Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0063 Transporter Info | ||||
| Gene Name | ABCD1 | ||||
| Transporter Name | Adrenoleukodystrophy protein | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Pancretic ductal adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCD1 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg23649004) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.00E-04; Z-score: 2.72E-01 | ||
|
Methylation in Case |
8.22E-02 (Median) | Methylation in Control | 7.64E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCD1 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg22534545) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 5.28E-07; Z-score: -1.11E+01 | ||
|
Methylation in Case |
5.92E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCD1 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg02772106) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.78E+00 | Statistic Test | p-value: 1.36E-03; Z-score: 7.22E+00 | ||
|
Methylation in Case |
2.16E-01 (Median) | Methylation in Control | 1.21E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCD1 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg22534545) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 1.38E-03; Z-score: -1.04E+00 | ||
|
Methylation in Case |
6.98E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCD1 in colorectal cancer | [ 4 ] | |||
|
Location |
Body (cg22534545) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.91E-02; Z-score: -4.95E-01 | ||
|
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 8.53E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCD1 in colorectal cancer | [ 4 ] | |||
|
Location |
3'UTR (cg27024381) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.06E-04; Z-score: -1.25E+00 | ||
|
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 7.15E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of ABCD1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg22534545) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.15E-04; Z-score: -6.24E-01 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of ABCD1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
3'UTR (cg27024381) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 4.61E-06; Z-score: -1.68E+00 | ||
|
Methylation in Case |
4.20E-01 (Median) | Methylation in Control | 4.85E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-23a directly targets ABCD1 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-23a | miRNA Mature ID | miR-23a-3p | ||
|
miRNA Sequence |
AUCACAUUGCCAGGGAUUUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 2 |
miR-26b directly targets ABCD1 | [ 7 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
|
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon 3 |
miR-615 directly targets ABCD1 | [ 6 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-615 | miRNA Mature ID | miR-615-3p | ||
|
miRNA Sequence |
UCCGAGCCUGGGUCUCCCUCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 4 |
miR-96 directly targets ABCD1 | [ 8 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-96 | miRNA Mature ID | miR-96-5p | ||
|
miRNA Sequence |
UUUGGCACUAGCACAUUUUUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human ovarian carcinoma cell line (SKOV3) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.