Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0111 Transporter Info
Gene Name SLC16A7
Transporter Name Monocarboxylate transporter 2
Gene ID
9194
UniProt ID
O60669
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg00178984)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 4.70E-09; Z-score: -1.32E+00

Methylation in Case

 7.23E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A7 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg10812247)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 3.39E-12; Z-score: -1.82E+00

Methylation in Case

 6.77E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in bladder cancer [ 2 ]

Location

 5'UTR (cg00178984)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 5.98E-03; Z-score: -1.25E+00

Methylation in Case

 8.24E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A7 in bladder cancer [ 2 ]

Location

 TSS1500 (cg11871280)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 5.78E-04; Z-score: -6.28E+00

Methylation in Case

 8.27E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A7 in bladder cancer [ 2 ]

Location

 Body (cg26664737)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 8.96E-16; Z-score: -1.48E+01

Methylation in Case

 6.32E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A7 in bladder cancer [ 2 ]

Location

 Body (cg26090940)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.12E+00 Statistic Test p-value: 1.90E-09; Z-score: -1.15E+01

Methylation in Case

 2.58E-01 (Median) Methylation in Control 5.48E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A7 in bladder cancer [ 2 ]

Location

 3'UTR (cg10812247)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 2.19E-06; Z-score: -5.58E+00

Methylation in Case

 5.20E-01 (Median) Methylation in Control 6.88E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in breast cancer [ 3 ]

Location

 5'UTR (cg00178984)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 2.35E-02; Z-score: -5.04E-01

Methylation in Case

 7.35E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A7 in breast cancer [ 3 ]

Location

 TSS1500 (cg26353859)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 8.83E-07; Z-score: -1.18E+00

Methylation in Case

 8.34E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A7 in breast cancer [ 3 ]

Location

 Body (cg26664737)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 2.62E-08; Z-score: -1.48E+00

Methylation in Case

 7.31E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A7 in breast cancer [ 3 ]

Location

 Body (cg26090940)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 2.63E-03; Z-score: -7.11E-01

Methylation in Case

 4.80E-01 (Median) Methylation in Control 5.25E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in colorectal cancer [ 4 ]

Location

 5'UTR (cg00178984)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.60E+00 Statistic Test p-value: 4.79E-15; Z-score: -7.52E+00

Methylation in Case

 5.28E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A7 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg11871280)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 1.03E-12; Z-score: -5.83E+00

Methylation in Case

 7.36E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A7 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg26353859)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 6.65E-10; Z-score: -6.08E+00

Methylation in Case

 8.53E-01 (Median) Methylation in Control 9.29E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A7 in colorectal cancer [ 4 ]

Location

 Body (cg26664737)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 8.49E-19; Z-score: -4.79E+00

Methylation in Case

 7.98E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A7 in colorectal cancer [ 4 ]

Location

 Body (cg26090940)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 2.37E-12; Z-score: -3.04E+00

Methylation in Case

 5.44E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC16A7 in colorectal cancer [ 4 ]

Location

 3'UTR (cg10812247)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 6.19E-05; Z-score: -1.08E+00

Methylation in Case

 5.90E-01 (Median) Methylation in Control 6.66E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in depression [ 5 ]

Location

 TSS1500 (cg11871280)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 2.24E-02; Z-score: 1.76E-01

Methylation in Case

 8.65E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg11871280)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 7.73E-03; Z-score: -4.06E-01

Methylation in Case

 8.50E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A7 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg26353859)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 7.78E-03; Z-score: -4.88E-01

Methylation in Case

 7.89E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A7 in hepatocellular carcinoma [ 6 ]

Location

 3'UTR (cg10812247)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 7.81E-06; Z-score: -1.25E+00

Methylation in Case

 4.53E-01 (Median) Methylation in Control 5.55E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS1500 (cg01823544)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.23E-04; Z-score: 3.77E-02

Methylation in Case

 9.02E-02 (Median) Methylation in Control 8.91E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A7 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS1500 (cg05203217)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 8.20E-03; Z-score: 6.94E-01

Methylation in Case

 6.45E-01 (Median) Methylation in Control 5.52E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A7 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS200 (cg18278638)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 5.93E-14; Z-score: 2.28E+00

Methylation in Case

 5.72E-01 (Median) Methylation in Control 4.80E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A7 in pancretic ductal adenocarcinoma [ 7 ]

Location

 Body (cg08149333)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.80E-02; Z-score: -3.45E-01

Methylation in Case

 4.72E-02 (Median) Methylation in Control 5.14E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in panic disorder [ 8 ]

Location

 TSS1500 (cg11871280)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.39E+00 Statistic Test p-value: 2.21E-05; Z-score: -7.12E-01

Methylation in Case

 8.39E-01 (Median) Methylation in Control 1.17E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A7 in panic disorder [ 8 ]

Location

 TSS1500 (cg26353859)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -7.54E-01 Statistic Test p-value: 3.10E-03; Z-score: -4.41E-01

Methylation in Case

 -5.79E-01 (Median) Methylation in Control -4.36E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A7 in panic disorder [ 8 ]

Location

 3'UTR (cg10812247)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -7.77E-01 Statistic Test p-value: 4.11E-02; Z-score: -3.17E-01

Methylation in Case

 -4.82E-01 (Median) Methylation in Control -3.74E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg26353859)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 5.40E-08; Z-score: -1.55E+00

Methylation in Case

 8.66E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in HIV infection [ 10 ]

Location

 Body (cg26090940)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 1.02E-05; Z-score: 2.19E+00

Methylation in Case

 6.72E-01 (Median) Methylation in Control 5.83E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A7 in HIV infection [ 10 ]

Location

 Body (cg26664737)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 6.14E-05; Z-score: 1.26E+00

Methylation in Case

 8.61E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in lung adenocarcinoma [ 11 ]

Location

 Body (cg26664737)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 4.85E-04; Z-score: -3.81E+00

Methylation in Case

 7.78E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in prostate cancer [ 12 ]

Location

 Body (cg19378389)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 4.51E-02; Z-score: 2.60E+00

Methylation in Case

 9.37E-01 (Median) Methylation in Control 8.83E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A7 in systemic lupus erythematosus [ 13 ]

Location

 Body (cg26664737)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.66E-02; Z-score: -2.89E-01

Methylation in Case

 8.24E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypomethylation of SLC16A7 in adenoma [ 15 ]

Epigenetic Type

 Methylation Experiment Method Bisulfite sequencing

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

Additional Notes

 SLC16A7 was hypermethylated in adenomatous-nontumor comparison.

  Uterine carcinosarcoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC16A7 in uterine carcinosarcoma than that in healthy individual

Studied Phenotype

 Uterine carcinosarcoma [ICD-11:2B5F]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 8.86E-05; Fold-change: -0.255548543; Z-score: -1.50284973
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Esthesioneuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC16A7 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

 Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.89E-15; Fold-change: -0.592830691; Z-score: -26.66473306
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Peripheral neuroectodermal tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC16A7 in peripheral neuroectodermal tumour than that in healthy individual

Studied Phenotype

 Peripheral neuroectodermal tumour [ICD-11:2B52]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 5.24E-06; Fold-change: -0.328996828; Z-score: -3.270645346
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Prostate cancer metastasis

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC16A7 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

 Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 3.70E-05; Fold-change: -0.542233755; Z-score: -83.48533454
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

Histone acetylation

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypoacetylation of SLC16A7 in breast cancer (compare with beta-hydroxybutyrate-treatment counterpart cells) [ 14 ]

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC16A7 Experiment Method RT-qPCR

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Multiple cell lines of human

Additional Notes

 Treatment with -hydroxybutyrate, breast cancer cells expressing MCT2 increase the global histone H3K9 acetylation and upregulate several tumour-promoting genes.

microRNA

  Unclear Phenotype

          12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-192 directly targets SLC16A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-20a directly targets SLC16A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-20a miRNA Mature ID miR-20a-3p

miRNA Sequence

 ACUGCAUUAUGAGCACUUAAAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-215 directly targets SLC16A7 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

 AUGACCUAUGAAUUGACAGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-329 directly targets SLC16A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-329 miRNA Mature ID miR-329-5p

miRNA Sequence

 GAGGUUUUCUGGGUUUCUGUUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-4423 directly targets SLC16A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4423 miRNA Mature ID miR-4423-3p

miRNA Sequence

 AUAGGCACCAAAAAGCAACAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-4464 directly targets SLC16A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4464 miRNA Mature ID miR-4464

miRNA Sequence

 AAGGUUUGGAUAGAUGCAAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-4729 directly targets SLC16A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4729 miRNA Mature ID miR-4729

miRNA Sequence

 UCAUUUAUCUGUUGGGAAGCUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-4748 directly targets SLC16A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4748 miRNA Mature ID miR-4748

miRNA Sequence

 GAGGUUUGGGGAGGAUUUGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-496 directly targets SLC16A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-496 miRNA Mature ID miR-496

miRNA Sequence

 UGAGUAUUACAUGGCCAAUCUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-506 directly targets SLC16A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-506 miRNA Mature ID miR-506-5p

miRNA Sequence

 UAUUCAGGAAGGUGUUACUUAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-759 directly targets SLC16A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-759 miRNA Mature ID miR-759

miRNA Sequence

 GCAGAGUGCAAACAAUUUUGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-892c directly targets SLC16A7 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-892c miRNA Mature ID miR-892c-5p

miRNA Sequence

 UAUUCAGAAAGGUGCCAGUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
13 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14 Adipocytes promote malignant growth of breast tumours with monocarboxylate transporter 2 expression via beta-hydroxybutyrate. Nat Commun. 2017 Mar 10;8:14706.
15 Gene promoter and exon DNA methylation changes in colon cancer development - mRNA expression and tumor mutation alterations. BMC Cancer. 2018 Jun 27;18(1):695.
16 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
17 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.