Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0106 Transporter Info
Gene Name SLC16A2
Transporter Name Monocarboxylate transporter 8
Gene ID
6567
UniProt ID
P36021
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A2 in hepatocellular carcinoma [ 1 ]

Location

 5'UTR (cg05373457)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 2.16E-10; Z-score: 2.64E+00

Methylation in Case

 4.59E-01 (Median) Methylation in Control 3.25E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A2 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg03424927)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 1.89E-04; Z-score: 8.75E-01

Methylation in Case

 7.92E-01 (Median) Methylation in Control 6.89E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Bladder cancer

          15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 TSS1500 (cg24663315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 3.23E-03; Z-score: 1.77E+00

Methylation in Case

 8.80E-02 (Median) Methylation in Control 6.95E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 TSS1500 (cg04317640)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 6.72E-03; Z-score: 9.78E-02

Methylation in Case

 4.60E-02 (Median) Methylation in Control 4.49E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 TSS1500 (cg03280420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 7.68E-03; Z-score: 6.95E-01

Methylation in Case

 2.86E-02 (Median) Methylation in Control 2.27E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 TSS200 (cg03055372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 1.37E-02; Z-score: 9.63E-02

Methylation in Case

 3.96E-02 (Median) Methylation in Control 3.81E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 1stExon (cg03580328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 6.44E-03; Z-score: 9.17E-01

Methylation in Case

 1.72E-02 (Median) Methylation in Control 1.39E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 1stExon (cg06277838)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 2.73E-02; Z-score: -8.46E-01

Methylation in Case

 1.07E-01 (Median) Methylation in Control 1.18E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 1stExon (cg09210933)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.91E-02; Z-score: -1.67E-01

Methylation in Case

 7.21E-02 (Median) Methylation in Control 7.41E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 Body (cg08605656)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.16E+00 Statistic Test p-value: 3.25E-06; Z-score: 7.56E+00

Methylation in Case

 5.45E-01 (Median) Methylation in Control 2.53E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 Body (cg03424927)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 6.75E-05; Z-score: -6.50E+00

Methylation in Case

 8.17E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 Body (cg15236541)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.90E+00 Statistic Test p-value: 6.06E-04; Z-score: 2.59E+00

Methylation in Case

 9.89E-02 (Median) Methylation in Control 5.22E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 Body (cg25943872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 1.96E-03; Z-score: 1.96E+00

Methylation in Case

 1.25E-01 (Median) Methylation in Control 9.40E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 Body (cg19214916)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.38E+00 Statistic Test p-value: 2.46E-03; Z-score: 3.22E+00

Methylation in Case

 2.56E-01 (Median) Methylation in Control 1.86E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 Body (cg22750044)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 2.56E-03; Z-score: 8.01E-01

Methylation in Case

 1.87E-01 (Median) Methylation in Control 1.66E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 14

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 Body (cg06805513)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.58E+00 Statistic Test p-value: 1.10E-02; Z-score: 6.88E-01

Methylation in Case

 1.94E-02 (Median) Methylation in Control 1.23E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 15

 Methylation of SLC16A2 in bladder cancer [ 2 ]

Location

 3'UTR (cg21154114)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 4.30E-04; Z-score: -3.39E+00

Methylation in Case

 8.26E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A2 in pancretic ductal adenocarcinoma [ 3 ]

Location

 TSS1500 (cg12408911)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.99E-02; Z-score: -7.12E-01

Methylation in Case

 7.01E-01 (Median) Methylation in Control 7.49E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A2 in pancretic ductal adenocarcinoma [ 3 ]

Location

 TSS200 (cg21557030)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.65E+00 Statistic Test p-value: 2.66E-26; Z-score: 4.49E+00

Methylation in Case

 2.70E-01 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A2 in pancretic ductal adenocarcinoma [ 3 ]

Location

 TSS200 (cg01894048)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.96E+00 Statistic Test p-value: 3.11E-23; Z-score: 4.35E+00

Methylation in Case

 2.92E-01 (Median) Methylation in Control 9.88E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A2 in pancretic ductal adenocarcinoma [ 3 ]

Location

 TSS200 (cg22919115)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 5.55E-10; Z-score: -1.57E+00

Methylation in Case

 3.73E-01 (Median) Methylation in Control 4.47E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A2 in pancretic ductal adenocarcinoma [ 3 ]

Location

 TSS200 (cg10387551)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 4.78E+00 Statistic Test p-value: 7.41E-08; Z-score: 1.97E+00

Methylation in Case

 3.95E-01 (Median) Methylation in Control 8.27E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC16A2 in pancretic ductal adenocarcinoma [ 3 ]

Location

 TSS200 (cg06697339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 1.17E-06; Z-score: 1.10E+00

Methylation in Case

 7.86E-02 (Median) Methylation in Control 5.89E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC16A2 in pancretic ductal adenocarcinoma [ 3 ]

Location

 Body (ch.2.3493243F)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.65E+00 Statistic Test p-value: 1.78E-06; Z-score: -1.42E+00

Methylation in Case

 1.10E-01 (Median) Methylation in Control 1.81E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC16A2 in pancretic ductal adenocarcinoma [ 3 ]

Location

 Body (cg18563642)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 1.67E-04; Z-score: -1.29E+00

Methylation in Case

 6.12E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC16A2 in pancretic ductal adenocarcinoma [ 3 ]

Location

 Body (cg19773466)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 8.43E-03; Z-score: -7.46E-01

Methylation in Case

 5.46E-01 (Median) Methylation in Control 6.06E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Breast cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A2 in breast cancer [ 4 ]

Location

 TSS200 (cg03055372)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 3.49E-05; Z-score: -8.31E-01

Methylation in Case

 2.60E-01 (Median) Methylation in Control 3.28E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A2 in breast cancer [ 4 ]

Location

 Body (cg08605656)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.38E+00 Statistic Test p-value: 1.10E-07; Z-score: 1.29E+00

Methylation in Case

 4.11E-01 (Median) Methylation in Control 2.99E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A2 in breast cancer [ 4 ]

Location

 Body (cg15236541)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.38E+00 Statistic Test p-value: 1.39E-07; Z-score: 1.63E+00

Methylation in Case

 4.67E-01 (Median) Methylation in Control 3.39E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A2 in breast cancer [ 4 ]

Location

 Body (cg22750044)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 6.42E-06; Z-score: 1.04E+00

Methylation in Case

 4.63E-01 (Median) Methylation in Control 4.08E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A2 in breast cancer [ 4 ]

Location

 Body (cg25943872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.38E-04; Z-score: 7.99E-01

Methylation in Case

 3.95E-01 (Median) Methylation in Control 3.50E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC16A2 in breast cancer [ 4 ]

Location

 Body (cg18787045)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 1.59E-04; Z-score: -1.05E+00

Methylation in Case

 7.71E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC16A2 in breast cancer [ 4 ]

Location

 Body (cg19214916)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 2.39E-02; Z-score: 5.85E-01

Methylation in Case

 4.48E-01 (Median) Methylation in Control 3.83E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC16A2 in breast cancer [ 4 ]

Location

 Body (cg06805513)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 4.25E-02; Z-score: 3.16E-01

Methylation in Case

 3.91E-01 (Median) Methylation in Control 3.64E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC16A2 in breast cancer [ 4 ]

Location

 3'UTR (cg21154114)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.85E-03; Z-score: -7.15E-01

Methylation in Case

 7.27E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A2 in colorectal cancer [ 5 ]

Location

 Body (cg15236541)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.40E+00 Statistic Test p-value: 7.48E-04; Z-score: 9.20E-01

Methylation in Case

 5.11E-01 (Median) Methylation in Control 3.64E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A2 in colorectal cancer [ 5 ]

Location

 Body (cg19214916)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 1.36E-03; Z-score: 7.68E-01

Methylation in Case

 5.14E-01 (Median) Methylation in Control 4.28E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A2 in colorectal cancer [ 5 ]

Location

 Body (cg06805513)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 3.09E-03; Z-score: 5.84E-01

Methylation in Case

 4.71E-01 (Median) Methylation in Control 3.52E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A2 in colorectal cancer [ 5 ]

Location

 Body (cg03424927)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.49E-03; Z-score: -6.50E-01

Methylation in Case

 8.54E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A2 in colorectal cancer [ 5 ]

Location

 Body (cg25943872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 4.69E-03; Z-score: 5.51E-01

Methylation in Case

 6.18E-01 (Median) Methylation in Control 5.23E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC16A2 in colorectal cancer [ 5 ]

Location

 Body (cg08605656)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 5.28E-03; Z-score: 8.07E-01

Methylation in Case

 5.57E-01 (Median) Methylation in Control 4.52E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC16A2 in colorectal cancer [ 5 ]

Location

 Body (cg22750044)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 4.25E-02; Z-score: 5.04E-01

Methylation in Case

 7.02E-01 (Median) Methylation in Control 6.22E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A2 in lung adenocarcinoma [ 6 ]

Location

 Body (cg08605656)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 4.03E-02; Z-score: 1.16E+00

Methylation in Case

 4.93E-01 (Median) Methylation in Control 4.49E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-17 directly targets SLC16A2 [ 7 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

 CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.