Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0159 Transporter Info | ||||
| Gene Name | SLC23A2 | ||||
| Transporter Name | Sodium-dependent vitamin C transporter 2 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Spinal muscular atrophy |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypomethylation of SLC23A2 in spinal muscular atrophy | [ 1 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Bisulfite sequencing | ||
|
Related Molecular Changes |
Up regulation of SLC23A2 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Spinal muscular atrophy [ ICD-11: 8B61] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
Lower methylation levels in type III-IV compared to type I SMA patients might suggest higher SLC23A2 expression level. | ||||
|
Atypical teratoid rhabdoid tumor |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC23A2 in atypical teratoid rhabdoid tumor | [ 2 ] | |||
|
Location |
5'UTR (cg12821724) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 3.88E-07; Z-score: -1.35E+00 | ||
|
Methylation in Case |
5.93E-01 (Median) | Methylation in Control | 7.58E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC23A2 in bladder cancer | [ 3 ] | |||
|
Location |
5'UTR (cg12821724) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.21E+00 | Statistic Test | p-value: 5.58E-12; Z-score: -1.20E+01 | ||
|
Methylation in Case |
2.96E-01 (Median) | Methylation in Control | 6.54E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC23A2 in bladder cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg25554205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.04E+00 | Statistic Test | p-value: 7.22E-12; Z-score: -3.61E+01 | ||
|
Methylation in Case |
4.14E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC23A2 in bladder cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg01162053) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 3.40E-05; Z-score: -4.52E+00 | ||
|
Methylation in Case |
7.68E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC23A2 in bladder cancer | [ 3 ] | |||
|
Location |
TSS200 (cg10150176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.20E+00 | Statistic Test | p-value: 6.59E-15; Z-score: -2.64E+01 | ||
|
Methylation in Case |
2.29E-01 (Median) | Methylation in Control | 7.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC23A2 in bladder cancer | [ 3 ] | |||
|
Location |
TSS200 (cg17978727) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.96E+00 | Statistic Test | p-value: 5.63E-09; Z-score: -8.32E+00 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 3.83E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC23A2 in breast cancer | [ 4 ] | |||
|
Location |
5'UTR (cg12821724) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 4.81E-02; Z-score: -4.71E-01 | ||
|
Methylation in Case |
6.87E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC23A2 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg17978727) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 1.34E-08; Z-score: -1.83E+00 | ||
|
Methylation in Case |
3.20E-01 (Median) | Methylation in Control | 4.51E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC23A2 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg10150176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 2.82E-03; Z-score: -6.52E-01 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 8.29E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC23A2 in colorectal cancer | [ 5 ] | |||
|
Location |
5'UTR (cg12821724) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 8.70E-08; Z-score: -2.20E+00 | ||
|
Methylation in Case |
8.33E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC23A2 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg17978727) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 9.53E-10; Z-score: -2.20E+00 | ||
|
Methylation in Case |
5.28E-01 (Median) | Methylation in Control | 6.70E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC23A2 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg10150176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.24E-07; Z-score: -2.14E+00 | ||
|
Methylation in Case |
8.68E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC23A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
5'UTR (cg12821724) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 8.01E-03; Z-score: -2.97E-01 | ||
|
Methylation in Case |
7.77E-01 (Median) | Methylation in Control | 8.07E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC23A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg25554205) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.51E-03; Z-score: -1.72E-01 | ||
|
Methylation in Case |
8.75E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC23A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg17978727) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 2.89E-09; Z-score: -1.57E+00 | ||
|
Methylation in Case |
4.48E-01 (Median) | Methylation in Control | 5.49E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC23A2 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg10150176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 5.36E-06; Z-score: -1.02E+00 | ||
|
Methylation in Case |
7.79E-01 (Median) | Methylation in Control | 8.09E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC23A2 in panic disorder | [ 7 ] | |||
|
Location |
5'UTR (cg12821724) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 4.76E-02; Z-score: 3.00E-01 | ||
|
Methylation in Case |
2.31E+00 (Median) | Methylation in Control | 2.21E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC23A2 in HIV infection | [ 8 ] | |||
|
Location |
TSS200 (cg17978727) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 2.93E-06; Z-score: -1.89E+00 | ||
|
Methylation in Case |
3.70E-01 (Median) | Methylation in Control | 4.66E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC23A2 in HIV infection | [ 8 ] | |||
|
Location |
TSS200 (cg10150176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.73E-02; Z-score: -7.89E-01 | ||
|
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 8.60E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC23A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS200 (cg10150176) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.77E-03; Z-score: -6.40E-01 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC23A2 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg08830157) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 3.56E-04; Z-score: -1.03E+00 | ||
|
Methylation in Case |
4.38E-01 (Median) | Methylation in Control | 5.76E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC23A2 in pancretic ductal adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg19903766) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 2.40E-02; Z-score: 8.45E-01 | ||
|
Methylation in Case |
4.77E-01 (Median) | Methylation in Control | 4.32E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC23A2 in prostate cancer | [ 11 ] | |||
|
Location |
Body (cg14137381) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.47E+00 | Statistic Test | p-value: 4.13E-02; Z-score: 4.10E+00 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 5.07E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Obesity |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC23A2 in obesity than that in healthy individual | ||||
Studied Phenotype |
Obesity [ICD-11:5B81] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.18E-41; Fold-change: 0.315967601; Z-score: 2.494075499 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC23A2 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.52E-10; Fold-change: -0.32994115; Z-score: -11.06018824 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Histone acetylation |
|||||
|
Colon |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypoacetylation of SLC23A2 in colon (compare with jejunum tissue of human) | [ 12 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes |
Down regulation of SLC23A2 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Colon | ||||
|
Experimental Material |
Patients samples of human | ||||
|
Additional Notes |
Lower levels of H3 acethylation of lysine 9 and lower gene expression was observed in the SLC23A2 promoter in the colon. | ||||
|
Histone trimethylation |
|||||
|
Chronic alcohol exposure |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Higher level of histone trimethylation of SLC23A2 in chronic alcohol exposure (compare with counterpart normal pancreatic acinar rat cells) | [ 13 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone trimethylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes |
Down regulation of SLC23A2 | Experiment Method | Western Blot | ||
|
Studied Phenotype |
Chronic alcohol exposure [ ICD-11: 6C40.2Z] | ||||
|
Experimental Material |
Model organism in vivo (mouse) | ||||
|
Additional Notes |
Chronic exposure of mouse pancreatic acinar tumor cells to alcohol is associated with a significant increase in the level of the H3K27me3 (a repressive mark) of the Slc23a2. | ||||
|
Epigenetic Phenomenon 2 |
Lower level of histone trimethylation of SLC23A2 in chronic alcohol exposure (compare with counterpart normal pancreatic acinar rat cells) | [ 13 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone trimethylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes |
Down regulation of SLC23A2 | Experiment Method | Western Blot | ||
|
Studied Phenotype |
Chronic alcohol exposure [ ICD-11: 6C40.2Z] | ||||
|
Experimental Material |
Model organism in vivo (mouse) | ||||
|
Additional Notes |
Chronic exposure of mouse pancreatic acinar tumor cells to alcohol is associated with a significant reduction in the level of expression of H3K4me3 (an activation mark) of the Slc23a2. | ||||
|
Colon |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Lower level of histone trimethylation of SLC23A2 in colon (compare with jejunum tissue of human) | [ 12 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone trimethylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes |
Down regulation of SLC23A2 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Colon | ||||
|
Experimental Material |
Patients samples of human | ||||
|
Additional Notes |
Lower levels of H3 trimethylation of lysine 4 and lower gene expression was observed in the SLC23A2 promoter in the colon. | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-196b directly targets SLC23A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-196b | miRNA Mature ID | miR-196b-5p | ||
|
miRNA Sequence |
UAGGUAGUUUCCUGUUGUUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 2 |
miR-320b directly targets SLC23A2 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-320b | miRNA Mature ID | miR-320b | ||
|
miRNA Sequence |
AAAAGCUGGGUUGAGAGGGCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples