Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0101 Transporter Info | ||||
| Gene Name | SLC16A10 | ||||
| Transporter Name | Monocarboxylate transporter 10 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Pancretic ductal adenocarcinoma |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC16A10 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg14794191) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.04E-03; Z-score: -3.82E-01 | ||
|
Methylation in Case |
8.55E-01 (Median) | Methylation in Control | 8.66E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC16A10 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg09454187) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 6.04E-05; Z-score: 1.46E+00 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 6.39E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC16A10 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg16782807) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.99E+00 | Statistic Test | p-value: 3.46E-12; Z-score: 1.92E+00 | ||
|
Methylation in Case |
3.68E-01 (Median) | Methylation in Control | 1.85E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC16A10 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg23250019) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 3.69E-08; Z-score: -1.79E+00 | ||
|
Methylation in Case |
5.47E-01 (Median) | Methylation in Control | 7.30E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC16A10 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg14047153) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 1.16E-04; Z-score: -1.50E+00 | ||
|
Methylation in Case |
7.09E-01 (Median) | Methylation in Control | 9.17E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC16A10 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg01551177) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 2.11E-03; Z-score: 7.32E-01 | ||
|
Methylation in Case |
7.33E-01 (Median) | Methylation in Control | 6.83E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC16A10 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg00378292) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.14E-02; Z-score: -7.36E-01 | ||
|
Methylation in Case |
3.66E-01 (Median) | Methylation in Control | 3.91E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC16A10 in clear cell renal cell carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg14849782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 5.58E-03; Z-score: 9.07E-01 | ||
|
Methylation in Case |
2.08E-02 (Median) | Methylation in Control | 1.71E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC16A10 in clear cell renal cell carcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg15721981) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 2.29E-02; Z-score: 3.51E-01 | ||
|
Methylation in Case |
4.80E-02 (Median) | Methylation in Control | 4.39E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC16A10 in clear cell renal cell carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg15822346) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 7.31E-05; Z-score: -1.16E+00 | ||
|
Methylation in Case |
4.10E-02 (Median) | Methylation in Control | 5.76E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC16A10 in clear cell renal cell carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg18588052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 3.25E-03; Z-score: -7.08E-01 | ||
|
Methylation in Case |
2.47E-02 (Median) | Methylation in Control | 3.01E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC16A10 in clear cell renal cell carcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg25357155) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 3.40E-02; Z-score: 9.71E-02 | ||
|
Methylation in Case |
1.24E-02 (Median) | Methylation in Control | 1.22E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC16A10 in clear cell renal cell carcinoma | [ 2 ] | |||
|
Location |
1stExon (cg07940485) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.62E-06; Z-score: 7.58E-01 | ||
|
Methylation in Case |
1.45E-02 (Median) | Methylation in Control | 1.36E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC16A10 in colon adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg07104116) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 2.71E-05; Z-score: -1.80E+00 | ||
|
Methylation in Case |
4.84E-01 (Median) | Methylation in Control | 5.85E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC16A10 in colon adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg06746492) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 5.29E-04; Z-score: -2.41E+00 | ||
|
Methylation in Case |
6.44E-01 (Median) | Methylation in Control | 7.65E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC16A10 in colon adenocarcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg10528482) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 4.98E-03; Z-score: 1.46E+00 | ||
|
Methylation in Case |
7.33E-01 (Median) | Methylation in Control | 6.64E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC16A10 in colon adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg14495732) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 2.00E-06; Z-score: -4.80E+00 | ||
|
Methylation in Case |
5.70E-01 (Median) | Methylation in Control | 7.40E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC16A10 in colon adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg20438663) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 9.02E-04; Z-score: 1.28E+00 | ||
|
Methylation in Case |
7.27E-01 (Median) | Methylation in Control | 6.83E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC16A10 in colon adenocarcinoma | [ 3 ] | |||
|
Location |
Body (cg01704999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 3.40E-03; Z-score: 1.05E+00 | ||
|
Methylation in Case |
1.41E-01 (Median) | Methylation in Control | 1.24E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC16A10 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg14074641) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.38E+00 | Statistic Test | p-value: 7.16E-16; Z-score: -6.28E+00 | ||
|
Methylation in Case |
5.56E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC16A10 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg13463516) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 6.87E-16; Z-score: -3.47E+00 | ||
|
Methylation in Case |
3.75E-01 (Median) | Methylation in Control | 5.43E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC16A10 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg05218653) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 2.41E-11; Z-score: -5.89E+00 | ||
|
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 9.69E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC16A10 in hepatocellular carcinoma | [ 4 ] | |||
|
Location |
Body (cg21276197) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 3.80E-02; Z-score: 6.28E-02 | ||
|
Methylation in Case |
4.67E-02 (Median) | Methylation in Control | 4.62E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC16A10 in panic disorder | [ 5 ] | |||
|
Location |
TSS1500 (cg14849782) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 9.78E-01 | Statistic Test | p-value: 2.35E-02; Z-score: 4.52E-01 | ||
|
Methylation in Case |
-5.18E+00 (Median) | Methylation in Control | -5.29E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC16A10 in systemic lupus erythematosus | [ 6 ] | |||
|
Location |
TSS1500 (cg15721981) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 9.13E-03; Z-score: -1.28E-01 | ||
|
Methylation in Case |
1.24E-01 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC16A10 in systemic lupus erythematosus | [ 6 ] | |||
|
Location |
TSS200 (cg26912984) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.89E-03; Z-score: -2.16E-01 | ||
|
Methylation in Case |
1.25E-01 (Median) | Methylation in Control | 1.31E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC16A10 in systemic lupus erythematosus | [ 6 ] | |||
|
Location |
TSS200 (cg24499517) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 4.02E-02; Z-score: 1.65E-01 | ||
|
Methylation in Case |
1.57E-02 (Median) | Methylation in Control | 1.49E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC16A10 in systemic lupus erythematosus | [ 6 ] | |||
|
Location |
Body (cg18485596) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 2.05E-04; Z-score: 3.35E-01 | ||
|
Methylation in Case |
2.42E-01 (Median) | Methylation in Control | 2.22E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC16A10 in bladder cancer | [ 7 ] | |||
|
Location |
TSS200 (cg26912984) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 1.46E-02; Z-score: -1.48E+00 | ||
|
Methylation in Case |
1.10E-01 (Median) | Methylation in Control | 1.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC16A10 in bladder cancer | [ 7 ] | |||
|
Location |
TSS200 (cg18588052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 1.60E-02; Z-score: -1.87E+00 | ||
|
Methylation in Case |
6.30E-02 (Median) | Methylation in Control | 9.32E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC16A10 in bladder cancer | [ 7 ] | |||
|
Location |
TSS200 (cg15822346) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 4.57E-02; Z-score: -1.56E+00 | ||
|
Methylation in Case |
9.83E-02 (Median) | Methylation in Control | 1.23E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC16A10 in breast cancer | [ 8 ] | |||
|
Location |
TSS200 (cg24499517) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.04E-02; Z-score: 7.21E-02 | ||
|
Methylation in Case |
1.47E-02 (Median) | Methylation in Control | 1.39E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC16A10 in breast cancer | [ 8 ] | |||
|
Location |
TSS200 (cg18588052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 1.94E-02; Z-score: -3.85E-01 | ||
|
Methylation in Case |
3.59E-02 (Median) | Methylation in Control | 4.49E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC16A10 in breast cancer | [ 8 ] | |||
|
Location |
TSS200 (cg25357155) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.86E-02; Z-score: -2.93E-02 | ||
|
Methylation in Case |
1.04E-02 (Median) | Methylation in Control | 1.07E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC16A10 in breast cancer | [ 8 ] | |||
|
Location |
1stExon (cg07940485) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 9.77E-04; Z-score: 3.55E-01 | ||
|
Methylation in Case |
9.38E-03 (Median) | Methylation in Control | 7.06E-03 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC16A10 in breast cancer | [ 8 ] | |||
|
Location |
Body (cg03181943) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 2.14E-06; Z-score: 2.14E+00 | ||
|
Methylation in Case |
7.65E-01 (Median) | Methylation in Control | 6.48E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC16A10 in breast cancer | [ 8 ] | |||
|
Location |
Body (cg21276197) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.81E-05; Z-score: 1.50E-01 | ||
|
Methylation in Case |
8.24E-02 (Median) | Methylation in Control | 7.82E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC16A10 in breast cancer | [ 8 ] | |||
|
Location |
Body (cg16300317) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 1.53E-03; Z-score: 7.76E-03 | ||
|
Methylation in Case |
7.10E-02 (Median) | Methylation in Control | 7.08E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC16A10 in HIV infection | [ 9 ] | |||
|
Location |
TSS200 (cg18588052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 1.26E-02; Z-score: 4.67E-01 | ||
|
Methylation in Case |
3.65E-02 (Median) | Methylation in Control | 3.12E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC16A10 in HIV infection | [ 9 ] | |||
|
Location |
1stExon (cg07940485) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.88E+00 | Statistic Test | p-value: 2.89E-02; Z-score: 5.81E-01 | ||
|
Methylation in Case |
5.02E-03 (Median) | Methylation in Control | 2.66E-03 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC16A10 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg18485596) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+00 | Statistic Test | p-value: 1.77E-08; Z-score: 2.33E+00 | ||
|
Methylation in Case |
1.98E-01 (Median) | Methylation in Control | 1.41E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC16A10 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg15822346) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 8.13E-03; Z-score: -1.47E+00 | ||
|
Methylation in Case |
1.11E-01 (Median) | Methylation in Control | 1.39E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC16A10 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
TSS200 (cg24499517) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 3.11E-02; Z-score: -1.03E+00 | ||
|
Methylation in Case |
2.28E-02 (Median) | Methylation in Control | 3.09E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC16A10 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg16300317) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 8.23E-03; Z-score: 1.31E+00 | ||
|
Methylation in Case |
1.11E-01 (Median) | Methylation in Control | 9.53E-02 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC16A10 in atypical teratoid rhabdoid tumor | [ 11 ] | |||
|
Location |
1stExon (cg07940485) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 2.96E-21; Z-score: -3.32E+00 | ||
|
Methylation in Case |
6.90E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC16A10 in atypical teratoid rhabdoid tumor | [ 11 ] | |||
|
Location |
Body (cg03181943) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.59E-04; Z-score: -8.52E-01 | ||
|
Methylation in Case |
8.69E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC16A10 in colorectal cancer | [ 12 ] | |||
|
Location |
Body (cg03181943) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 7.87E-03; Z-score: -7.98E-01 | ||
|
Methylation in Case |
8.91E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
56 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-122 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-122 | miRNA Mature ID | miR-122-5p | ||
|
miRNA Sequence |
UGGAGUGUGACAAUGGUGUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 2 |
miR-1250 directly targets SLC16A10 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1250 | miRNA Mature ID | miR-1250-3p | ||
|
miRNA Sequence |
ACAUUUUCCAGCCCAUUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-1281 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1281 | miRNA Mature ID | miR-1281 | ||
|
miRNA Sequence |
UCGCCUCCUCCUCUCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 4 |
miR-1304 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1304 | miRNA Mature ID | miR-1304-3p | ||
|
miRNA Sequence |
UCUCACUGUAGCCUCGAACCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 5 |
miR-140 directly targets SLC16A10 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-140 | miRNA Mature ID | miR-140-3p | ||
|
miRNA Sequence |
UACCACAGGGUAGAACCACGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 6 |
miR-143 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-143 | miRNA Mature ID | miR-143-5p | ||
|
miRNA Sequence |
GGUGCAGUGCUGCAUCUCUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 7 |
miR-145 directly targets SLC16A10 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-145 | miRNA Mature ID | miR-145-5p | ||
|
miRNA Sequence |
GUCCAGUUUUCCCAGGAAUCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 8 |
miR-153 directly targets SLC16A10 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-153 | miRNA Mature ID | miR-153-5p | ||
|
miRNA Sequence |
UCAUUUUUGUGAUGUUGCAGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-1825 directly targets SLC16A10 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1825 | miRNA Mature ID | miR-1825 | ||
|
miRNA Sequence |
UCCAGUGCCCUCCUCUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-199a directly targets SLC16A10 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-199a | miRNA Mature ID | miR-199a-5p | ||
|
miRNA Sequence |
CCCAGUGUUCAGACUACCUGUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 11 |
miR-199b directly targets SLC16A10 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-199b | miRNA Mature ID | miR-199b-5p | ||
|
miRNA Sequence |
CCCAGUGUUUAGACUAUCUGUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 12 |
miR-21 directly targets SLC16A10 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-21 | miRNA Mature ID | miR-21-5p | ||
|
miRNA Sequence |
UAGCUUAUCAGACUGAUGUUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
miR-2115 directly targets SLC16A10 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-2115 | miRNA Mature ID | miR-2115-5p | ||
|
miRNA Sequence |
AGCUUCCAUGACUCCUGAUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 14 |
miR-3135b directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3135b | miRNA Mature ID | miR-3135b | ||
|
miRNA Sequence |
GGCUGGAGCGAGUGCAGUGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 15 |
miR-3149 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3149 | miRNA Mature ID | miR-3149 | ||
|
miRNA Sequence |
UUUGUAUGGAUAUGUGUGUGUAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 16 |
miR-3158 directly targets SLC16A10 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3158 | miRNA Mature ID | miR-3158-5p | ||
|
miRNA Sequence |
CCUGCAGAGAGGAAGCCCUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 17 |
miR-3166 directly targets SLC16A10 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3166 | miRNA Mature ID | miR-3166 | ||
|
miRNA Sequence |
CGCAGACAAUGCCUACUGGCCUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 18 |
miR-3190 directly targets SLC16A10 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3190 | miRNA Mature ID | miR-3190-5p | ||
|
miRNA Sequence |
UCUGGCCAGCUACGUCCCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 19 |
miR-3529 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3529 | miRNA Mature ID | miR-3529-5p | ||
|
miRNA Sequence |
AGGUAGACUGGGAUUUGUUGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 20 |
miR-3652 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3652 | miRNA Mature ID | miR-3652 | ||
|
miRNA Sequence |
CGGCUGGAGGUGUGAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 21 |
miR-3674 directly targets SLC16A10 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3674 | miRNA Mature ID | miR-3674 | ||
|
miRNA Sequence |
AUUGUAGAACCUAAGAUUGGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 22 |
miR-379 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-379 | miRNA Mature ID | miR-379-5p | ||
|
miRNA Sequence |
UGGUAGACUAUGGAACGUAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 23 |
miR-3926 directly targets SLC16A10 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3926 | miRNA Mature ID | miR-3926 | ||
|
miRNA Sequence |
UGGCCAAAAAGCAGGCAGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 24 |
miR-4418 directly targets SLC16A10 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4418 | miRNA Mature ID | miR-4418 | ||
|
miRNA Sequence |
CACUGCAGGACUCAGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 25 |
miR-4428 directly targets SLC16A10 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4428 | miRNA Mature ID | miR-4428 | ||
|
miRNA Sequence |
CAAGGAGACGGGAACAUGGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 26 |
miR-4430 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4430 | miRNA Mature ID | miR-4430 | ||
|
miRNA Sequence |
AGGCUGGAGUGAGCGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 27 |
miR-4438 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4438 | miRNA Mature ID | miR-4438 | ||
|
miRNA Sequence |
CACAGGCUUAGAAAAGACAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 28 |
miR-4451 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4451 | miRNA Mature ID | miR-4451 | ||
|
miRNA Sequence |
UGGUAGAGCUGAGGACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 29 |
miR-4537 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4537 | miRNA Mature ID | miR-4537 | ||
|
miRNA Sequence |
UGAGCCGAGCUGAGCUUAGCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 30 |
miR-4643 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4643 | miRNA Mature ID | miR-4643 | ||
|
miRNA Sequence |
GACACAUGACCAUAAAUGCUAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 31 |
miR-4650 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4650 | miRNA Mature ID | miR-4650-3p | ||
|
miRNA Sequence |
AGGUAGAAUGAGGCCUGACAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 32 |
miR-4717 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4717 | miRNA Mature ID | miR-4717-3p | ||
|
miRNA Sequence |
ACACAUGGGUGGCUGUGGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 33 |
miR-4771 directly targets SLC16A10 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4771 | miRNA Mature ID | miR-4771 | ||
|
miRNA Sequence |
AGCAGACUUGACCUACAAUUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 34 |
miR-4772 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4772 | miRNA Mature ID | miR-4772-3p | ||
|
miRNA Sequence |
CCUGCAACUUUGCCUGAUCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 35 |
miR-499b directly targets SLC16A10 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-499b | miRNA Mature ID | miR-499b-5p | ||
|
miRNA Sequence |
ACAGACUUGCUGUGAUGUUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 36 |
miR-500b directly targets SLC16A10 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-500b | miRNA Mature ID | miR-500b-3p | ||
|
miRNA Sequence |
GCACCCAGGCAAGGAUUCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 37 |
miR-504 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-504 | miRNA Mature ID | miR-504-3p | ||
|
miRNA Sequence |
GGGAGUGCAGGGCAGGGUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 38 |
miR-509 directly targets SLC16A10 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-509 | miRNA Mature ID | miR-509-5p | ||
|
miRNA Sequence |
UACUGCAGACAGUGGCAAUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 39 |
miR-5195 directly targets SLC16A10 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5195 | miRNA Mature ID | miR-5195-3p | ||
|
miRNA Sequence |
AUCCAGUUCUCUGAGGGGGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 40 |
miR-548s directly targets SLC16A10 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548s | miRNA Mature ID | miR-548s | ||
|
miRNA Sequence |
AUGGCCAAAACUGCAGUUAUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 41 |
miR-5693 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5693 | miRNA Mature ID | miR-5693 | ||
|
miRNA Sequence |
GCAGUGGCUCUGAAAUGAACUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 42 |
miR-5698 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5698 | miRNA Mature ID | miR-5698 | ||
|
miRNA Sequence |
UGGGGGAGUGCAGUGAUUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 43 |
miR-590 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-590 | miRNA Mature ID | miR-590-3p | ||
|
miRNA Sequence |
UAAUUUUAUGUAUAAGCUAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 44 |
miR-624 directly targets SLC16A10 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-624 | miRNA Mature ID | miR-624-3p | ||
|
miRNA Sequence |
CACAAGGUAUUGGUAUUACCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 45 |
miR-6499 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6499 | miRNA Mature ID | miR-6499-3p | ||
|
miRNA Sequence |
AGCAGUGUUUGUUUUGCCCACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 46 |
miR-6504 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6504 | miRNA Mature ID | miR-6504-3p | ||
|
miRNA Sequence |
CAUUACAGCACAGCCAUUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 47 |
miR-6720 directly targets SLC16A10 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6720 | miRNA Mature ID | miR-6720-3p | ||
|
miRNA Sequence |
CGCGCCUGCAGGAACUGGUAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 48 |
miR-6722 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6722 | miRNA Mature ID | miR-6722-5p | ||
|
miRNA Sequence |
AGGCGCACCCGACCACAUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 49 |
miR-6746 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6746 | miRNA Mature ID | miR-6746-3p | ||
|
miRNA Sequence |
CAGCCGCCGCCUGUCUCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 50 |
miR-6758 directly targets SLC16A10 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6758 | miRNA Mature ID | miR-6758-3p | ||
|
miRNA Sequence |
ACUCAUUCUCCUCUGUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 51 |
miR-6807 directly targets SLC16A10 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6807 | miRNA Mature ID | miR-6807-5p | ||
|
miRNA Sequence |
GUGAGCCAGUGGAAUGGAGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 52 |
miR-6832 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6832 | miRNA Mature ID | miR-6832-5p | ||
|
miRNA Sequence |
AGUAGAGAGGAAAAGUUAGGGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 53 |
miR-6879 directly targets SLC16A10 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6879 | miRNA Mature ID | miR-6879-3p | ||
|
miRNA Sequence |
UGUCACCCGCUCCUUGCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 54 |
miR-6890 directly targets SLC16A10 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6890 | miRNA Mature ID | miR-6890-3p | ||
|
miRNA Sequence |
CCACUGCCUAUGCCCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Left ventricular cardiac tissues of human | ||||
|
Epigenetic Phenomenon 55 |
miR-7151 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7151 | miRNA Mature ID | miR-7151-3p | ||
|
miRNA Sequence |
CUACAGGCUGGAAUGGGCUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 56 |
miR-942 directly targets SLC16A10 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-942 | miRNA Mature ID | miR-942-3p | ||
|
miRNA Sequence |
CACAUGGCCGAAACAGAGAAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.