Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0064 Transporter Info
Gene Name ABCD2
Transporter Name Adrenoleukodystrophy-like 1
Gene ID
225
UniProt ID
Q9UBJ2
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD2 in bladder cancer [ 1 ]

Location

 TSS1500 (cg26980789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.60E+00 Statistic Test p-value: 2.25E-04; Z-score: -3.07E+00

Methylation in Case

 7.29E-02 (Median) Methylation in Control 1.16E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD2 in breast cancer [ 2 ]

Location

 TSS1500 (cg26980789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 5.91E-04; Z-score: -8.22E-01

Methylation in Case

 8.00E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD2 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg15876417)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.70E+00 Statistic Test p-value: 2.05E-05; Z-score: -1.49E+00

Methylation in Case

 1.27E-01 (Median) Methylation in Control 2.16E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCD2 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg26980789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.17E-02; Z-score: 6.71E-02

Methylation in Case

 1.66E-01 (Median) Methylation in Control 1.63E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCD2 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg08424219)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 3.95E-02; Z-score: -1.37E-01

Methylation in Case

 1.66E-01 (Median) Methylation in Control 1.77E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of ABCD2 in colorectal cancer [ 3 ]

Location

 Body (cg13406085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 6.53E-11; Z-score: -3.98E+00

Methylation in Case

 6.88E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD2 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg26980789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 1.19E-04; Z-score: -7.69E-01

Methylation in Case

 1.01E-01 (Median) Methylation in Control 1.26E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCD2 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg06527919)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 2.04E-10; Z-score: -2.12E+00

Methylation in Case

 5.16E-01 (Median) Methylation in Control 7.41E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of ABCD2 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg13406085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 8.23E-06; Z-score: -1.34E+00

Methylation in Case

 5.73E-01 (Median) Methylation in Control 6.77E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD2 in lung adenocarcinoma [ 5 ]

Location

 TSS1500 (cg26980789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.46E+00 Statistic Test p-value: 3.82E-04; Z-score: -1.80E+00

Methylation in Case

 1.50E-01 (Median) Methylation in Control 2.19E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCD2 in lung adenocarcinoma [ 5 ]

Location

 TSS1500 (cg08424219)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 4.00E-02; Z-score: -8.60E-01

Methylation in Case

 1.11E-01 (Median) Methylation in Control 1.32E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD2 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg26980789)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 3.84E-02; Z-score: -5.98E-01

Methylation in Case

 3.57E-01 (Median) Methylation in Control 4.02E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD2 in panic disorder [ 7 ]

Location

 TSS200 (cg27288424)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -9.15E-01 Statistic Test p-value: 3.65E-02; Z-score: -5.04E-01

Methylation in Case

 -1.78E+00 (Median) Methylation in Control -1.63E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD2 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg07045469)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 2.14E-05; Z-score: 1.49E+00

Methylation in Case

 7.93E-01 (Median) Methylation in Control 6.79E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of ABCD2 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg03358588)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 3.62E-02; Z-score: 7.23E-01

Methylation in Case

 6.23E-01 (Median) Methylation in Control 5.60E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          33 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1208 directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1208 miRNA Mature ID miR-1208

miRNA Sequence

 UCACUGUUCAGACAGGCGGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-1257 directly targets ABCD2 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1257 miRNA Mature ID miR-1257

miRNA Sequence

 AGUGAAUGAUGGGUUCUGACC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-130a directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-130a miRNA Mature ID miR-130a-3p

miRNA Sequence

 CAGUGCAAUGUUAAAAGGGCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-130b directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-130b miRNA Mature ID miR-130b-3p

miRNA Sequence

 CAGUGCAAUGAUGAAAGGGCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-15b directly targets ABCD2 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-15b miRNA Mature ID miR-15b-3p

miRNA Sequence

 CGAAUCAUUAUUUGCUGCUCUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-301a directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-301a miRNA Mature ID miR-301a-3p

miRNA Sequence

 CAGUGCAAUAGUAUUGUCAAAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-301b directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-301b miRNA Mature ID miR-301b-3p

miRNA Sequence

 CAGUGCAAUGAUAUUGUCAAAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-3074 directly targets ABCD2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3074 miRNA Mature ID miR-3074-5p

miRNA Sequence

 GUUCCUGCUGAACUGAGCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-3117 directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3117 miRNA Mature ID miR-3117-3p

miRNA Sequence

 AUAGGACUCAUAUAGUGCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-3169 directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3169 miRNA Mature ID miR-3169

miRNA Sequence

 UAGGACUGUGCUUGGCACAUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-3666 directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3666 miRNA Mature ID miR-3666

miRNA Sequence

 CAGUGCAAGUGUAGAUGCCGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-411 directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-411 miRNA Mature ID miR-411-5p

miRNA Sequence

 UAGUAGACCGUAUAGCGUACG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-4263 directly targets ABCD2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4263 miRNA Mature ID miR-4263

miRNA Sequence

 AUUCUAAGUGCCUUGGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-4267 directly targets ABCD2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4267 miRNA Mature ID miR-4267

miRNA Sequence

 UCCAGCUCGGUGGCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-4276 directly targets ABCD2 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4276 miRNA Mature ID miR-4276

miRNA Sequence

 CUCAGUGACUCAUGUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-4295 directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4295 miRNA Mature ID miR-4295

miRNA Sequence

 CAGUGCAAUGUUUUCCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-454 directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-454 miRNA Mature ID miR-454-3p

miRNA Sequence

 UAGUGCAAUAUUGCUUAUAGGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 18

 miR-4671 directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4671 miRNA Mature ID miR-4671-3p

miRNA Sequence

 UUAGUGCAUAGUCUUUGGUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 19

 miR-4699 directly targets ABCD2 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4699 miRNA Mature ID miR-4699-3p

miRNA Sequence

 AAUUUACUCUGCAAUCUUCUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 20

 miR-4722 directly targets ABCD2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

 ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-4724 directly targets ABCD2 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4724 miRNA Mature ID miR-4724-5p

miRNA Sequence

 AACUGAACCAGGAGUGAGCUUCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-4759 directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4759 miRNA Mature ID miR-4759

miRNA Sequence

 UAGGACUAGAUGUUGGAAUUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 23

 miR-5003 directly targets ABCD2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5003 miRNA Mature ID miR-5003-3p

miRNA Sequence

 UACUUUUCUAGGUUGUUGGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-5094 directly targets ABCD2 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5094 miRNA Mature ID miR-5094

miRNA Sequence

 AAUCAGUGAAUGCCUUGAACCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 25

 miR-5187 directly targets ABCD2 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5187 miRNA Mature ID miR-5187-3p

miRNA Sequence

 ACUGAAUCCUCUUUUCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 26

 miR-5190 directly targets ABCD2 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5190 miRNA Mature ID miR-5190

miRNA Sequence

 CCAGUGACUGAGCUGGAGCCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 27

 miR-5586 directly targets ABCD2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5586 miRNA Mature ID miR-5586-5p

miRNA Sequence

 UAUCCAGCUUGUUACUAUAUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-576 directly targets ABCD2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-576 miRNA Mature ID miR-576-5p

miRNA Sequence

 AUUCUAAUUUCUCCACGUCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-605 directly targets ABCD2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-605 miRNA Mature ID miR-605-5p

miRNA Sequence

 UAAAUCCCAUGGUGCCUUCUCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-627 directly targets ABCD2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-627 miRNA Mature ID miR-627-3p

miRNA Sequence

 UCUUUUCUUUGAGACUCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-6727 directly targets ABCD2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

 UCCUGCCACCUCCUCCGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-6747 directly targets ABCD2 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

 UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-8083 directly targets ABCD2 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-8083 miRNA Mature ID miR-8083

miRNA Sequence

 CAGGACUUGACGGCUGCAACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
10 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
11 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.