General Information of Drug Transporter (DT)
DT ID DTD0133 Transporter Info
Gene Name SLC1A5
Transporter Name Alanine/serine/cysteine/threonine transporter 2
Gene ID
6510
UniProt ID
Q15758
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC1A5 in bladder cancer [ 1 ]

Location

TSS1500 (cg08533710)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.22E+00 Statistic Test p-value: 2.73E-02; Z-score: -2.13E+00

Methylation in Case

3.93E-01 (Median) Methylation in Control 4.79E-01 (Median)

Studied Phenotype

Bladder cancer [ ICD-11: 2C94]

Experimental Material

Patient tissue samples

  Breast cancer

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC1A5 in breast cancer [ 2 ]

Location

TSS1500 (cg23391214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.61E+00 Statistic Test p-value: 1.47E-03; Z-score: -1.94E+00

Methylation in Case

7.72E-02 (Median) Methylation in Control 1.24E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC1A5 in breast cancer [ 2 ]

Location

TSS1500 (cg08533710)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.16E+00 Statistic Test p-value: 2.90E-02; Z-score: -1.44E+00

Methylation in Case

4.78E-01 (Median) Methylation in Control 5.57E-01 (Median)

Studied Phenotype

Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

Patient tissue samples

  Renal cell carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC1A5 in clear cell renal cell carcinoma [ 3 ]

Location

TSS1500 (cg08533710)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.07E+00 Statistic Test p-value: 6.80E-03; Z-score: 7.57E-01

Methylation in Case

6.24E-01 (Median) Methylation in Control 5.86E-01 (Median)

Studied Phenotype

Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

Patient tissue samples

  Colorectal cancer

           4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC1A5 in colorectal cancer [ 4 ]

Location

TSS1500 (cg23391214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.83E+00 Statistic Test p-value: 1.67E-04; Z-score: -1.61E+00

Methylation in Case

2.43E-01 (Median) Methylation in Control 4.45E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC1A5 in colorectal cancer [ 4 ]

Location

TSS1500 (cg12297570)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.11E+00 Statistic Test p-value: 1.00E-03; Z-score: 8.01E-01

Methylation in Case

9.37E-02 (Median) Methylation in Control 8.42E-02 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 3

Methylation of SLC1A5 in colorectal cancer [ 4 ]

Location

TSS1500 (cg08533710)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.08E+00 Statistic Test p-value: 1.06E-02; Z-score: -6.49E-01

Methylation in Case

6.80E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

Colorectal cancer [ ICD-11: 2B91]

Experimental Material

Patient tissue samples

  Hepatocellular carcinoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC1A5 in hepatocellular carcinoma [ 5 ]

Location

TSS1500 (cg08533710)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.12E+00 Statistic Test p-value: 7.23E-05; Z-score: 6.30E-01

Methylation in Case

6.12E-01 (Median) Methylation in Control 5.46E-01 (Median)

Studied Phenotype

Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

Patient tissue samples

  Systemic lupus erythematosus

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC1A5 in systemic lupus erythematosus [ 6 ]

Location

TSS1500 (cg23391214)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.05E+00 Statistic Test p-value: 3.25E-03; Z-score: -2.16E-01

Methylation in Case

8.71E-02 (Median) Methylation in Control 9.16E-02 (Median)

Studied Phenotype

Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

Patient tissue samples

  Colon cancer

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC1A5 in colon adenocarcinoma [ 7 ]

Location

TSS200 (cg20551181)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.27E+00 Statistic Test p-value: 1.05E-03; Z-score: 9.75E-01

Methylation in Case

4.64E-01 (Median) Methylation in Control 3.65E-01 (Median)

Studied Phenotype

Colon cancer [ ICD-11: 2B90]

Experimental Material

Patient tissue samples

  Pancretic ductal adenocarcinoma

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Methylation of SLC1A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg22708635)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: 1.08E+00 Statistic Test p-value: 1.07E-04; Z-score: 9.88E-01

Methylation in Case

7.46E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 2

Methylation of SLC1A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

Body (cg09481056)

Epigenetic Type

Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

Fold Change: -1.01E+00 Statistic Test p-value: 1.17E-02; Z-score: -1.48E-01

Methylation in Case

8.05E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

Patient tissue samples

  Rheumatoid arthritis

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Hypomethylation of SLC1A5 in rheumatoid arthritis [ 10 ]

Epigenetic Type

Methylation Experiment Method HumanMethylation450 BeadChip

Studied Phenotype

Rheumatoid arthritis [ ICD-11: FA20]

Experimental Material

Patient tissue samples

Additional Notes

SLC1A5 was the most hypermethyaltion gene in rheumatoid arthritis.

  Craniopharyngioma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Significant hypomethylation of SLC1A5 in craniopharyngioma than that in healthy individual

Studied Phenotype

Craniopharyngioma [ICD-11:2F9A]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 6.42E-17; Fold-change: -0.436998223; Z-score: -10.59168556
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Esthesioneuroblastoma

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Significant hypomethylation of SLC1A5 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 6.96E-18; Fold-change: -0.44574971; Z-score: -11.75569871
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

  Obesity

           1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Significant hypomethylation of SLC1A5 in obesity than that in healthy individual

Studied Phenotype

Obesity [ICD-11:5B81]

The Methylation Level of Disease Section Compare with the Healthy Individual

p-value: 3.40E-13; Fold-change: -0.310174486; Z-score: -3.20449883
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples

Histone acetylation

  Chronic social defeat stress

           2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

Hyperacetylation of SLC1A5 in chronic social defeat stress (compare with normal control mice) [ 9 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Up regulation of SLC1A5 Experiment Method RT-qPCR

Studied Phenotype

Chronic social defeat stress [ ICD-11: QE01]

Experimental Material

Model organism in vivo (mouse)

Additional Notes

Chronic social stress activates ASCT2 transcription via histone acetylation in its promoter.

  Epigenetic Phenomenon 2

Hyperacetylation of SLC1A5 in chronic social defeat stress (compare with normal control mice) [ 9 ]

Location

Promoter

Epigenetic Type

Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

Up regulation of SLC1A5 Experiment Method RT-qPCR

Studied Phenotype

Chronic social defeat stress [ ICD-11: QE01]

Experimental Material

Model organism in vivo (mouse)

Additional Notes

Chronic social stress activates ASCT2 transcription via histone acetylation in its promoter.

microRNA

  Unclear Phenotype

       160 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

miR-106a directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-106a miRNA Mature ID miR-106a-5p

miRNA Sequence

AAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 2

miR-106b directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 3

miR-122 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-122 miRNA Mature ID miR-122-5p

miRNA Sequence

UGGAGUGUGACAAUGGUGUUUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 4

miR-1224 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1224 miRNA Mature ID miR-1224-3p

miRNA Sequence

CCCCACCUCCUCUCUCCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 5

miR-1226 directly targets SLC1A5 [ 13 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-1226 miRNA Mature ID miR-1226-3p

miRNA Sequence

UCACCAGCCCUGUGUUCCCUAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

miR-1227 directly targets SLC1A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1227 miRNA Mature ID miR-1227-3p

miRNA Sequence

CGUGCCACCCUUUUCCCCAG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 7

miR-1234 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1234 miRNA Mature ID miR-1234-3p

miRNA Sequence

UCGGCCUGACCACCCACCCCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 8

miR-125a directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-125a miRNA Mature ID miR-125a-3p

miRNA Sequence

ACAGGUGAGGUUCUUGGGAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 9

miR-125a directly targets SLC1A5 [ 15 ]

Epigenetic Type

microRNA Experiment Method Sequencing

miRNA Stemloop ID

miR-125a miRNA Mature ID miR-125a-5p

miRNA Sequence

UCCCUGAGACCCUUUAACCUGUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

miR-1260a directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1260a miRNA Mature ID miR-1260a

miRNA Sequence

AUCCCACCUCUGCCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 11

miR-1260b directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1260b miRNA Mature ID miR-1260b

miRNA Sequence

AUCCCACCACUGCCACCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 12

miR-1267 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1267 miRNA Mature ID miR-1267

miRNA Sequence

CCUGUUGAAGUGUAAUCCCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 13

miR-1295b directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1295b miRNA Mature ID miR-1295b-3p

miRNA Sequence

AAUAGGCCACGGAUCUGGGCAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 14

miR-1304 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1304 miRNA Mature ID miR-1304-3p

miRNA Sequence

UCUCACUGUAGCCUCGAACCCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 15

miR-1307 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-1307 miRNA Mature ID miR-1307-3p

miRNA Sequence

ACUCGGCGUGGCGUCGGUCGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 16

miR-143 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-143 miRNA Mature ID miR-143-5p

miRNA Sequence

GGUGCAGUGCUGCAUCUCUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 17

miR-149 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-149 miRNA Mature ID miR-149-3p

miRNA Sequence

AGGGAGGGACGGGGGCUGUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 18

miR-150 directly targets SLC1A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-150 miRNA Mature ID miR-150-5p

miRNA Sequence

UCUCCCAACCCUUGUACCAGUG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 19

miR-155 directly targets SLC1A5 [ 17 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

miR-155 miRNA Mature ID miR-155-5p

miRNA Sequence

UUAAUGCUAAUCGUGAUAGGGGUU

miRNA Target Type

Direct

Experimental Material

Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 20

miR-15a directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-15a miRNA Mature ID miR-15a-3p

miRNA Sequence

CAGGCCAUAUUGUGCUGCCUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 21

miR-15b directly targets SLC1A5 [ 13 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

miR-16 directly targets SLC1A5 [ 13 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 23

miR-17 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 24

miR-186 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-186 miRNA Mature ID miR-186-3p

miRNA Sequence

GCCCAAAGGUGAAUUUUUUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 25

miR-188 directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-188 miRNA Mature ID miR-188-3p

miRNA Sequence

CUCCCACAUGCAGGGUUUGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 26

miR-193b directly targets SLC1A5 [ 18 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

miR-193b miRNA Mature ID miR-193b-3p

miRNA Sequence

AACUGGCCCUCAAAGUCCCGCU

miRNA Target Type

Direct

Experimental Material

Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon 27

miR-1976 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-1976 miRNA Mature ID miR-1976

miRNA Sequence

CCUCCUGCCCUCCUUGCUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 28

miR-20a directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 29

miR-20b directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-20b miRNA Mature ID miR-20b-5p

miRNA Sequence

CAAAGUGCUCAUAGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 30

miR-214 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-214 miRNA Mature ID miR-214-5p

miRNA Sequence

UGCCUGUCUACACUUGCUGUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 31

miR-218 directly targets SLC1A5 [ 20 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-218 miRNA Mature ID miR-218-5p

miRNA Sequence

UUGUGCUUGAUCUAACCAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 32

miR-2276 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-2276 miRNA Mature ID miR-2276-3p

miRNA Sequence

UCUGCAAGUGUCAGAGGCGAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 33

miR-23a directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-23a miRNA Mature ID miR-23a-5p

miRNA Sequence

GGGGUUCCUGGGGAUGGGAUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 34

miR-23b directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-23b miRNA Mature ID miR-23b-5p

miRNA Sequence

UGGGUUCCUGGCAUGCUGAUUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 35

miR-24 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-24 miRNA Mature ID miR-24-3p

miRNA Sequence

UGGCUCAGUUCAGCAGGAACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 36

miR-2681 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-2681 miRNA Mature ID miR-2681-3p

miRNA Sequence

UAUCAUGGAGUUGGUAAAGCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 37

miR-29a directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-29a miRNA Mature ID miR-29a-5p

miRNA Sequence

ACUGAUUUCUUUUGGUGUUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 38

miR-302a directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302a miRNA Mature ID miR-302a-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUUGGUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 39

miR-302b directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302b miRNA Mature ID miR-302b-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUUAGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 40

miR-302c directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302c miRNA Mature ID miR-302c-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUCAGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 41

miR-302d directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302d miRNA Mature ID miR-302d-3p

miRNA Sequence

UAAGUGCUUCCAUGUUUGAGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 42

miR-302e directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-302e miRNA Mature ID miR-302e

miRNA Sequence

UAAGUGCUUCCAUGCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 43

miR-30b directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-30b miRNA Mature ID miR-30b-3p

miRNA Sequence

CUGGGAGGUGGAUGUUUACUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 44

miR-3122 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3122 miRNA Mature ID miR-3122

miRNA Sequence

GUUGGGACAAGAGGACGGUCUU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 45

miR-3130 directly targets SLC1A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3130 miRNA Mature ID miR-3130-3p

miRNA Sequence

GCUGCACCGGAGACUGGGUAA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 46

miR-3135b directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3135b miRNA Mature ID miR-3135b

miRNA Sequence

GGCUGGAGCGAGUGCAGUGGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 47

miR-3156 directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3156 miRNA Mature ID miR-3156-3p

miRNA Sequence

CUCCCACUUCCAGAUCUUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 48

miR-3159 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3159 miRNA Mature ID miR-3159

miRNA Sequence

UAGGAUUACAAGUGUCGGCCAC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 49

miR-3192 directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3192 miRNA Mature ID miR-3192-3p

miRNA Sequence

CUCUGAUCGCCCUCUCAGCUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 50

miR-3199 directly targets SLC1A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3199 miRNA Mature ID miR-3199

miRNA Sequence

AGGGACUGCCUUAGGAGAAAGUU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 51

miR-324 directly targets SLC1A5 [ 13 ]

Epigenetic Type

microRNA Experiment Method CLASH

miRNA Stemloop ID

miR-324 miRNA Mature ID miR-324-3p

miRNA Sequence

CCCACUGCCCCAGGUGCUGCUGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 52

miR-330 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-330 miRNA Mature ID miR-330-3p

miRNA Sequence

GCAAAGCACACGGCCUGCAGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 53

miR-331 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-331 miRNA Mature ID miR-331-3p

miRNA Sequence

GCCCCUGGGCCUAUCCUAGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 54

miR-34a directly targets SLC1A5 [ 22 ]

Epigenetic Type

microRNA Experiment Method Proteomics

miRNA Stemloop ID

miR-34a miRNA Mature ID miR-34a-5p

miRNA Sequence

UGGCAGUGUCUUAGCUGGUUGU

miRNA Target Type

Direct

Experimental Material

Human colorectal cancer cell line (SW480)

  Epigenetic Phenomenon 55

miR-3622b directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3622b miRNA Mature ID miR-3622b-5p

miRNA Sequence

AGGCAUGGGAGGUCAGGUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 56

miR-3652 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3652 miRNA Mature ID miR-3652

miRNA Sequence

CGGCUGGAGGUGUGAGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 57

miR-365a directly targets SLC1A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-365a miRNA Mature ID miR-365a-5p

miRNA Sequence

AGGGACUUUUGGGGGCAGAUGUG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 58

miR-365b directly targets SLC1A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-365b miRNA Mature ID miR-365b-5p

miRNA Sequence

AGGGACUUUCAGGGGCAGCUGU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 59

miR-3664 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3664 miRNA Mature ID miR-3664-5p

miRNA Sequence

AACUCUGUCUUCACUCAUGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 60

miR-367 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-367 miRNA Mature ID miR-367-5p

miRNA Sequence

ACUGUUGCUAAUAUGCAACUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 61

miR-3689c directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3689c miRNA Mature ID miR-3689c

miRNA Sequence

CUGGGAGGUGUGAUAUUGUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 62

miR-372 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-372 miRNA Mature ID miR-372-3p

miRNA Sequence

AAAGUGCUGCGACAUUUGAGCGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 63

miR-373 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-373 miRNA Mature ID miR-373-3p

miRNA Sequence

GAAGUGCUUCGAUUUUGGGGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 64

miR-378a directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-378a miRNA Mature ID miR-378a-5p

miRNA Sequence

CUCCUGACUCCAGGUCCUGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 65

miR-383 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-383 miRNA Mature ID miR-383-3p

miRNA Sequence

ACAGCACUGCCUGGUCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 66

miR-3909 directly targets SLC1A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3909 miRNA Mature ID miR-3909

miRNA Sequence

UGUCCUCUAGGGCCUGCAGUCU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 67

miR-3913 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3913 miRNA Mature ID miR-3913-5p

miRNA Sequence

UUUGGGACUGAUCUUGAUGUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 68

miR-3920 directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-3920 miRNA Mature ID miR-3920

miRNA Sequence

ACUGAUUAUCUUAACUCUCUGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 69

miR-3926 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3926 miRNA Mature ID miR-3926

miRNA Sequence

UGGCCAAAAAGCAGGCAGAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 70

miR-3934 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3934 miRNA Mature ID miR-3934-5p

miRNA Sequence

UCAGGUGUGGAAACUGAGGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 71

miR-3940 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-3940 miRNA Mature ID miR-3940-5p

miRNA Sequence

GUGGGUUGGGGCGGGCUCUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 72

miR-4252 directly targets SLC1A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4252 miRNA Mature ID miR-4252

miRNA Sequence

GGCCACUGAGUCAGCACCA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 73

miR-4279 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4279 miRNA Mature ID miR-4279

miRNA Sequence

CUCUCCUCCCGGCUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 74

miR-4284 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4284 miRNA Mature ID miR-4284

miRNA Sequence

GGGCUCACAUCACCCCAU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 75

miR-4292 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4292 miRNA Mature ID miR-4292

miRNA Sequence

CCCCUGGGCCGGCCUUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 76

miR-4313 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4313 miRNA Mature ID miR-4313

miRNA Sequence

AGCCCCCUGGCCCCAAACCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 77

miR-433 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-433 miRNA Mature ID miR-433-3p

miRNA Sequence

AUCAUGAUGGGCUCCUCGGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 78

miR-4423 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4423 miRNA Mature ID miR-4423-5p

miRNA Sequence

AGUUGCCUUUUUGUUCCCAUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 79

miR-4430 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4430 miRNA Mature ID miR-4430

miRNA Sequence

AGGCUGGAGUGAGCGGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 80

miR-4436b directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4436b miRNA Mature ID miR-4436b-5p

miRNA Sequence

GUCCACUUCUGCCUGCCCUGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 81

miR-4438 directly targets SLC1A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4438 miRNA Mature ID miR-4438

miRNA Sequence

CACAGGCUUAGAAAAGACAGU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 82

miR-4454 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4454 miRNA Mature ID miR-4454

miRNA Sequence

GGAUCCGAGUCACGGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 83

miR-4507 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4507 miRNA Mature ID miR-4507

miRNA Sequence

CUGGGUUGGGCUGGGCUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 84

miR-455 directly targets SLC1A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-455 miRNA Mature ID miR-455-5p

miRNA Sequence

UAUGUGCCUUUGGACUACAUCG

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 85

miR-4638 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4638 miRNA Mature ID miR-4638-5p

miRNA Sequence

ACUCGGCUGCGGUGGACAAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 86

miR-4639 directly targets SLC1A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4639 miRNA Mature ID miR-4639-5p

miRNA Sequence

UUGCUAAGUAGGCUGAGAUUGA

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 87

miR-4690 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4690 miRNA Mature ID miR-4690-5p

miRNA Sequence

GAGCAGGCGAGGCUGGGCUGAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 88

miR-4715 directly targets SLC1A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4715 miRNA Mature ID miR-4715-3p

miRNA Sequence

GUGCCACCUUAACUGCAGCCAAU

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 89

miR-4717 directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4717 miRNA Mature ID miR-4717-5p

miRNA Sequence

UAGGCCACAGCCACCCAUGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 90

miR-4722 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 91

miR-4728 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4728 miRNA Mature ID miR-4728-5p

miRNA Sequence

UGGGAGGGGAGAGGCAGCAAGCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 92

miR-4742 directly targets SLC1A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4742 miRNA Mature ID miR-4742-3p

miRNA Sequence

UCUGUAUUCUCCUUUGCCUGCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 93

miR-4762 directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-4762 miRNA Mature ID miR-4762-3p

miRNA Sequence

CUUCUGAUCAAGAUUUGUGGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 94

miR-4772 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-4772 miRNA Mature ID miR-4772-3p

miRNA Sequence

CCUGCAACUUUGCCUGAUCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 95

miR-500b directly targets SLC1A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-500b miRNA Mature ID miR-500b-3p

miRNA Sequence

GCACCCAGGCAAGGAUUCUG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 96

miR-504 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-504 miRNA Mature ID miR-504-3p

miRNA Sequence

GGGAGUGCAGGGCAGGGUUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 97

miR-519d directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-519d miRNA Mature ID miR-519d-3p

miRNA Sequence

CAAAGUGCCUCCCUUUAGAGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 98

miR-520a directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520a miRNA Mature ID miR-520a-3p

miRNA Sequence

AAAGUGCUUCCCUUUGGACUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 99

miR-520c directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520c miRNA Mature ID miR-520c-3p

miRNA Sequence

AAAGUGCUUCCUUUUAGAGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 100

miR-520d directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520d miRNA Mature ID miR-520d-3p

miRNA Sequence

AAAGUGCUUCUCUUUGGUGGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 101

miR-520g directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520g miRNA Mature ID miR-520g-3p

miRNA Sequence

ACAAAGUGCUUCCCUUUAGAGUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 102

miR-520h directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-520h miRNA Mature ID miR-520h

miRNA Sequence

ACAAAGUGCUUCCCUUUAGAGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 103

miR-526b directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-526b miRNA Mature ID miR-526b-3p

miRNA Sequence

GAAAGUGCUUCCUUUUAGAGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 104

miR-552 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-552 miRNA Mature ID miR-552-3p

miRNA Sequence

AACAGGUGACUGGUUAGACAA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 105

miR-562 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-562 miRNA Mature ID miR-562

miRNA Sequence

AAAGUAGCUGUACCAUUUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 106

miR-5693 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5693 miRNA Mature ID miR-5693

miRNA Sequence

GCAGUGGCUCUGAAAUGAACUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 107

miR-5697 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5697 miRNA Mature ID miR-5697

miRNA Sequence

UCAAGUAGUUUCAUGAUAAAGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 108

miR-5698 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-5698 miRNA Mature ID miR-5698

miRNA Sequence

UGGGGGAGUGCAGUGAUUGUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 109

miR-5704 directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-5704 miRNA Mature ID miR-5704

miRNA Sequence

UUAGGCCAUCAUCCCAUUAUGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 110

miR-589 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-589 miRNA Mature ID miR-589-3p

miRNA Sequence

UCAGAACAAAUGCCGGUUCCCAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 111

miR-590 directly targets SLC1A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-590 miRNA Mature ID miR-590-3p

miRNA Sequence

UAAUUUUAUGUAUAAGCUAGU

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 112

miR-619 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-619 miRNA Mature ID miR-619-5p

miRNA Sequence

GCUGGGAUUACAGGCAUGAGCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 113

miR-635 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-635 miRNA Mature ID miR-635

miRNA Sequence

ACUUGGGCACUGAAACAAUGUCC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 114

miR-640 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-640 miRNA Mature ID miR-640

miRNA Sequence

AUGAUCCAGGAACCUGCCUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 115

miR-6499 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6499 miRNA Mature ID miR-6499-3p

miRNA Sequence

AGCAGUGUUUGUUUUGCCCACA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 116

miR-6501 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6501 miRNA Mature ID miR-6501-5p

miRNA Sequence

AGUUGCCAGGGCUGCCUUUGGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 117

miR-6504 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6504 miRNA Mature ID miR-6504-3p

miRNA Sequence

CAUUACAGCACAGCCAUUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 118

miR-6513 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6513 miRNA Mature ID miR-6513-5p

miRNA Sequence

UUUGGGAUUGACGCCACAUGUCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 119

miR-6514 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6514 miRNA Mature ID miR-6514-3p

miRNA Sequence

CUGCCUGUUCUUCCACUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 120

miR-6727 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

UCCUGCCACCUCCUCCGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 121

miR-6729 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6729 miRNA Mature ID miR-6729-3p

miRNA Sequence

UCAUCCCCCUCGCCCUCUCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 122

miR-6741 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6741 miRNA Mature ID miR-6741-3p

miRNA Sequence

UCGGCUCUCUCCCUCACCCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 123

miR-6742 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6742 miRNA Mature ID miR-6742-3p

miRNA Sequence

ACCUGGGUUGUCCCCUCUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 124

miR-6746 directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6746 miRNA Mature ID miR-6746-3p

miRNA Sequence

CAGCCGCCGCCUGUCUCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 125

miR-6747 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 126

miR-6767 directly targets SLC1A5 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6767 miRNA Mature ID miR-6767-3p

miRNA Sequence

CCACGUGCUUCUCUUUCCGCAG

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 127

miR-6774 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6774 miRNA Mature ID miR-6774-5p

miRNA Sequence

ACUUGGGCAGGAGGGACCCUGUAUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 128

miR-6778 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

UGCCUCCCUGACAUUCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 129

miR-6779 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6779 miRNA Mature ID miR-6779-5p

miRNA Sequence

CUGGGAGGGGCUGGGUUUGGC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 130

miR-6780a directly targets SLC1A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6780a miRNA Mature ID miR-6780a-3p

miRNA Sequence

CUCCUCUGUUUUCUUUCCUAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 131

miR-6785 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6785 miRNA Mature ID miR-6785-5p

miRNA Sequence

UGGGAGGGCGUGGAUGAUGGUG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 132

miR-6788 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6788 miRNA Mature ID miR-6788-5p

miRNA Sequence

CUGGGAGAAGAGUGGUGAAGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 133

miR-6790 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6790 miRNA Mature ID miR-6790-3p

miRNA Sequence

CGACCUCGGCGACCCCUCACU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 134

miR-6791 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6791 miRNA Mature ID miR-6791-5p

miRNA Sequence

CCCCUGGGGCUGGGCAGGCGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 135

miR-6799 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6799 miRNA Mature ID miR-6799-5p

miRNA Sequence

GGGGAGGUGUGCAGGGCUGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 136

miR-6807 directly targets SLC1A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 137

miR-6811 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6811 miRNA Mature ID miR-6811-3p

miRNA Sequence

AGCCUGUGCUUGUCCCUGCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 138

miR-6814 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6814 miRNA Mature ID miR-6814-5p

miRNA Sequence

UCCCAAGGGUGAGAUGCUGCCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 139

miR-6821 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6821 miRNA Mature ID miR-6821-3p

miRNA Sequence

UGACCUCUCCGCUCCGCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 140

miR-6821 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6821 miRNA Mature ID miR-6821-5p

miRNA Sequence

GUGCGUGGUGGCUCGAGGCGGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 141

miR-6839 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6839 miRNA Mature ID miR-6839-3p

miRNA Sequence

UUGGGUUUUCUCUUCAAUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 142

miR-6847 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6847 miRNA Mature ID miR-6847-3p

miRNA Sequence

GGCUCAUGUGUCUGUCCUCUUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 143

miR-6849 directly targets SLC1A5 [ 21 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 144

miR-6852 directly targets SLC1A5 [ 23 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6852 miRNA Mature ID miR-6852-3p

miRNA Sequence

UGUCCUCUGUUCCUCAG

miRNA Target Type

Direct

Experimental Material

Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 145

miR-6856 directly targets SLC1A5 [ 16 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-6856 miRNA Mature ID miR-6856-3p

miRNA Sequence

UACAGCCCUGUGAUCUUUCCAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 146

miR-6883 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6883 miRNA Mature ID miR-6883-5p

miRNA Sequence

AGGGAGGGUGUGGUAUGGAUGU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 147

miR-6890 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-6890 miRNA Mature ID miR-6890-3p

miRNA Sequence

CCACUGCCUAUGCCCCACAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 148

miR-7106 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7106 miRNA Mature ID miR-7106-5p

miRNA Sequence

UGGGAGGAGGGGAUCUUGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 149

miR-7107 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7107 miRNA Mature ID miR-7107-5p

miRNA Sequence

UCGGCCUGGGGAGGAGGAAGGG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 150

miR-7151 directly targets SLC1A5 [ 19 ]

Epigenetic Type

microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

miR-7151 miRNA Mature ID miR-7151-3p

miRNA Sequence

CUACAGGCUGGAAUGGGCUCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 151

miR-744 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-744 miRNA Mature ID miR-744-3p

miRNA Sequence

CUGUUGCCACUAACCUCAACCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 152

miR-764 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-764 miRNA Mature ID miR-764

miRNA Sequence

GCAGGUGCUCACUUGUCCUCCU

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 153

miR-7977 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-7977 miRNA Mature ID miR-7977

miRNA Sequence

UUCCCAGCCAACGCACCA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 154

miR-8052 directly targets SLC1A5 [ 14 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8052 miRNA Mature ID miR-8052

miRNA Sequence

CGGGACUGUAGAGGGCAUGAGC

miRNA Target Type

Direct

Experimental Material

Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 155

miR-8057 directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8057 miRNA Mature ID miR-8057

miRNA Sequence

GUGGCUCUGUAGUAAGAUGGA

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 156

miR-8064 directly targets SLC1A5 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8064 miRNA Mature ID miR-8064

miRNA Sequence

AGCACACUGAGCGAGCGGAC

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 157

miR-8485 directly targets SLC1A5 [ 24 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

CACACACACACACACACGUAU

miRNA Target Type

Direct

Experimental Material

Patient tissue samples

  Epigenetic Phenomenon 158

miR-887 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-887 miRNA Mature ID miR-887-5p

miRNA Sequence

CUUGGGAGCCCUGUUAGACUC

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 159

miR-891a directly targets SLC1A5 [ 12 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-891a miRNA Mature ID miR-891a-3p

miRNA Sequence

AGUGGCACAUGUUUGUUGUGAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human

  Epigenetic Phenomenon 160

miR-93 directly targets SLC1A5 [ 11 ]

Epigenetic Type

microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

Direct

Experimental Material

Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
7 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 Epigenetic Activation of ASCT2 in the Hippocampus Contributes to Depression-Like Behavior by Regulating D-Serine in Mice. Front Mol Neurosci. 2017 May 9;10:139.
10 Genome-wide DNA methylation patterns in CD4+ T cells from Chinese Han patients with rheumatoid arthritis. Mod Rheumatol. 2017 May;27(3):441-447.
11 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
12 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
13 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
14 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
15 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
16 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
17 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
18 Identification of miR-193b targets in breast cancer cells and systems biological analysis of their functional impact. Mol Cell Proteomics. 2011 Jul;10(7):M110.005322.
19 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
20 MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.
21 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
22 Genome-wide characterization of miR-34a induced changes in protein and mRNA expression by a combined pulsed SILAC and microarray analysis. Mol Cell Proteomics. 2011 Aug;10(8):M111.010462.
23 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
24 Argonaute CLIP Defines a Deregulated miR-122-Bound Transcriptome that Correlates with Patient Survival in Human Liver Cancer. Mol Cell. 2017 Aug 3;67(3):400-410.e7.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.