukemia (compare with valproate treatment counterpart cells) | [ 1 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes |
Up regulation of ABCC11 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Acute myeloid leukemia [ ICD-11: 2A60] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
Chromatin immunoprecipitation revealed the hyperacetylation of histone proteins in the promoter regions of MDR1, BCRP, and MRP8 on valproate treatment. | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
hsa-miR-1291 directly targets ABCC1 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes |
Down regulation of ABCC1 | Experiment Method | Western Blot | ||
|
miRNA Stemloop ID |
miR-1291 | miRNA Mature ID | miR-1291 | ||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human pancreatic carcinoma cell line (PANC-1) | ||||
|
Additional Notes |
Overexpression of hsa-miR-1291 led to a reduced ABCC1 protein expression in hsa-miR-1291 stably transfected cells. | ||||
|
Epigenetic Phenomenon 2 |
miR-335 directly targets ABCC11 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Methylation |
|||||
|
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of ABCC11 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000575537; Fold-change: -0.45872133; Z-score: -10.6961536 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of ABCC11 in prostate cancer than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer [ICD-11:2C82] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000551072; Fold-change: -0.377007279; Z-score: -2.612870252 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples