Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0113 Transporter Info
Gene Name	SLC16A9
Transporter Name	Monocarboxylate transporter 9
Gene ID	220963
UniProt ID	Q7RTY1

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg02164452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.41E+00	Statistic Test	p-value: 1.23E-08; Z-score: -1.82E+00
Methylation in Case	1.24E-01 (Median)	Methylation in Control	2.98E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC16A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg03462556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.60E+00	Statistic Test	p-value: 1.79E-08; Z-score: 1.57E+00
Methylation in Case	8.35E-01 (Median)	Methylation in Control	5.22E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC16A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg04215870)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 2.77E-08; Z-score: 1.62E+00
Methylation in Case	8.26E-01 (Median)	Methylation in Control	6.23E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC16A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg04605148)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 3.50E-08; Z-score: -1.37E+00
Methylation in Case	6.71E-01 (Median)	Methylation in Control	7.36E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC16A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg04882188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 4.06E-08; Z-score: -8.82E-01
Methylation in Case	4.38E-01 (Median)	Methylation in Control	5.36E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC16A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg06578117)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 6.34E-08; Z-score: -1.12E+00
Methylation in Case	4.01E-01 (Median)	Methylation in Control	5.31E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC16A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg19880462)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 3.61E-06; Z-score: 1.23E+00
Methylation in Case	8.58E-01 (Median)	Methylation in Control	7.69E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC16A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg22544571)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 6.07E-06; Z-score: 1.65E+00
Methylation in Case	8.48E-01 (Median)	Methylation in Control	7.32E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC16A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg24969942)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 8.67E-06; Z-score: -1.03E+00
Methylation in Case	6.49E-01 (Median)	Methylation in Control	7.21E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC16A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg08535112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 7.26E-03; Z-score: 4.22E-01
Methylation in Case	1.39E-01 (Median)	Methylation in Control	1.27E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC16A9 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg03227481)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 7.61E-15; Z-score: -2.69E+00
Methylation in Case	7.57E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in bladder cancer			[ 2 ]
Location	5'UTR (cg19880462)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.03E+00	Statistic Test	p-value: 5.93E-09; Z-score: -7.25E+00
Methylation in Case	1.47E-01 (Median)	Methylation in Control	2.99E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC16A9 in bladder cancer			[ 2 ]
Location	5'UTR (cg04605148)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 3.30E-07; Z-score: -6.74E+00
Methylation in Case	5.65E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC16A9 in bladder cancer			[ 2 ]
Location	5'UTR (cg22544571)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 2.56E-05; Z-score: -4.25E+00
Methylation in Case	5.59E-01 (Median)	Methylation in Control	7.70E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC16A9 in bladder cancer			[ 2 ]
Location	5'UTR (cg04882188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.03E+00	Statistic Test	p-value: 3.19E-03; Z-score: -3.08E+00
Methylation in Case	8.01E-02 (Median)	Methylation in Control	1.62E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC16A9 in bladder cancer			[ 2 ]
Location	5'UTR (cg24969942)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.13E+00	Statistic Test	p-value: 2.90E-02; Z-score: -1.74E+00
Methylation in Case	1.77E-02 (Median)	Methylation in Control	3.77E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC16A9 in bladder cancer			[ 2 ]
Location	TSS1500 (cg00219151)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 2.25E-03; Z-score: 2.76E+00
Methylation in Case	9.01E-01 (Median)	Methylation in Control	8.11E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC16A9 in bladder cancer			[ 2 ]
Location	Body (cg08535112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 3.77E-06; Z-score: -5.35E+00
Methylation in Case	6.17E-01 (Median)	Methylation in Control	7.96E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC16A9 in bladder cancer			[ 2 ]
Location	Body (cg24603972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 2.27E-04; Z-score: -5.22E+00
Methylation in Case	6.07E-01 (Median)	Methylation in Control	7.87E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	5'UTR (cg04605148)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.01E-07; Z-score: -1.21E+00
Methylation in Case	8.01E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	5'UTR (cg19880462)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 5.37E-07; Z-score: -1.54E+00
Methylation in Case	2.34E-01 (Median)	Methylation in Control	3.03E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	5'UTR (cg04882188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.44E+00	Statistic Test	p-value: 9.91E-06; Z-score: -1.81E+00
Methylation in Case	1.21E-01 (Median)	Methylation in Control	1.74E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	5'UTR (cg03462556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.39E-04; Z-score: -6.57E-01
Methylation in Case	9.02E-01 (Median)	Methylation in Control	9.14E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	5'UTR (cg22544571)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.79E-03; Z-score: 6.94E-01
Methylation in Case	7.21E-01 (Median)	Methylation in Control	6.61E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	5'UTR (cg24969942)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 6.07E-03; Z-score: 3.01E-01
Methylation in Case	2.42E-02 (Median)	Methylation in Control	2.00E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	5'UTR (cg06578117)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.60E-02; Z-score: -6.68E-01
Methylation in Case	7.04E-01 (Median)	Methylation in Control	7.84E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	TSS1500 (cg00219151)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 5.53E-04; Z-score: 9.50E-01
Methylation in Case	8.90E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	TSS1500 (cg20156450)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.02E+00	Statistic Test	p-value: 3.90E-02; Z-score: 5.74E-01
Methylation in Case	3.51E-02 (Median)	Methylation in Control	1.74E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	TSS200 (cg16430909)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.23E-02; Z-score: 5.24E-01
Methylation in Case	3.16E-02 (Median)	Methylation in Control	2.65E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	TSS200 (cg06373764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 1.37E-02; Z-score: 3.40E-01
Methylation in Case	1.62E-02 (Median)	Methylation in Control	1.41E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	TSS200 (cg20627835)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 4.71E-02; Z-score: 6.77E-01
Methylation in Case	3.59E-02 (Median)	Methylation in Control	2.70E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC16A9 in breast cancer			[ 3 ]
Location	Body (cg08535112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.18E-02; Z-score: -3.64E-01
Methylation in Case	7.07E-01 (Median)	Methylation in Control	7.55E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg22544571)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 5.49E-05; Z-score: -1.98E+00
Methylation in Case	7.47E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC16A9 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg02164452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 4.09E-03; Z-score: 5.47E-01
Methylation in Case	4.03E-02 (Median)	Methylation in Control	3.41E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC16A9 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg04215870)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 5.52E-03; Z-score: 6.16E-01
Methylation in Case	4.05E-02 (Median)	Methylation in Control	3.63E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC16A9 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg24969942)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 2.11E-02; Z-score: 4.13E-01
Methylation in Case	2.11E-02 (Median)	Methylation in Control	1.77E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC16A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg00219151)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 3.64E-14; Z-score: 3.15E+00
Methylation in Case	9.70E-01 (Median)	Methylation in Control	7.88E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC16A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg20156450)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 3.05E-03; Z-score: 9.76E-01
Methylation in Case	2.68E-02 (Median)	Methylation in Control	2.38E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC16A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg06373764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.29E-04; Z-score: 4.59E-01
Methylation in Case	1.67E-02 (Median)	Methylation in Control	1.58E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC16A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg16430909)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 4.33E-03; Z-score: 7.18E-01
Methylation in Case	1.99E-02 (Median)	Methylation in Control	1.78E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC16A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg20627835)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 4.38E-03; Z-score: 1.45E-01
Methylation in Case	2.35E-02 (Median)	Methylation in Control	2.31E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC16A9 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS200 (cg27346088)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 2.76E-02; Z-score: 3.14E-01
Methylation in Case	7.05E-02 (Median)	Methylation in Control	6.55E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in colorectal cancer			[ 5 ]
Location	5'UTR (cg06578117)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 9.24E-03; Z-score: -4.01E-01
Methylation in Case	8.74E-01 (Median)	Methylation in Control	8.86E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC16A9 in colorectal cancer			[ 5 ]
Location	5'UTR (cg02164452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.67E-02; Z-score: 1.78E-01
Methylation in Case	4.88E-02 (Median)	Methylation in Control	4.47E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC16A9 in colorectal cancer			[ 5 ]
Location	5'UTR (cg24969942)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 2.02E-02; Z-score: -1.27E-03
Methylation in Case	2.14E-02 (Median)	Methylation in Control	2.15E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC16A9 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg20156450)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 4.32E-02; Z-score: 9.64E-02
Methylation in Case	2.32E-02 (Median)	Methylation in Control	2.19E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC16A9 in colorectal cancer			[ 5 ]
Location	TSS200 (cg27346088)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 3.94E-05; Z-score: 1.37E+00
Methylation in Case	7.54E-02 (Median)	Methylation in Control	5.83E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC16A9 in colorectal cancer			[ 5 ]
Location	TSS200 (cg20627835)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 1.49E-02; Z-score: 7.04E-01
Methylation in Case	2.19E-02 (Median)	Methylation in Control	1.69E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC16A9 in colorectal cancer			[ 5 ]
Location	TSS200 (cg06373764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.81E-02; Z-score: 3.05E-01
Methylation in Case	1.61E-02 (Median)	Methylation in Control	1.44E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC16A9 in colorectal cancer			[ 5 ]
Location	TSS200 (cg20193173)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.76E-02; Z-score: 3.71E-01
Methylation in Case	8.42E-02 (Median)	Methylation in Control	7.98E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC16A9 in colorectal cancer			[ 5 ]
Location	TSS200 (cg12583927)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 4.42E-02; Z-score: 5.23E-01
Methylation in Case	3.91E-02 (Median)	Methylation in Control	3.32E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC16A9 in colorectal cancer			[ 5 ]
Location	Body (cg08535112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.32E-06; Z-score: -2.31E+00
Methylation in Case	7.99E-01 (Median)	Methylation in Control	8.66E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	15 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg24969942)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.31E+00	Statistic Test	p-value: 2.12E-08; Z-score: 4.63E+00
Methylation in Case	2.40E-01 (Median)	Methylation in Control	7.26E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg04605148)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.93E-08; Z-score: -9.40E-01
Methylation in Case	7.28E-01 (Median)	Methylation in Control	7.81E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg02164452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.20E+00	Statistic Test	p-value: 1.10E-07; Z-score: 3.49E+00
Methylation in Case	2.33E-01 (Median)	Methylation in Control	1.06E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg03462556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.39E-06; Z-score: -2.20E+00
Methylation in Case	8.44E-01 (Median)	Methylation in Control	8.86E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	5'UTR (cg04215870)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.56E-02; Z-score: 1.65E-01
Methylation in Case	7.76E-02 (Median)	Methylation in Control	7.55E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg20156450)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 6.10E-04; Z-score: -1.23E-01
Methylation in Case	3.69E-02 (Median)	Methylation in Control	3.94E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg00219151)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 8.81E-03; Z-score: -2.36E-01
Methylation in Case	8.79E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg16430909)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 4.05E-04; Z-score: 1.89E-01
Methylation in Case	4.28E-02 (Median)	Methylation in Control	3.91E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg06373764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 1.64E-03; Z-score: 3.78E-02
Methylation in Case	3.37E-02 (Median)	Methylation in Control	3.30E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg27346088)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 2.45E-03; Z-score: 2.66E-01
Methylation in Case	8.95E-02 (Median)	Methylation in Control	8.21E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg12570419)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.49E+00	Statistic Test	p-value: 1.70E-18; Z-score: -3.87E+00
Methylation in Case	4.81E-01 (Median)	Methylation in Control	7.17E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg01272393)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.52E+00	Statistic Test	p-value: 6.36E-16; Z-score: -4.95E+00
Methylation in Case	5.13E-01 (Median)	Methylation in Control	7.81E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg23603573)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 3.11E-10; Z-score: -3.22E+00
Methylation in Case	7.31E-01 (Median)	Methylation in Control	8.47E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg24603972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 5.54E-04; Z-score: -3.51E-01
Methylation in Case	8.18E-01 (Median)	Methylation in Control	8.57E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC16A9 in hepatocellular carcinoma			[ 6 ]
Location	3'UTR (cg03227481)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.30E-08; Z-score: -1.17E+00
Methylation in Case	8.22E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in HIV infection			[ 7 ]
Location	5'UTR (cg24969942)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.37E+00	Statistic Test	p-value: 1.25E-04; Z-score: 1.91E+00
Methylation in Case	4.36E-02 (Median)	Methylation in Control	1.29E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC16A9 in HIV infection			[ 7 ]
Location	5'UTR (cg02164452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.55E+00	Statistic Test	p-value: 2.55E-04; Z-score: 1.84E+00
Methylation in Case	7.69E-02 (Median)	Methylation in Control	4.97E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC16A9 in HIV infection			[ 7 ]
Location	5'UTR (cg04882188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 9.30E-04; Z-score: 1.06E+00
Methylation in Case	9.10E-02 (Median)	Methylation in Control	7.49E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC16A9 in HIV infection			[ 7 ]
Location	5'UTR (cg06578117)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.87E-03; Z-score: -1.31E+00
Methylation in Case	8.20E-01 (Median)	Methylation in Control	8.61E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC16A9 in HIV infection			[ 7 ]
Location	5'UTR (cg04215870)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 7.21E-03; Z-score: 9.78E-01
Methylation in Case	9.43E-02 (Median)	Methylation in Control	7.94E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC16A9 in HIV infection			[ 7 ]
Location	5'UTR (cg19880462)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 1.34E-02; Z-score: 7.64E-01
Methylation in Case	1.96E-01 (Median)	Methylation in Control	1.75E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC16A9 in HIV infection			[ 7 ]
Location	TSS1500 (cg10845249)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 1.23E-02; Z-score: 6.83E-01
Methylation in Case	1.35E-01 (Median)	Methylation in Control	1.16E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC16A9 in HIV infection			[ 7 ]
Location	TSS1500 (cg20156450)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 1.37E-02; Z-score: 7.40E-01
Methylation in Case	5.98E-02 (Median)	Methylation in Control	4.64E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC16A9 in HIV infection			[ 7 ]
Location	TSS200 (cg16430909)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 2.34E-02; Z-score: 4.93E-01
Methylation in Case	1.92E-02 (Median)	Methylation in Control	1.35E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC16A9 in HIV infection			[ 7 ]
Location	TSS200 (cg06373764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.81E+00	Statistic Test	p-value: 2.58E-02; Z-score: 5.60E-01
Methylation in Case	2.18E-02 (Median)	Methylation in Control	1.20E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC16A9 in HIV infection			[ 7 ]
Location	TSS200 (cg27346088)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 4.93E-02; Z-score: 4.79E-01
Methylation in Case	1.08E-01 (Median)	Methylation in Control	9.80E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC16A9 in HIV infection			[ 7 ]
Location	Body (cg08535112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 1.83E-06; Z-score: -1.94E+00
Methylation in Case	7.26E-01 (Median)	Methylation in Control	8.11E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in lung adenocarcinoma			[ 8 ]
Location	5'UTR (cg22544571)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 4.18E-02; Z-score: 1.07E+00
Methylation in Case	7.61E-01 (Median)	Methylation in Control	7.08E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC16A9 in lung adenocarcinoma			[ 8 ]
Location	TSS1500 (cg10845249)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 3.60E-03; Z-score: 2.14E+00
Methylation in Case	1.84E-01 (Median)	Methylation in Control	1.50E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC16A9 in lung adenocarcinoma			[ 8 ]
Location	3'UTR (cg03227481)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 7.93E-03; Z-score: 1.40E+00
Methylation in Case	8.87E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	5'UTR (cg01393327)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 1.73E-02; Z-score: -1.66E-01
Methylation in Case	1.52E-01 (Median)	Methylation in Control	1.68E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg11735997)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.46E+00	Statistic Test	p-value: 7.09E-21; Z-score: 3.38E+00
Methylation in Case	4.65E-01 (Median)	Methylation in Control	3.19E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg04675747)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 1.92E-09; Z-score: -1.63E+00
Methylation in Case	3.77E-01 (Median)	Methylation in Control	5.17E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg08731720)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 2.81E-03; Z-score: -5.28E-01
Methylation in Case	4.04E-02 (Median)	Methylation in Control	4.45E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS1500 (cg22995232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 1.94E-02; Z-score: 6.50E-01
Methylation in Case	5.03E-01 (Median)	Methylation in Control	4.29E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg03940556)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 1.19E-06; Z-score: -1.28E+00
Methylation in Case	1.16E-01 (Median)	Methylation in Control	1.53E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg04670913)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 1.60E-04; Z-score: -6.69E-01
Methylation in Case	9.42E-02 (Median)	Methylation in Control	1.20E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	TSS200 (cg11264635)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.09E-03; Z-score: 1.05E+00
Methylation in Case	7.33E-01 (Median)	Methylation in Control	6.73E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg08758174)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 1.90E-05; Z-score: 1.35E+00
Methylation in Case	8.42E-01 (Median)	Methylation in Control	7.53E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg25518170)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 3.33E-03; Z-score: 1.08E+00
Methylation in Case	7.14E-01 (Median)	Methylation in Control	6.15E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg07489029)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 4.61E-03; Z-score: 7.01E-01
Methylation in Case	8.14E-01 (Median)	Methylation in Control	7.36E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	Body (cg17451688)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.31E-02; Z-score: 8.10E-01
Methylation in Case	8.84E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC16A9 in pancretic ductal adenocarcinoma			[ 9 ]
Location	3'UTR (cg10277956)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.80E-15; Z-score: -2.09E+00
Methylation in Case	7.38E-01 (Median)	Methylation in Control	8.12E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in panic disorder			[ 10 ]
Location	5'UTR (cg04605148)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -6.90E-01	Statistic Test	p-value: 2.83E-02; Z-score: -5.31E-01
Methylation in Case	-5.11E-01 (Median)	Methylation in Control	-3.52E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC16A9 in panic disorder			[ 10 ]
Location	5'UTR (cg02164452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.78E-01	Statistic Test	p-value: 3.92E-02; Z-score: 3.78E-01
Methylation in Case	-5.10E+00 (Median)	Methylation in Control	-5.22E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in papillary thyroid cancer			[ 11 ]
Location	5'UTR (cg04882188)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 3.64E-03; Z-score: 4.61E-01
Methylation in Case	9.45E-02 (Median)	Methylation in Control	8.69E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC16A9 in papillary thyroid cancer			[ 11 ]
Location	5'UTR (cg24969942)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 7.01E-03; Z-score: 4.14E-01
Methylation in Case	5.96E-02 (Median)	Methylation in Control	5.46E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC16A9 in papillary thyroid cancer			[ 11 ]
Location	TSS1500 (cg00219151)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.93E-03; Z-score: 6.51E-01
Methylation in Case	9.44E-01 (Median)	Methylation in Control	9.36E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC16A9 in papillary thyroid cancer			[ 11 ]
Location	TSS200 (cg20627835)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 3.84E-06; Z-score: 1.19E+00
Methylation in Case	6.86E-02 (Median)	Methylation in Control	6.14E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC16A9 in papillary thyroid cancer			[ 11 ]
Location	Body (cg24603972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.52E-10; Z-score: -1.98E+00
Methylation in Case	8.70E-01 (Median)	Methylation in Control	9.19E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC16A9 in papillary thyroid cancer			[ 11 ]
Location	Body (cg08535112)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.38E-02; Z-score: -1.54E-01
Methylation in Case	8.71E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Colon cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in colon adenocarcinoma			[ 12 ]
Location	TSS1500 (cg22434409)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.13E+00	Statistic Test	p-value: 1.99E-09; Z-score: 4.37E+00
Methylation in Case	7.32E-01 (Median)	Methylation in Control	3.44E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC16A9 in colon adenocarcinoma			[ 12 ]
Location	TSS1500 (cg22505977)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 2.27E-05; Z-score: -2.38E+00
Methylation in Case	4.02E-01 (Median)	Methylation in Control	5.68E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC16A9 in colon adenocarcinoma			[ 12 ]
Location	TSS1500 (cg08390254)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 8.07E-05; Z-score: -2.43E+00
Methylation in Case	5.47E-01 (Median)	Methylation in Control	6.39E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC16A9 in colon adenocarcinoma			[ 12 ]
Location	TSS1500 (cg07041488)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 8.64E-04; Z-score: -2.12E+00
Methylation in Case	5.42E-01 (Median)	Methylation in Control	6.83E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC16A9 in colon adenocarcinoma			[ 12 ]
Location	TSS1500 (cg14830815)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 4.06E-03; Z-score: -1.03E+00
Methylation in Case	3.73E-01 (Median)	Methylation in Control	4.02E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC16A9 in colon adenocarcinoma			[ 12 ]
Location	1stExon (cg13958974)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 4.94E-04; Z-score: 1.78E+00
Methylation in Case	4.56E-01 (Median)	Methylation in Control	3.75E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC16A9 in colon adenocarcinoma			[ 12 ]
Location	Body (cg05554939)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 6.62E-04; Z-score: 1.23E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	7.77E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC16A9 in colon adenocarcinoma			[ 12 ]
Location	Body (cg26929806)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 6.84E-04; Z-score: -2.51E+00
Methylation in Case	7.13E-01 (Median)	Methylation in Control	7.89E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC16A9 in colon adenocarcinoma			[ 12 ]
Location	Body (cg00244747)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 6.90E-04; Z-score: -2.23E+00
Methylation in Case	6.47E-01 (Median)	Methylation in Control	7.23E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC16A9 in colon adenocarcinoma			[ 12 ]
Location	Body (cg06577241)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 3.15E-03; Z-score: 1.60E+00
Methylation in Case	2.20E-01 (Median)	Methylation in Control	1.72E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC16A9 in depression			[ 13 ]
Location	TSS200 (cg20627835)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 3.62E-04; Z-score: 7.30E-01
Methylation in Case	6.89E-02 (Median)	Methylation in Control	6.25E-02 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	65 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	let-7a directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	let-7a	miRNA Mature ID	let-7a-5p
miRNA Sequence	UGAGGUAGUAGGUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 2	let-7b directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	let-7b	miRNA Mature ID	let-7b-5p
miRNA Sequence	UGAGGUAGUAGGUUGUGUGGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 3	let-7c directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	let-7c	miRNA Mature ID	let-7c-5p
miRNA Sequence	UGAGGUAGUAGGUUGUAUGGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 4	let-7d directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	let-7d	miRNA Mature ID	let-7d-5p
miRNA Sequence	AGAGGUAGUAGGUUGCAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 5	let-7e directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	let-7e	miRNA Mature ID	let-7e-5p
miRNA Sequence	UGAGGUAGGAGGUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 6	let-7f directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	let-7f	miRNA Mature ID	let-7f-5p
miRNA Sequence	UGAGGUAGUAGAUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 7	let-7g directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	let-7g	miRNA Mature ID	let-7g-5p
miRNA Sequence	UGAGGUAGUAGUUUGUACAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 8	let-7i directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	let-7i	miRNA Mature ID	let-7i-5p
miRNA Sequence	UGAGGUAGUAGUUUGUGCUGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 9	miR-1-3p directly targets SLC16A9			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-1-3p	miRNA Mature ID	miR-1-3p
miRNA Sequence	UGGAAUGUAAAGAAGUAUGUAU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 10	miR-106b directly targets SLC16A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-106b	miRNA Mature ID	miR-106b-5p
miRNA Sequence	UAAAGUGCUGACAGUGCAGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-1294 directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1294	miRNA Mature ID	miR-1294
miRNA Sequence	UGUGAGGUUGGCAUUGUUGUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 12	miR-153 directly targets SLC16A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-153	miRNA Mature ID	miR-153-3p
miRNA Sequence	UUGCAUAGUCACAAAAGUGAUC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 13	miR-17 directly targets SLC16A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-17	miRNA Mature ID	miR-17-5p
miRNA Sequence	CAAAGUGCUUACAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-18a directly targets SLC16A9			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-18a	miRNA Mature ID	miR-18a-3p
miRNA Sequence	ACUGCCCUAAGUGCUCCUUCUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-1913 directly targets SLC16A9			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1913	miRNA Mature ID	miR-1913
miRNA Sequence	UCUGCCCCCUCCGCUGCUGCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-194 directly targets SLC16A9			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-194	miRNA Mature ID	miR-194-5p
miRNA Sequence	UGUAACAGCAACUCCAUGUGGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 17	miR-202 directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-202	miRNA Mature ID	miR-202-3p
miRNA Sequence	AGAGGUAUAGGGCAUGGGAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 18	miR-20a directly targets SLC16A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-20a	miRNA Mature ID	miR-20a-5p
miRNA Sequence	UAAAGUGCUUAUAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-20b directly targets SLC16A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-20b	miRNA Mature ID	miR-20b-5p
miRNA Sequence	CAAAGUGCUCAUAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-2114 directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2114	miRNA Mature ID	miR-2114-5p
miRNA Sequence	UAGUCCCUUCCUUGAAGCGGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-31 directly targets SLC16A9			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-31	miRNA Mature ID	miR-31-3p
miRNA Sequence	UGCUAUGCCAACAUAUUGCCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-3120 directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3120	miRNA Mature ID	miR-3120-3p
miRNA Sequence	CACAGCAAGUGUAGACAGGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-3121 directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3121	miRNA Mature ID	miR-3121-3p
miRNA Sequence	UAAAUAGAGUAGGCAAAGGACA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 24	miR-3166 directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3166	miRNA Mature ID	miR-3166
miRNA Sequence	CGCAGACAAUGCCUACUGGCCUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-324 directly targets SLC16A9			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-324	miRNA Mature ID	miR-324-3p
miRNA Sequence	CCCACUGCCCCAGGUGCUGCUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-3606 directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3606	miRNA Mature ID	miR-3606-5p
miRNA Sequence	UUAGUGAAGGCUAUUUUAAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-3658 directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3658	miRNA Mature ID	miR-3658
miRNA Sequence	UUUAAGAAAACACCAUGGAGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-374b directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-374b	miRNA Mature ID	miR-374b-3p
miRNA Sequence	CUUAGCAGGUUGUAUUAUCAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-378a directly targets SLC16A9			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-378a	miRNA Mature ID	miR-378a-5p
miRNA Sequence	CUCCUGACUCCAGGUCCUGUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 30	miR-4276 directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4276	miRNA Mature ID	miR-4276
miRNA Sequence	CUCAGUGACUCAUGUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 31	miR-4458 directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4458	miRNA Mature ID	miR-4458
miRNA Sequence	AGAGGUAGGUGUGGAAGAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 32	miR-4500 directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4500	miRNA Mature ID	miR-4500
miRNA Sequence	UGAGGUAGUAGUUUCUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 33	miR-4511 directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4511	miRNA Mature ID	miR-4511
miRNA Sequence	GAAGAACUGUUGCAUUUGCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 34	miR-4522 directly targets SLC16A9			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4522	miRNA Mature ID	miR-4522
miRNA Sequence	UGACUCUGCCUGUAGGCCGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 35	miR-4712 directly targets SLC16A9			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4712	miRNA Mature ID	miR-4712-3p
miRNA Sequence	AAUGAGAGACCUGUACUGUAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 36	miR-4727 directly targets SLC16A9			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4727	miRNA Mature ID	miR-4727-5p
miRNA Sequence	AUCUGCCAGCUUCCACAGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 37	miR-4764 directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4764	miRNA Mature ID	miR-4764-5p
miRNA Sequence	UGGAUGUGGAAGGAGUUAUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 38	miR-4780 directly targets SLC16A9			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4780	miRNA Mature ID	miR-4780
miRNA Sequence	ACCCUUGAGCCUGAUCCCUAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 39	miR-4798 directly targets SLC16A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4798	miRNA Mature ID	miR-4798-3p
miRNA Sequence	AACUCACGAAGUAUACCGAAGU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 40	miR-5001 directly targets SLC16A9			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5001	miRNA Mature ID	miR-5001-3p
miRNA Sequence	UUCUGCCUCUGUCCAGGUCCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 41	miR-5190 directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5190	miRNA Mature ID	miR-5190
miRNA Sequence	CCAGUGACUGAGCUGGAGCCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 42	miR-519d directly targets SLC16A9			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-519d	miRNA Mature ID	miR-519d-3p
miRNA Sequence	CAAAGUGCCUCCCUUUAGAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 43	miR-539 directly targets SLC16A9			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-539	miRNA Mature ID	miR-539-5p
miRNA Sequence	GGAGAAAUUAUCCUUGGUGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 44	miR-545 directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-545	miRNA Mature ID	miR-545-3p
miRNA Sequence	UCAGCAAACAUUUAUUGUGUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 45	miR-548a directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548a	miRNA Mature ID	miR-548a-3p
miRNA Sequence	CAAAACUGGCAAUUACUUUUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 46	miR-548ar directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548ar	miRNA Mature ID	miR-548ar-3p
miRNA Sequence	UAAAACUGCAGUUAUUUUUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 47	miR-548az directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548az	miRNA Mature ID	miR-548az-3p
miRNA Sequence	AAAAACUGCAAUCACUUUUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 48	miR-548b directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548b	miRNA Mature ID	miR-548b-3p
miRNA Sequence	CAAGAACCUCAGUUGCUUUUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 49	miR-548e directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548e	miRNA Mature ID	miR-548e-3p
miRNA Sequence	AAAAACUGAGACUACUUUUGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 50	miR-548f directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548f	miRNA Mature ID	miR-548f-3p
miRNA Sequence	AAAAACUGUAAUUACUUUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 51	miR-548p directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548p	miRNA Mature ID	miR-548p
miRNA Sequence	UAGCAAAAACUGCAGUUACUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 52	miR-548v directly targets SLC16A9			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-548v	miRNA Mature ID	miR-548v
miRNA Sequence	AGCUACAGUUACUUUUGCACCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 53	miR-5571 directly targets SLC16A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5571	miRNA Mature ID	miR-5571-5p
miRNA Sequence	CAAUUCUCAAAGGAGCCUCCC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 54	miR-5588 directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5588	miRNA Mature ID	miR-5588-3p
miRNA Sequence	AAGUCCCACUAAUGCCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 55	miR-5684 directly targets SLC16A9			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5684	miRNA Mature ID	miR-5684
miRNA Sequence	AACUCUAGCCUGAGCAACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 56	miR-570 directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-570	miRNA Mature ID	miR-570-3p
miRNA Sequence	CGAAAACAGCAAUUACCUUUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 57	miR-582 directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-582	miRNA Mature ID	miR-582-3p
miRNA Sequence	UAACUGGUUGAACAACUGAACC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 58	miR-585 directly targets SLC16A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-585	miRNA Mature ID	miR-585-5p
miRNA Sequence	CUAGCACACAGAUACGCCCAGA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 59	miR-603 directly targets SLC16A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-603	miRNA Mature ID	miR-603
miRNA Sequence	CACACACUGCAAUUACUUUUGC
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 60	miR-6738 directly targets SLC16A9			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6738	miRNA Mature ID	miR-6738-3p
miRNA Sequence	CUUCUGCCUGCAUUCUACUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 61	miR-6886 directly targets SLC16A9			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6886	miRNA Mature ID	miR-6886-3p
miRNA Sequence	UGCCCUUCUCUCCUCCUGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 62	miR-8069 directly targets SLC16A9			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8069	miRNA Mature ID	miR-8069
miRNA Sequence	GGAUGGUUGGGGGCGGUCGGCGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 63	miR-8485 directly targets SLC16A9			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8485	miRNA Mature ID	miR-8485
miRNA Sequence	CACACACACACACACACGUAU
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 64	miR-938 directly targets SLC16A9			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-938	miRNA Mature ID	miR-938
miRNA Sequence	UGCCCUUAAAGGUGAACCCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 65	miR-98 directly targets SLC16A9			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-98	miRNA Mature ID	miR-98-5p
miRNA Sequence	UGAGGUAGUAAGUUGUAUUGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
13	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
14	A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
15	The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
16	EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
17	Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
18	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
19	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
20	Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
21	Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence