Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0065 Transporter Info
Gene Name ABCD3
Transporter Name ATP-binding cassette sub-family D member 3
Gene ID
5825
UniProt ID
P28288
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg12099423)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 7.26E-09; Z-score: 1.61E+00

Methylation in Case

 6.95E-01 (Median) Methylation in Control 6.03E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD3 in breast cancer [ 2 ]

Location

 3'UTR (cg11689700)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.52E-05; Z-score: -9.97E-01

Methylation in Case

 8.08E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD3 in colorectal cancer [ 3 ]

Location

 3'UTR (cg11689700)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 8.01E-04; Z-score: 7.53E-01

Methylation in Case

 8.65E-01 (Median) Methylation in Control 8.11E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of ABCD3 in panic disorder [ 4 ]

Location

 3'UTR (cg11689700)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -7.09E-01 Statistic Test p-value: 7.96E-04; Z-score: -3.04E-01

Methylation in Case

 -5.13E-01 (Median) Methylation in Control -3.64E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-21 directly targets ABCD3 [ 5 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-21 miRNA Mature ID miR-21-5p

miRNA Sequence

 UAGCUUAUCAGACUGAUGUUGA

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
5 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.