Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0173 Transporter Info
Gene Name SLC25A15
Transporter Name Mitochondrial ornithine transporter 1
Gene ID
10166
UniProt ID
Q9Y619
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A15 in bladder cancer [ 1 ]

Location

 5'UTR (cg16989646)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.48E+00 Statistic Test p-value: 1.83E-02; Z-score: -2.03E+00

Methylation in Case

 1.80E-01 (Median) Methylation in Control 2.65E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A15 in bladder cancer [ 1 ]

Location

 TSS1500 (cg06567155)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 6.10E-03; Z-score: -1.92E+00

Methylation in Case

 8.83E-01 (Median) Methylation in Control 8.98E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A15 in breast cancer [ 2 ]

Location

 5'UTR (cg23211791)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.01E+00 Statistic Test p-value: 2.50E-11; Z-score: 2.88E+00

Methylation in Case

 1.87E-01 (Median) Methylation in Control 9.31E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A15 in breast cancer [ 2 ]

Location

 5'UTR (cg16989646)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.88E+00 Statistic Test p-value: 3.76E-11; Z-score: 3.16E+00

Methylation in Case

 3.12E-01 (Median) Methylation in Control 1.67E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A15 in breast cancer [ 2 ]

Location

 5'UTR (cg10328297)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.81E-04; Z-score: -6.23E-01

Methylation in Case

 6.20E-01 (Median) Methylation in Control 6.49E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A15 in breast cancer [ 2 ]

Location

 TSS1500 (cg06567155)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.11E-04; Z-score: -1.14E+00

Methylation in Case

 8.29E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A15 in clear cell renal cell carcinoma [ 3 ]

Location

 5'UTR (cg16989646)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.10E+00 Statistic Test p-value: 9.32E-07; Z-score: 1.57E+00

Methylation in Case

 3.15E-01 (Median) Methylation in Control 1.50E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A15 in clear cell renal cell carcinoma [ 3 ]

Location

 5'UTR (cg23211791)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.87E+00 Statistic Test p-value: 1.48E-06; Z-score: 1.60E+00

Methylation in Case

 1.29E-01 (Median) Methylation in Control 4.51E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A15 in hepatocellular carcinoma [ 4 ]

Location

 5'UTR (cg23211791)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.55E+00 Statistic Test p-value: 6.08E-06; Z-score: -1.21E+00

Methylation in Case

 1.37E-01 (Median) Methylation in Control 2.12E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A15 in hepatocellular carcinoma [ 4 ]

Location

 5'UTR (cg16989646)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 3.56E-05; Z-score: -9.99E-01

Methylation in Case

 2.67E-01 (Median) Methylation in Control 3.50E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A15 in hepatocellular carcinoma [ 4 ]

Location

 TSS1500 (cg06567155)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.45E-07; Z-score: -1.15E+00

Methylation in Case

 8.51E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A15 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg25528709)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 1.43E-25; Z-score: 2.00E+00

Methylation in Case

 9.50E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A15 in hepatocellular carcinoma [ 4 ]

Location

 Body (cg08737116)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.53E+00 Statistic Test p-value: 2.87E-10; Z-score: -1.42E+00

Methylation in Case

 1.80E-01 (Median) Methylation in Control 2.74E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A15 in lung adenocarcinoma [ 5 ]

Location

 5'UTR (cg16989646)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.30E+00 Statistic Test p-value: 1.95E-04; Z-score: 2.48E+00

Methylation in Case

 4.48E-01 (Median) Methylation in Control 3.46E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A15 in lung adenocarcinoma [ 5 ]

Location

 5'UTR (cg23211791)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.54E+00 Statistic Test p-value: 1.22E-03; Z-score: 3.75E+00

Methylation in Case

 3.43E-01 (Median) Methylation in Control 2.23E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A15 in lung adenocarcinoma [ 5 ]

Location

 TSS200 (cg18335740)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 4.13E-02; Z-score: 2.68E+00

Methylation in Case

 3.27E-01 (Median) Methylation in Control 2.65E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A15 in pancretic ductal adenocarcinoma [ 6 ]

Location

 TSS1500 (cg20942339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 3.21E-02; Z-score: -7.44E-01

Methylation in Case

 4.57E-02 (Median) Methylation in Control 5.13E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A15 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg17002851)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 9.24E-07; Z-score: 1.73E+00

Methylation in Case

 7.50E-01 (Median) Methylation in Control 6.39E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A15 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg12651599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.26E-06; Z-score: -6.39E-01

Methylation in Case

 8.70E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Colon cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A15 in colon adenocarcinoma [ 7 ]

Location

 Body (cg02426464)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 1.23E-06; Z-score: -1.91E+00

Methylation in Case

 3.30E-01 (Median) Methylation in Control 3.96E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A15 in colon adenocarcinoma [ 7 ]

Location

 Body (cg27082881)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 1.73E-06; Z-score: -3.60E+00

Methylation in Case

 5.39E-01 (Median) Methylation in Control 6.63E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A15 in prostate cancer [ 8 ]

Location

 Body (cg07287345)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 1.95E-02; Z-score: 2.37E+00

Methylation in Case

 9.55E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A15 in prostate cancer [ 8 ]

Location

 Body (cg05887366)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 2.06E-02; Z-score: 2.16E+00

Methylation in Case

 8.77E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          28 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1227 directly targets SLC25A15 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1227 miRNA Mature ID miR-1227-3p

miRNA Sequence

 CGUGCCACCCUUUUCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-1295b directly targets SLC25A15 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1295b miRNA Mature ID miR-1295b-3p

miRNA Sequence

 AAUAGGCCACGGAUCUGGGCAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-193b directly targets SLC25A15 [ 11 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-193b miRNA Mature ID miR-193b-3p

miRNA Sequence

 AACUGGCCCUCAAAGUCCCGCU

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 miR-1976 directly targets SLC25A15 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1976 miRNA Mature ID miR-1976

miRNA Sequence

 CCUCCUGCCCUCCUUGCUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-218 directly targets SLC25A15 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-218 miRNA Mature ID miR-218-5p

miRNA Sequence

 UUGUGCUUGAUCUAACCAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-24 directly targets SLC25A15 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-24 miRNA Mature ID miR-24-3p

miRNA Sequence

 UGGCUCAGUUCAGCAGGAACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-3176 directly targets SLC25A15 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3176 miRNA Mature ID miR-3176

miRNA Sequence

 ACUGGCCUGGGACUACCGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-3186 directly targets SLC25A15 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3186 miRNA Mature ID miR-3186-5p

miRNA Sequence

 CAGGCGUCUGUCUACGUGGCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-3922 directly targets SLC25A15 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3922 miRNA Mature ID miR-3922-3p

miRNA Sequence

 UCUGGCCUUGACUUGACUCUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-423 directly targets SLC25A15 [ 14 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-423 miRNA Mature ID miR-423-3p

miRNA Sequence

 AGCUCGGUCUGAGGCCCCUCAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-4252 directly targets SLC25A15 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4252 miRNA Mature ID miR-4252

miRNA Sequence

 GGCCACUGAGUCAGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-4279 directly targets SLC25A15 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4279 miRNA Mature ID miR-4279

miRNA Sequence

 CUCUCCUCCCGGCUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-4537 directly targets SLC25A15 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4537 miRNA Mature ID miR-4537

miRNA Sequence

 UGAGCCGAGCUGAGCUUAGCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-455 directly targets SLC25A15 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-455 miRNA Mature ID miR-455-3p

miRNA Sequence

 GCAGUCCAUGGGCAUAUACAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-4722 directly targets SLC25A15 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

 ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-4731 directly targets SLC25A15 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4731 miRNA Mature ID miR-4731-5p

miRNA Sequence

 UGCUGGGGGCCACAUGAGUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-5089 directly targets SLC25A15 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5089 miRNA Mature ID miR-5089-5p

miRNA Sequence

 GUGGGAUUUCUGAGUAGCAUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 18

 miR-5589 directly targets SLC25A15 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5589 miRNA Mature ID miR-5589-5p

miRNA Sequence

 GGCUGGGUGCUCUUGUGCAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 19

 miR-619 directly targets SLC25A15 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-619 miRNA Mature ID miR-619-5p

miRNA Sequence

 GCUGGGAUUACAGGCAUGAGCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 20

 miR-6499 directly targets SLC25A15 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6499 miRNA Mature ID miR-6499-3p

miRNA Sequence

 AGCAGUGUUUGUUUUGCCCACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-6506 directly targets SLC25A15 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6506 miRNA Mature ID miR-6506-5p

miRNA Sequence

 ACUGGGAUGUCACUGAAUAUGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-6516 directly targets SLC25A15 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6516 miRNA Mature ID miR-6516-5p

miRNA Sequence

 UUUGCAGUAACAGGUGUGAGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-668 directly targets SLC25A15 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-668 miRNA Mature ID miR-668-5p

miRNA Sequence

 UGCGCCUCGGGUGAGCAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 24

 miR-6720 directly targets SLC25A15 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6720 miRNA Mature ID miR-6720-3p

miRNA Sequence

 CGCGCCUGCAGGAACUGGUAGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 25

 miR-6727 directly targets SLC25A15 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

 UCCUGCCACCUCCUCCGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-6747 directly targets SLC25A15 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

 UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-6807 directly targets SLC25A15 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

 GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 28

 miR-7-5p directly targets SLC25A15 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-7-5p miRNA Mature ID miR-7-5p

miRNA Sequence

 UGGAAGACUAGUGAUUUUGUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
6 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
10 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
11 MicroRNA-193b represses cell proliferation and regulates cyclin D1 in melanoma. Am J Pathol. 2010 May;176(5):2520-9.
12 MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.
13 miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Mol Cell. 2009 Sep 11;35(5):610-25.
14 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
15 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.