Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0071 Transporter Info
Gene Name ABCG1
Transporter Name ATP-binding cassette sub-family G member 1
Gene ID
9619
UniProt ID
P45844
Epigenetic Regulations of This DT (EGR)

microRNA

  Ischemic stroke

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Higher expression of miR-23a-5p in acute ischemic stroke [ 2 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

 Down regulation of ABCG1 Experiment Method RT-qPCR

miRNA Stemloop ID

 miR-23a miRNA Mature ID miR-23a-5p

miRNA Sequence

 GGGGUUCCUGGGGAUGGGAUUU

miRNA Target Type

 Direct

Studied Phenotype

 Ischemic stroke [ ICD-11: 8B11]

Experimental Material

 Patient tissue samples

Additional Notes

 miR-23a-5p regulates cholesterol efflux in ABCG1-dependent pathway and miR-23a-5p might be a potential therapeutic target for suppressing atherosclerosis.

  Gastric cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-129-5p downregulates of ABCG1 in gastric cancer [ 3 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

 Down regulation of ABCG1 Experiment Method Western Blot

miRNA Stemloop ID

 miR-129 miRNA Mature ID miR-129-5p

miRNA Sequence

 CUUUUUGCGGUCUGGGCUUGC

miRNA Target Type

 Direct

Studied Phenotype

 Gastric cancer [ ICD-11: 2B72]

Experimental Material

 Human gastric adenocarcinoma cell line (SGC7901)

Additional Notes

 miR-129-5p regulates ABCG1 expression in vivo at the post-transcriptional level.

  Unclear Phenotype

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-10b directly targets RALBP1 [ 6 ]

Epigenetic Type

 microRNA Experiment Method miRNA Microarray Analysis

miRNA Stemloop ID

 miR-10b miRNA Mature ID miR-10b-5p

miRNA Sequence

 UACCCUGUAGAACCGAAUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-129 directly targets ABCG1 [ 3 ]

Epigenetic Type

 microRNA Experiment Method Immunohistochemistry//Luciferase reporter assay//Microarray//qRT-PCR//Western blot

miRNA Stemloop ID

 miR-129 miRNA Mature ID miR-129-5p

miRNA Sequence

 CUUUUUGCGGUCUGGGCUUGC

miRNA Target Type

 Direct

Experimental Material

 Human gastric adenocarcinoma cell line (SGC7901)

Methylation

  Coronary heart disease

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of ABCG1 in coronary heart disease [ 1 ]

Location

 Promoter (cg06500161)

Epigenetic Type

 Methylation Experiment Method HumanMethylation450 BeadChip

Related Molecular Changes

 Down regulation of ABCG1 Experiment Method RT-qPCR

Studied Phenotype

 Coronary heart disease [ ICD-11: BA80.Z]

Experimental Material

 Patient tissue samples

Additional Notes

 ABCG1 methylation (cg06500161) was negatively associated with ABCG1 mRNA levels.

  Epigenetic Phenomenon 2

 Hypermethylation of ABCG1 in coronary heart disease [ 4 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Methylation-specific PCR

Studied Phenotype

 Coronary heart disease [ ICD-11: BA80.Z]

Frequency

 52 (61%) out of the 85 studied sample

Experimental Material

 Patient tissue samples

Additional Notes

 Promoter DNA Hypermethylation of the ABCG1 is associated with an increased risk of CHD (p<0.001).

  Type 2 diabetes

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of ABCG1 in type 2 diabetes [ 5 ]

Location

 Promoter (cg06500161)

Epigenetic Type

 Methylation Experiment Method .

Studied Phenotype

 Type 2 diabetes [ ICD-11: 5A11]

Frequency

 58% of the studied samples

Experimental Material

 Patient tissue samples

Additional Notes

 Increase risk for future type 2 diabetes
References
1 DNA methylation of lipid-related genes affects blood lipid levels. Circ Cardiovasc Genet. 2015 Apr;8(2):334-42.
2 MicroRNA-23a-5p promotes atherosclerotic plaque progression and vulnerability by repressing ATP-binding cassette transporter A1/G1 in macrophages. J Mol Cell Cardiol. 2018 Oct;123:139-149.
3 Methylation of miR-129-5p CpG island modulates multi-drug resistance in gastric cancer by targeting ABC transporters. Oncotarget. 2014 Nov 30;5(22):11552-63.
4 A preliminary study of the relationship between promoter methylation of the ABCG1, GALNT2 and HMGCR genes and coronary heart disease. PLoS One. 2014 Aug 1;9(8):e102265.
5 DNA methylation of loci within ABCG1 and PHOSPHO1 in blood DNA is associated with future type 2 diabetes risk. Epigenetics. 2016 Jul 2;11(7):482-8.
6 Gut microbiota metabolism of anthocyanin promotes reverse cholesterol transport in mice via repressing miRNA-10b. Circ Res. 2012 Sep 28;111(8):967-81.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.