Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0084 Transporter Info | ||||
| Gene Name | SLC12A3 | ||||
| Transporter Name | Thiazide-sensitive sodium-chloride cotransporter | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-136 directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-136 | miRNA Mature ID | miR-136-5p | ||
|
miRNA Sequence |
ACUCCAUUUGUUUUGAUGAUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 2 |
miR-2355 directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-2355 | miRNA Mature ID | miR-2355-3p | ||
|
miRNA Sequence |
AUUGUCCUUGCUGUUUGGAGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-335 directly targets SLC12A3 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 4 |
miR-4287 directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4287 | miRNA Mature ID | miR-4287 | ||
|
miRNA Sequence |
UCUCCCUUGAGGGCACUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 5 |
miR-4329 directly targets SLC12A3 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4329 | miRNA Mature ID | miR-4329 | ||
|
miRNA Sequence |
CCUGAGACCCUAGUUCCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 6 |
miR-4469 directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4469 | miRNA Mature ID | miR-4469 | ||
|
miRNA Sequence |
GCUCCCUCUAGGGUCGCUCGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-4524a directly targets SLC12A3 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4524a | miRNA Mature ID | miR-4524a-3p | ||
|
miRNA Sequence |
UGAGACAGGCUUAUGCUGCUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 8 |
miR-4685 directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4685 | miRNA Mature ID | miR-4685-3p | ||
|
miRNA Sequence |
UCUCCCUUCCUGCCCUGGCUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-4780 directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4780 | miRNA Mature ID | miR-4780 | ||
|
miRNA Sequence |
ACCCUUGAGCCUGAUCCCUAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-515 directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-515 | miRNA Mature ID | miR-515-5p | ||
|
miRNA Sequence |
UUCUCCAAAAGAAAGCACUUUCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 11 |
miR-519e directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-519e | miRNA Mature ID | miR-519e-5p | ||
|
miRNA Sequence |
UUCUCCAAAAGGGAGCACUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 12 |
miR-5680 directly targets SLC12A3 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5680 | miRNA Mature ID | miR-5680 | ||
|
miRNA Sequence |
GAGAAAUGCUGGACUAAUCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 13 |
miR-623 directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-623 | miRNA Mature ID | miR-623 | ||
|
miRNA Sequence |
AUCCCUUGCAGGGGCUGUUGGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 14 |
miR-629 directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-629 | miRNA Mature ID | miR-629-3p | ||
|
miRNA Sequence |
GUUCUCCCAACGUAAGCCCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 15 |
miR-676 directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-676 | miRNA Mature ID | miR-676-3p | ||
|
miRNA Sequence |
CUGUCCUAAGGUUGUUGAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 16 |
miR-6867 directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6867 | miRNA Mature ID | miR-6867-3p | ||
|
miRNA Sequence |
CUCUCCCUCUUUACCCACUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 17 |
miR-7113 directly targets SLC12A3 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7113 | miRNA Mature ID | miR-7113-3p | ||
|
miRNA Sequence |
CCUCCCUGCCCGCCUCUCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.