Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0100 Transporter Info
Gene Name SLC16A1
Transporter Name Monocarboxylate transporter 1
Gene ID
6566
UniProt ID
P53985
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A1 in bladder cancer [ 1 ]

Location

 TSS1500 (cg19645639)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.75E+00 Statistic Test p-value: 2.95E-04; Z-score: -4.02E+00

Methylation in Case

 1.25E-01 (Median) Methylation in Control 2.18E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A1 in breast cancer [ 2 ]

Location

 TSS1500 (cg07176692)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.51E+00 Statistic Test p-value: 2.24E-09; Z-score: 1.62E+00

Methylation in Case

 2.32E-01 (Median) Methylation in Control 1.53E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A1 in breast cancer [ 2 ]

Location

 TSS1500 (cg19645639)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.55E+00 Statistic Test p-value: 3.06E-08; Z-score: 1.41E+00

Methylation in Case

 2.25E-01 (Median) Methylation in Control 1.45E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A1 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg19645639)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.58E+00 Statistic Test p-value: 4.00E-03; Z-score: -1.76E+00

Methylation in Case

 1.82E-01 (Median) Methylation in Control 2.89E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A1 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg19645639)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.88E+00 Statistic Test p-value: 2.56E-04; Z-score: -1.46E+00

Methylation in Case

 1.87E-01 (Median) Methylation in Control 3.51E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A1 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg07176692)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.90E+00 Statistic Test p-value: 1.14E-03; Z-score: -1.36E+00

Methylation in Case

 2.77E-01 (Median) Methylation in Control 5.27E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A1 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg24977541)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 2.94E-12; Z-score: -4.34E+00

Methylation in Case

 5.28E-01 (Median) Methylation in Control 6.89E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A1 in HIV infection [ 6 ]

Location

 TSS1500 (cg07176692)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.69E+00 Statistic Test p-value: 2.25E-08; Z-score: -2.64E+00

Methylation in Case

 2.91E-01 (Median) Methylation in Control 4.92E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A1 in HIV infection [ 6 ]

Location

 TSS1500 (cg19645639)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 4.68E-06; Z-score: -2.83E+00

Methylation in Case

 5.39E-01 (Median) Methylation in Control 6.92E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A1 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg19645639)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 2.49E-02; Z-score: -1.90E+00

Methylation in Case

 4.06E-01 (Median) Methylation in Control 4.91E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A1 in panic disorder [ 8 ]

Location

 TSS1500 (cg07176692)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 6.04E-01 Statistic Test p-value: 6.50E-03; Z-score: 3.84E-01

Methylation in Case

 -2.77E-01 (Median) Methylation in Control -4.59E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A1 in panic disorder [ 8 ]

Location

 TSS1500 (cg19645639)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 2.53E-02; Z-score: 6.03E-01

Methylation in Case

 2.00E+00 (Median) Methylation in Control 1.65E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A1 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg07176692)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 9.77E-03; Z-score: -6.68E-01

Methylation in Case

 6.23E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A1 in prostate cancer [ 10 ]

Location

 TSS1500 (cg08620470)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.29E-02; Z-score: 1.71E+00

Methylation in Case

 9.50E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A1 in prostate cancer [ 10 ]

Location

 Body (cg01650904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.39E+00 Statistic Test p-value: 4.68E-02; Z-score: 5.64E+00

Methylation in Case

 4.03E-01 (Median) Methylation in Control 1.68E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A1 in colon adenocarcinoma [ 11 ]

Location

 Body (cg23529278)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 6.44E-04; Z-score: -2.34E+00

Methylation in Case

 8.60E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

Histone acetylation

  Oligodendrocyte precursors

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypoacetylation of Slc16a1 in oligodendrocyte precursors (compare with oligodendrocyte) [ 12 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Up regulation of Slc16a1 Experiment Method RT-qPCR

Studied Phenotype

 Oligodendrocyte precursors

Experimental Material

 Model organism in vivo (mouse)

Additional Notes

 There was a significant negative correlation between H3K9ac in the Slc16a1 promoter and Slc16a1 expression.

microRNA

  Medulloblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Lower expression of miR-124 in medulloblastoma (compare with adjacent normal tissue) [ 13 ]

Epigenetic Type

 microRNA Experiment Method Luciferase reporter assay

Related Molecular Changes

 Down regulation of SLC16A1 Experiment Method Western Blot

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Studied Phenotype

 Medulloblastoma [ ICD-11: 2A00.10]

Experimental Material

 Patient tissue samples; Multiple cell lines of human

Additional Notes

 miR-124 deregulation is common in medulloblastomas, and reexpression of miR-124 inhibits cell proliferation.

  Unclear Phenotype

        118 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1202 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1202 miRNA Mature ID miR-1202

miRNA Sequence

 GUGCCAGCUGCAGUGGGGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-124 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-1267 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1267 miRNA Mature ID miR-1267

miRNA Sequence

 CCUGUUGAAGUGUAAUCCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-128 directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-128 miRNA Mature ID miR-128-3p

miRNA Sequence

 UCACAGUGAACCGGUCUCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-129 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-129 miRNA Mature ID miR-129-5p

miRNA Sequence

 CUUUUUGCGGUCUGGGCUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-1343 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1343 miRNA Mature ID miR-1343-3p

miRNA Sequence

 CUCCUGGGGCCCGCACUCUCGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-188 directly targets SLC16A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-188 miRNA Mature ID miR-188-5p

miRNA Sequence

 CAUCCCUUGCAUGGUGGAGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-190a directly targets SLC16A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-190a miRNA Mature ID miR-190a-3p

miRNA Sequence

 CUAUAUAUCAAACAUAUUCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-1914 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1914 miRNA Mature ID miR-1914-3p

miRNA Sequence

 GGAGGGGUCCCGCACUGGGAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-1972 directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1972 miRNA Mature ID miR-1972

miRNA Sequence

 UCAGGCCAGGCACAGUGGCUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-216a directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-216a miRNA Mature ID miR-216a-3p

miRNA Sequence

 UCACAGUGGUCUCUGGGAUUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-23b directly targets SLC16A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-23b miRNA Mature ID miR-23b-3p

miRNA Sequence

 AUCACAUUGCCAGGGAUUACCAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-27a directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-27a miRNA Mature ID miR-27a-3p

miRNA Sequence

 UUCACAGUGGCUAAGUUCCGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-27b directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-27b miRNA Mature ID miR-27b-3p

miRNA Sequence

 UUCACAGUGGCUAAGUUCUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-29a directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-29a miRNA Mature ID miR-29a-3p

miRNA Sequence

 UAGCACCAUCUGAAAUCGGUUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-29b directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-29b miRNA Mature ID miR-29b-3p

miRNA Sequence

 UAGCACCAUUUGAAAUCAGUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-29c directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-29c miRNA Mature ID miR-29c-3p

miRNA Sequence

 UAGCACCAUUUGAAAUCGGUUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 18

 miR-302a directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-302a miRNA Mature ID miR-302a-5p

miRNA Sequence

 ACUUAAACGUGGAUGUACUUGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 19

 miR-302c directly targets SLC16A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-302c miRNA Mature ID miR-302c-5p

miRNA Sequence

 UUUAACAUGGGGGUACCUGCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-30a directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-30a miRNA Mature ID miR-30a-3p

miRNA Sequence

 CUUUCAGUCGGAUGUUUGCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-30d directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-30d miRNA Mature ID miR-30d-3p

miRNA Sequence

 CUUUCAGUCAGAUGUUUGCUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-30e directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-30e miRNA Mature ID miR-30e-3p

miRNA Sequence

 CUUUCAGUCGGAUGUUUACAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-3117 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3117 miRNA Mature ID miR-3117-5p

miRNA Sequence

 AGACACUAUACGAGUCAUAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 24

 miR-3148 directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3148 miRNA Mature ID miR-3148

miRNA Sequence

 UGGAAAAAACUGGUGUGUGCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-3194 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3194 miRNA Mature ID miR-3194-3p

miRNA Sequence

 AGCUCUGCUGCUCACUGGCAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-33a directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-33a miRNA Mature ID miR-33a-3p

miRNA Sequence

 CAAUGUUUCCACAGUGCAUCAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 27

 miR-33a directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-33a miRNA Mature ID miR-33a-5p

miRNA Sequence

 GUGCAUUGUAGUUGCAUUGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 28

 miR-33b directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-33b miRNA Mature ID miR-33b-5p

miRNA Sequence

 GUGCAUUGCUGUUGCAUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 29

 miR-3529 directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3529 miRNA Mature ID miR-3529-5p

miRNA Sequence

 AGGUAGACUGGGAUUUGUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 30

 miR-3663 directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3663 miRNA Mature ID miR-3663-3p

miRNA Sequence

 UGAGCACCACACAGGCCGGGCGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 31

 miR-367 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-367 miRNA Mature ID miR-367-5p

miRNA Sequence

 ACUGUUGCUAAUAUGCAACUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-3672 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3672 miRNA Mature ID miR-3672

miRNA Sequence

 AUGAGACUCAUGUAAAACAUCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-3680 directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3680 miRNA Mature ID miR-3680-3p

miRNA Sequence

 UUUUGCAUGACCCUGGGAGUAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 34

 miR-3681 directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3681 miRNA Mature ID miR-3681-3p

miRNA Sequence

 ACACAGUGCUUCAUCCACUACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-3714 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3714 miRNA Mature ID miR-3714

miRNA Sequence

 GAAGGCAGCAGUGCUCCCCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 36

 miR-374a directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-374a miRNA Mature ID miR-374a-5p

miRNA Sequence

 UUAUAAUACAACCUGAUAAGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 37

 miR-374b directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-374b miRNA Mature ID miR-374b-5p

miRNA Sequence

 AUAUAAUACAACCUGCUAAGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 38

 miR-377 directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-377 miRNA Mature ID miR-377-5p

miRNA Sequence

 AGAGGUUGCCCUUGGUGAAUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-379 directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-379 miRNA Mature ID miR-379-5p

miRNA Sequence

 UGGUAGACUAUGGAACGUAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 40

 miR-380 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-380 miRNA Mature ID miR-380-5p

miRNA Sequence

 UGGUUGACCAUAGAACAUGCGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 41

 miR-3910 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3910 miRNA Mature ID miR-3910

miRNA Sequence

 AAAGGCAUAAAACCAAGACA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 42

 miR-3936 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3936 miRNA Mature ID miR-3936

miRNA Sequence

 UAAGGGGUGUAUGGCAGAUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 43

 miR-3942 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3942 miRNA Mature ID miR-3942-3p

miRNA Sequence

 UUUCAGAUAACAGUAUUACAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 44

 miR-3972 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3972 miRNA Mature ID miR-3972

miRNA Sequence

 CUGCCAGCCCCGUUCCAGGGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 45

 miR-3978 directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3978 miRNA Mature ID miR-3978

miRNA Sequence

 GUGGAAAGCAUGCAUCCAGGGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 46

 miR-425 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-425 miRNA Mature ID miR-425-5p

miRNA Sequence

 AAUGACACGAUCACUCCCGUUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 47

 miR-4294 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4294 miRNA Mature ID miR-4294

miRNA Sequence

 GGGAGUCUACAGCAGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 48

 miR-4307 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4307 miRNA Mature ID miR-4307

miRNA Sequence

 AAUGUUUUUUCCUGUUUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 49

 miR-431 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-431 miRNA Mature ID miR-431-5p

miRNA Sequence

 UGUCUUGCAGGCCGUCAUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 50

 miR-4324 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4324 miRNA Mature ID miR-4324

miRNA Sequence

 CCCUGAGACCCUAACCUUAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 51

 miR-4423 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4423 miRNA Mature ID miR-4423-5p

miRNA Sequence

 AGUUGCCUUUUUGUUCCCAUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 52

 miR-4438 directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4438 miRNA Mature ID miR-4438

miRNA Sequence

 CACAGGCUUAGAAAAGACAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 53

 miR-4451 directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4451 miRNA Mature ID miR-4451

miRNA Sequence

 UGGUAGAGCUGAGGACA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 54

 miR-4503 directly targets SLC16A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4503 miRNA Mature ID miR-4503

miRNA Sequence

 UUUAAGCAGGAAAUAGAAUUUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 55

 miR-4650 directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4650 miRNA Mature ID miR-4650-3p

miRNA Sequence

 AGGUAGAAUGAGGCCUGACAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 56

 miR-4719 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4719 miRNA Mature ID miR-4719

miRNA Sequence

 UCACAAAUCUAUAAUAUGCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 57

 miR-4733 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4733 miRNA Mature ID miR-4733-5p

miRNA Sequence

 AAUCCCAAUGCUAGACCCGGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 58

 miR-4755 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4755 miRNA Mature ID miR-4755-3p

miRNA Sequence

 AGCCAGGCUCUGAAGGGAAAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 59

 miR-484 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-484 miRNA Mature ID miR-484

miRNA Sequence

 UCAGGCUCAGUCCCCUCCCGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 60

 miR-488 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-488 miRNA Mature ID miR-488-3p

miRNA Sequence

 UUGAAAGGCUAUUUCUUGGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 61

 miR-5002 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5002 miRNA Mature ID miR-5002-5p

miRNA Sequence

 AAUUUGGUUUCUGAGGCACUUAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 62

 miR-5003 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5003 miRNA Mature ID miR-5003-3p

miRNA Sequence

 UACUUUUCUAGGUUGUUGGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 63

 miR-5006 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5006 miRNA Mature ID miR-5006-5p

miRNA Sequence

 UUGCCAGGGCAGGAGGUGGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 64

 miR-5011 directly targets SLC16A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5011 miRNA Mature ID miR-5011-5p

miRNA Sequence

 UAUAUAUACAGCCAUGCACUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 65

 miR-506 directly targets SLC16A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-506 miRNA Mature ID miR-506-3p

miRNA Sequence

 UAAGGCACCCUUCUGAGUAGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 66

 miR-506 directly targets SLC16A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-506 miRNA Mature ID miR-506-5p

miRNA Sequence

 UAUUCAGGAAGGUGUUACUUAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 67

 miR-5100 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5100 miRNA Mature ID miR-5100

miRNA Sequence

 UUCAGAUCCCAGCGGUGCCUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 68

 miR-513a directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-513a miRNA Mature ID miR-513a-5p

miRNA Sequence

 UUCACAGGGAGGUGUCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 69

 miR-5194 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5194 miRNA Mature ID miR-5194

miRNA Sequence

 UGAGGGGUUUGGAAUGGGAUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 70

 miR-548a directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548a miRNA Mature ID miR-548a-3p

miRNA Sequence

 CAAAACUGGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 71

 miR-548ar directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548ar miRNA Mature ID miR-548ar-3p

miRNA Sequence

 UAAAACUGCAGUUAUUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 72

 miR-548az directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548az miRNA Mature ID miR-548az-3p

miRNA Sequence

 AAAAACUGCAAUCACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 73

 miR-548e directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548e miRNA Mature ID miR-548e-3p

miRNA Sequence

 AAAAACUGAGACUACUUUUGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 74

 miR-548f directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548f miRNA Mature ID miR-548f-3p

miRNA Sequence

 AAAAACUGUAAUUACUUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 75

 miR-548j directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548j miRNA Mature ID miR-548j-3p

miRNA Sequence

 CAAAAACUGCAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 76

 miR-548m directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548m miRNA Mature ID miR-548m

miRNA Sequence

 CAAAGGUAUUUGUGGUUUUUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 77

 miR-548x directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548x miRNA Mature ID miR-548x-3p

miRNA Sequence

 UAAAAACUGCAAUUACUUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 78

 miR-552 directly targets SLC16A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-552 miRNA Mature ID miR-552-5p

miRNA Sequence

 GUUUAACCUUUUGCCUGUUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 79

 miR-5582 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5582 miRNA Mature ID miR-5582-5p

miRNA Sequence

 UAGGCACACUUAAAGUUAUAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 80

 miR-5582 directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5582 miRNA Mature ID miR-5582-3p

miRNA Sequence

 UAAAACUUUAAGUGUGCCUAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 81

 miR-563 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-563 miRNA Mature ID miR-563

miRNA Sequence

 AGGUUGACAUACGUUUCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 82

 miR-5681a directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5681a miRNA Mature ID miR-5681a

miRNA Sequence

 AGAAAGGGUGGCAAUACCUCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 83

 miR-5691 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5691 miRNA Mature ID miR-5691

miRNA Sequence

 UUGCUCUGAGCUCCGAGAAAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 84

 miR-576 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-576 miRNA Mature ID miR-576-5p

miRNA Sequence

 AUUCUAAUUUCUCCACGUCUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 85

 miR-605 directly targets SLC16A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-605 miRNA Mature ID miR-605-5p

miRNA Sequence

 UAAAUCCCAUGGUGCCUUCUCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 86

 miR-6074 directly targets SLC16A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6074 miRNA Mature ID miR-6074

miRNA Sequence

 GAUAUUCAGAGGCUAGGUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 87

 miR-6086 directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6086 miRNA Mature ID miR-6086

miRNA Sequence

 GGAGGUUGGGAAGGGCAGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 88

 miR-6124 directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6124 miRNA Mature ID miR-6124

miRNA Sequence

 GGGAAAAGGAAGGGGGAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 89

 miR-615 directly targets SLC16A1 [ 20 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-615 miRNA Mature ID miR-615-3p

miRNA Sequence

 UCCGAGCCUGGGUCUCCCUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 90

 miR-6501 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6501 miRNA Mature ID miR-6501-5p

miRNA Sequence

 AGUUGCCAGGGCUGCCUUUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 91

 miR-6504 directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6504 miRNA Mature ID miR-6504-3p

miRNA Sequence

 CAUUACAGCACAGCCAUUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 92

 miR-655 directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-655 miRNA Mature ID miR-655-5p

miRNA Sequence

 AGAGGUUAUCCGUGUUAUGUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 93

 miR-656 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-656 miRNA Mature ID miR-656-3p

miRNA Sequence

 AAUAUUAUACAGUCAACCUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 94

 miR-6730 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6730 miRNA Mature ID miR-6730-5p

miRNA Sequence

 AGAAAGGUGGAGGGGUUGUCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 95

 miR-6738 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6738 miRNA Mature ID miR-6738-5p

miRNA Sequence

 CGAGGGGUAGAAGAGCACAGGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 96

 miR-6742 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6742 miRNA Mature ID miR-6742-3p

miRNA Sequence

 ACCUGGGUUGUCCCCUCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 97

 miR-6761 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6761 miRNA Mature ID miR-6761-5p

miRNA Sequence

 UCUGAGAGAGCUCGAUGGCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 98

 miR-6783 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6783 miRNA Mature ID miR-6783-3p

miRNA Sequence

 UUCCUGGGCUUCUCCUCUGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 99

 miR-6792 directly targets SLC16A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6792 miRNA Mature ID miR-6792-5p

miRNA Sequence

 GUAAGCAGGGGCUCUGGGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 100

 miR-6805 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6805 miRNA Mature ID miR-6805-3p

miRNA Sequence

 UUGCUCUGCUCCCCCGCCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 101

 miR-6814 directly targets SLC16A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6814 miRNA Mature ID miR-6814-5p

miRNA Sequence

 UCCCAAGGGUGAGAUGCUGCCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 102

 miR-6815 directly targets SLC16A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6815 miRNA Mature ID miR-6815-3p

miRNA Sequence

 UGGCUUCUCUUGCACACCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 103

 miR-6852 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6852 miRNA Mature ID miR-6852-5p

miRNA Sequence

 CCCUGGGGUUCUGAGGACAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 104

 miR-6864 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6864 miRNA Mature ID miR-6864-3p

miRNA Sequence

 GUGAGACUUCUCUCCCUUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 105

 miR-6866 directly targets SLC16A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6866 miRNA Mature ID miR-6866-3p

miRNA Sequence

 GAUCCCUUUAUCUGUCCUCUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 106

 miR-7109 directly targets SLC16A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7109 miRNA Mature ID miR-7109-3p

miRNA Sequence

 CAAGCCUCUCCUGCCCUUCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 107

 miR-7151 directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7151 miRNA Mature ID miR-7151-3p

miRNA Sequence

 CUACAGGCUGGAAUGGGCUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 108

 miR-7154 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7154 miRNA Mature ID miR-7154-5p

miRNA Sequence

 UUCAUGAACUGGGUCUAGCUUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 109

 miR-7162 directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7162 miRNA Mature ID miR-7162-3p

miRNA Sequence

 UCUGAGGUGGAACAGCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 110

 miR-744 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-744 miRNA Mature ID miR-744-3p

miRNA Sequence

 CUGUUGCCACUAACCUCAACCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 111

 miR-7850 directly targets SLC16A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7850 miRNA Mature ID miR-7850-5p

miRNA Sequence

 GUUUGGACAUAGUGUGGCUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 112

 miR-8055 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8055 miRNA Mature ID miR-8055

miRNA Sequence

 CUUUGAGCACAUGAGCAGACGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 113

 miR-8060 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-8060 miRNA Mature ID miR-8060

miRNA Sequence

 CCAUGAAGCAGUGGGUAGGAGGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 114

 miR-890 directly targets SLC16A1 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-890 miRNA Mature ID miR-890

miRNA Sequence

 UACUUGGAAAGGCAUCAGUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 115

 miR-892c directly targets SLC16A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-892c miRNA Mature ID miR-892c-5p

miRNA Sequence

 UAUUCAGAAAGGUGCCAGUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 116

 miR-924 directly targets SLC16A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-924 miRNA Mature ID miR-924

miRNA Sequence

 AGAGUCUUGUGAUGUCUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 117

 miR-936 directly targets SLC16A1 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-936 miRNA Mature ID miR-936

miRNA Sequence

 ACAGUAGAGGGAGGAAUCGCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 118

 miR-939 directly targets SLC16A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-939 miRNA Mature ID miR-939-3p

miRNA Sequence

 CCCUGGGCCUCUGCUCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
12 H3K9ac and HDAC2 Activity Are Involved in the Expression of Monocarboxylate Transporter 1 in Oligodendrocyte. Front Mol Neurosci. 2017 Nov 14;10:376.
13 miR-124 is frequently down-regulated in medulloblastoma and is a negative regulator of SLC16A1. Hum Pathol. 2009 Sep;40(9):1234-43.
14 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
15 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
16 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
17 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
18 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
19 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
20 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
21 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.