Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0127 Transporter Info
Gene Name SLC19A2
Transporter Name Thiamine transporter 1
Gene ID
10560
UniProt ID
O60779
Epigenetic Regulations of This DT (EGR)

Methylation

  Renal cell carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in clear cell renal cell carcinoma [ 1 ]

Location

 TSS1500 (cg13912204)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 6.71E-05; Z-score: 9.43E-01

Methylation in Case

 2.62E-02 (Median) Methylation in Control 2.08E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC19A2 in clear cell renal cell carcinoma [ 1 ]

Location

 TSS1500 (cg20248356)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 1.89E-04; Z-score: 9.11E-01

Methylation in Case

 1.19E-02 (Median) Methylation in Control 1.01E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC19A2 in clear cell renal cell carcinoma [ 1 ]

Location

 TSS200 (cg00874641)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 6.00E-04; Z-score: 6.40E-01

Methylation in Case

 2.72E-02 (Median) Methylation in Control 2.36E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC19A2 in clear cell renal cell carcinoma [ 1 ]

Location

 Body (cg01433556)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 9.75E-06; Z-score: 1.34E+00

Methylation in Case

 3.09E-02 (Median) Methylation in Control 2.47E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in colon adenocarcinoma [ 2 ]

Location

 TSS1500 (cg11735997)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 1.34E-04; Z-score: 2.64E+00

Methylation in Case

 5.37E-01 (Median) Methylation in Control 3.80E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC19A2 in colon adenocarcinoma [ 2 ]

Location

 Body (cg26048101)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.50E+00 Statistic Test p-value: 7.02E-06; Z-score: -1.69E+00

Methylation in Case

 1.21E-01 (Median) Methylation in Control 1.81E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC19A2 in colon adenocarcinoma [ 2 ]

Location

 Body (cg01829829)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 2.54E-05; Z-score: -3.25E+00

Methylation in Case

 6.67E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC19A2 in colon adenocarcinoma [ 2 ]

Location

 Body (cg26579073)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 5.49E-05; Z-score: 1.20E+00

Methylation in Case

 8.65E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg20248356)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 1.14E-02; Z-score: 9.20E-01

Methylation in Case

 7.45E-02 (Median) Methylation in Control 6.40E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

 TSS1500 (cg00691125)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 4.27E-02; Z-score: -7.08E-01

Methylation in Case

 2.31E-02 (Median) Methylation in Control 2.75E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

 TSS200 (cg05969530)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 5.36E-04; Z-score: -8.56E-01

Methylation in Case

 2.90E-02 (Median) Methylation in Control 3.38E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

 TSS200 (cg20816261)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 2.01E-03; Z-score: -7.15E-01

Methylation in Case

 1.78E-02 (Median) Methylation in Control 2.13E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

 TSS200 (cg00874641)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 2.58E-02; Z-score: -4.01E-01

Methylation in Case

 8.86E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

 Body (cg16548605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 6.97E-03; Z-score: -7.97E-01

Methylation in Case

 7.61E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC19A2 in colorectal cancer [ 3 ]

Location

 3'UTR (cg24541193)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.94E-02; Z-score: -4.33E-01

Methylation in Case

 8.34E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in HIV infection [ 4 ]

Location

 TSS1500 (cg20248356)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 1.69E-02; Z-score: 5.66E-01

Methylation in Case

 4.91E-02 (Median) Methylation in Control 4.24E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC19A2 in HIV infection [ 4 ]

Location

 TSS1500 (cg13912204)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 3.78E-02; Z-score: -4.82E-01

Methylation in Case

 5.50E-02 (Median) Methylation in Control 6.07E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC19A2 in HIV infection [ 4 ]

Location

 TSS200 (cg05969530)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 5.62E-03; Z-score: 7.30E-01

Methylation in Case

 3.45E-02 (Median) Methylation in Control 2.91E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC19A2 in HIV infection [ 4 ]

Location

 TSS200 (cg00874641)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.61E-02; Z-score: -6.41E-01

Methylation in Case

 6.29E-02 (Median) Methylation in Control 6.84E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC19A2 in HIV infection [ 4 ]

Location

 Body (cg04083076)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 3.30E-11; Z-score: 1.84E+00

Methylation in Case

 6.84E-01 (Median) Methylation in Control 5.91E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC19A2 in HIV infection [ 4 ]

Location

 Body (cg01433556)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 3.35E-03; Z-score: 9.02E-01

Methylation in Case

 7.03E-02 (Median) Methylation in Control 6.22E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC19A2 in HIV infection [ 4 ]

Location

 3'UTR (cg24541193)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 1.54E-05; Z-score: 1.10E+00

Methylation in Case

 6.97E-01 (Median) Methylation in Control 6.22E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in pancretic ductal adenocarcinoma [ 5 ]

Location

 TSS1500 (cg00664682)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.04E-02; Z-score: -3.92E-01

Methylation in Case

 4.14E-02 (Median) Methylation in Control 4.47E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC19A2 in pancretic ductal adenocarcinoma [ 5 ]

Location

 Body (cg14004271)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 3.92E-05; Z-score: 1.01E+00

Methylation in Case

 8.48E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC19A2 in pancretic ductal adenocarcinoma [ 5 ]

Location

 Body (cg15128778)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 1.06E-03; Z-score: 1.12E+00

Methylation in Case

 7.42E-01 (Median) Methylation in Control 6.70E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg20248356)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.28E-03; Z-score: -5.16E-01

Methylation in Case

 4.02E-02 (Median) Methylation in Control 4.39E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC19A2 in papillary thyroid cancer [ 6 ]

Location

 TSS200 (cg26681912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 9.88E-04; Z-score: -3.36E-01

Methylation in Case

 3.38E-02 (Median) Methylation in Control 3.62E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC19A2 in papillary thyroid cancer [ 6 ]

Location

 TSS200 (cg00874641)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.30E-02; Z-score: -3.40E-01

Methylation in Case

 5.18E-02 (Median) Methylation in Control 5.41E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC19A2 in papillary thyroid cancer [ 6 ]

Location

 Body (cg16548605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.46E+00 Statistic Test p-value: 2.20E-12; Z-score: -3.07E+00

Methylation in Case

 4.96E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC19A2 in papillary thyroid cancer [ 6 ]

Location

 Body (cg04083076)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 5.53E-03; Z-score: -2.92E-01

Methylation in Case

 7.50E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in bladder cancer [ 7 ]

Location

 TSS200 (cg26681912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.43E+00 Statistic Test p-value: 2.95E-02; Z-score: -2.00E+00

Methylation in Case

 2.40E-02 (Median) Methylation in Control 5.85E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC19A2 in bladder cancer [ 7 ]

Location

 Body (cg16548605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.84E+00 Statistic Test p-value: 1.92E-13; Z-score: -2.08E+01

Methylation in Case

 2.56E-01 (Median) Methylation in Control 7.27E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC19A2 in bladder cancer [ 7 ]

Location

 Body (cg04083076)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.37E+00 Statistic Test p-value: 3.10E-06; Z-score: -5.54E+00

Methylation in Case

 4.73E-01 (Median) Methylation in Control 6.48E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC19A2 in bladder cancer [ 7 ]

Location

 3'UTR (cg24541193)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.45E+00 Statistic Test p-value: 4.96E-07; Z-score: 6.09E+00

Methylation in Case

 6.74E-01 (Median) Methylation in Control 4.65E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in breast cancer [ 8 ]

Location

 TSS200 (cg00874641)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 5.97E-03; Z-score: -7.20E-01

Methylation in Case

 6.11E-02 (Median) Methylation in Control 7.16E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC19A2 in breast cancer [ 8 ]

Location

 TSS200 (cg26681912)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.76E+00 Statistic Test p-value: 2.69E-02; Z-score: -4.07E-01

Methylation in Case

 1.33E-02 (Median) Methylation in Control 2.34E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC19A2 in breast cancer [ 8 ]

Location

 Body (cg16548605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 1.16E-09; Z-score: -2.03E+00

Methylation in Case

 5.91E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC19A2 in breast cancer [ 8 ]

Location

 Body (cg04083076)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 7.49E-04; Z-score: -3.98E-01

Methylation in Case

 5.67E-01 (Median) Methylation in Control 6.01E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in hepatocellular carcinoma [ 9 ]

Location

 TSS200 (cg05969530)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.54E-02; Z-score: 1.46E-01

Methylation in Case

 3.27E-02 (Median) Methylation in Control 3.13E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC19A2 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg17669365)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 5.07E-10; Z-score: -4.69E+00

Methylation in Case

 6.28E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in systemic lupus erythematosus [ 10 ]

Location

 TSS200 (cg00874641)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.04E-02; Z-score: -1.19E-01

Methylation in Case

 7.98E-02 (Median) Methylation in Control 8.14E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC19A2 in systemic lupus erythematosus [ 10 ]

Location

 3'UTR (cg24541193)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 2.11E-02; Z-score: 2.43E-01

Methylation in Case

 7.39E-01 (Median) Methylation in Control 7.23E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 Body (cg01433556)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 6.54E-05; Z-score: -8.53E-01

Methylation in Case

 2.57E-01 (Median) Methylation in Control 3.24E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC19A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 Body (cg02625942)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -5.24E+00 Statistic Test p-value: 1.97E-04; Z-score: -7.27E-01

Methylation in Case

 2.99E-02 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC19A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 Body (cg04083076)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 5.52E-04; Z-score: -1.01E+00

Methylation in Case

 7.34E-01 (Median) Methylation in Control 7.88E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC19A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 3'UTR (cg24541193)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 1.48E-09; Z-score: -1.60E+00

Methylation in Case

 6.16E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in lung adenocarcinoma [ 12 ]

Location

 3'UTR (cg24541193)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.42E-02; Z-score: 1.42E+00

Methylation in Case

 7.53E-01 (Median) Methylation in Control 7.07E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in panic disorder [ 13 ]

Location

 3'UTR (cg24541193)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.28E-01 Statistic Test p-value: 2.95E-05; Z-score: -7.53E-01

Methylation in Case

 -4.97E-01 (Median) Methylation in Control -1.63E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC19A2 in prostate cancer [ 14 ]

Location

 3'UTR (cg18377941)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.01E-02; Z-score: 2.60E+00

Methylation in Case

 9.59E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-122 directly targets SLC19A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-122 miRNA Mature ID miR-122-5p

miRNA Sequence

 UGGAGUGUGACAAUGGUGUUUG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

 miR-181a directly targets SLC19A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181a miRNA Mature ID miR-181a-5p

miRNA Sequence

 AACAUUCAACGCUGUCGGUGAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-181b directly targets SLC19A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181b miRNA Mature ID miR-181b-5p

miRNA Sequence

 AACAUUCAUUGCUGUCGGUGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-181c directly targets SLC19A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181c miRNA Mature ID miR-181c-5p

miRNA Sequence

 AACAUUCAACCUGUCGGUGAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-181d directly targets SLC19A2 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-181d miRNA Mature ID miR-181d-5p

miRNA Sequence

 AACAUUCAUUGUUGUCGGUGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-192 directly targets SLC19A2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-215 directly targets SLC19A2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

 AUGACCUAUGAAUUGACAGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-26b directly targets SLC19A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-98 directly targets SLC19A2 [ 19 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

 UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
2 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
3 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
4 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
5 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 DNA Methylation Dynamics in Urological Tumors.
8 Genome-wide Scan for Methylation Profiles in Breast Cancer
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.
16 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
17 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
18 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
19 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.