Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0175 Transporter Info
Gene Name	SLC25A16
Transporter Name	Graves disease carrier protein
Gene ID	8034
UniProt ID	P16260

Epigenetic Regulations of This DT (EGR)
Methylation
Pancretic ductal adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A16 in pancretic ductal adenocarcinoma			[ 1 ]
Location	5'UTR (cg22639011)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 7.33E-10; Z-score: 1.61E+00
Methylation in Case	4.26E-01 (Median)	Methylation in Control	3.08E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A16 in pancretic ductal adenocarcinoma			[ 1 ]
Location	TSS1500 (cg20491914)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 2.46E-05; Z-score: 4.88E-01
Methylation in Case	3.28E-01 (Median)	Methylation in Control	2.99E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A16 in bladder cancer			[ 2 ]
Location	TSS1500 (cg08620470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.76E-02; Z-score: -9.70E-01
Methylation in Case	8.35E-01 (Median)	Methylation in Control	8.52E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A16 in bladder cancer			[ 2 ]
Location	TSS1500 (cg25565000)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 2.09E-02; Z-score: -2.25E+00
Methylation in Case	6.74E-01 (Median)	Methylation in Control	7.33E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A16 in bladder cancer			[ 2 ]
Location	Body (cg10590909)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 9.93E-03; Z-score: -1.09E+00
Methylation in Case	1.15E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A16 in bladder cancer			[ 2 ]
Location	Body (cg01284033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 4.21E-02; Z-score: -1.31E+00
Methylation in Case	7.02E-02 (Median)	Methylation in Control	9.79E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A16 in breast cancer			[ 3 ]
Location	TSS1500 (cg25565000)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 6.14E-13; Z-score: 1.99E+00
Methylation in Case	7.82E-01 (Median)	Methylation in Control	6.62E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A16 in breast cancer			[ 3 ]
Location	Body (cg16214034)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 7.22E-06; Z-score: 1.22E+00
Methylation in Case	6.46E-01 (Median)	Methylation in Control	5.19E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A16 in breast cancer			[ 3 ]
Location	Body (cg01284033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 6.14E-04; Z-score: 9.06E-01
Methylation in Case	1.08E-01 (Median)	Methylation in Control	8.68E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A16 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg26546862)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.86E-04; Z-score: -1.20E+00
Methylation in Case	8.79E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A16 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg25565000)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 4.33E-02; Z-score: 1.32E+00
Methylation in Case	9.62E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A16 in clear cell renal cell carcinoma			[ 4 ]
Location	1stExon (cg17823321)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 4.77E-04; Z-score: 5.47E-01
Methylation in Case	2.82E-02 (Median)	Methylation in Control	2.65E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A16 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg01284033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.46E+00	Statistic Test	p-value: 4.28E-04; Z-score: 6.89E-01
Methylation in Case	5.73E-02 (Median)	Methylation in Control	3.91E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A16 in colon adenocarcinoma			[ 5 ]
Location	TSS1500 (cg24420041)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.83E+00	Statistic Test	p-value: 1.13E-04; Z-score: 3.21E+00
Methylation in Case	3.30E-01 (Median)	Methylation in Control	1.80E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A16 in colon adenocarcinoma			[ 5 ]
Location	Body (cg04860674)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 7.29E-05; Z-score: -2.19E+00
Methylation in Case	7.37E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A16 in colon adenocarcinoma			[ 5 ]
Location	Body (cg11351837)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 1.01E-04; Z-score: 2.85E+00
Methylation in Case	7.03E-01 (Median)	Methylation in Control	6.02E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A16 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg08620470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 5.22E-03; Z-score: -5.53E-01
Methylation in Case	9.36E-01 (Median)	Methylation in Control	9.42E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A16 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg25565000)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.01E-02; Z-score: -3.75E-01
Methylation in Case	9.33E-01 (Median)	Methylation in Control	9.37E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A16 in papillary thyroid cancer			[ 7 ]
Location	TSS1500 (cg08620470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 2.95E-02; Z-score: 5.98E-01
Methylation in Case	9.18E-01 (Median)	Methylation in Control	9.06E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A16 in atypical teratoid rhabdoid tumor			[ 8 ]
Location	1stExon (cg17823321)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.56E+00	Statistic Test	p-value: 9.36E-18; Z-score: -2.60E+00
Methylation in Case	4.24E-01 (Median)	Methylation in Control	6.62E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A16 in atypical teratoid rhabdoid tumor			[ 8 ]
Location	Body (cg01284033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.86E+00	Statistic Test	p-value: 5.92E-05; Z-score: -1.32E+00
Methylation in Case	2.55E-01 (Median)	Methylation in Control	4.75E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A16 in atypical teratoid rhabdoid tumor			[ 8 ]
Location	Body (cg10590909)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.58E-02; Z-score: -2.30E-01
Methylation in Case	4.88E-01 (Median)	Methylation in Control	5.14E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A16 in atypical teratoid rhabdoid tumor			[ 8 ]
Location	3'UTR (cg07526816)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.51E+00	Statistic Test	p-value: 2.08E-13; Z-score: -2.30E+00
Methylation in Case	4.94E-01 (Median)	Methylation in Control	7.46E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A16 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg08956724)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 6.08E+00	Statistic Test	p-value: 2.04E-20; Z-score: 4.80E+00
Methylation in Case	4.96E-01 (Median)	Methylation in Control	8.16E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A16 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg01284033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 9.43E-05; Z-score: -1.06E+00
Methylation in Case	9.64E-02 (Median)	Methylation in Control	1.22E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A16 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg16214034)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.31E-02; Z-score: 4.25E-01
Methylation in Case	7.14E-01 (Median)	Methylation in Control	6.73E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A16 in hepatocellular carcinoma			[ 9 ]
Location	3'UTR (cg07526816)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.74E-02; Z-score: -3.17E-01
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.65E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A16 in lung adenocarcinoma			[ 10 ]
Location	Body (cg16214034)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 2.24E-03; Z-score: 1.83E+00
Methylation in Case	6.98E-01 (Median)	Methylation in Control	5.74E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Prostate cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A16 in prostate cancer			[ 11 ]
Location	Body (cg18031850)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.18E+00	Statistic Test	p-value: 1.02E-03; Z-score: 2.07E+01
Methylation in Case	4.41E-01 (Median)	Methylation in Control	1.38E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A16 in prostate cancer			[ 11 ]
Location	Body (cg27067158)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.31E-02; Z-score: 2.23E+00
Methylation in Case	9.32E-01 (Median)	Methylation in Control	8.52E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A16 in systemic lupus erythematosus			[ 12 ]
Location	Body (cg01284033)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 9.36E-03; Z-score: -2.40E-01
Methylation in Case	3.26E-01 (Median)	Methylation in Control	3.42E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	68 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1228 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1228	miRNA Mature ID	miR-1228-3p
miRNA Sequence	UCACACCUGCCUCGCCCCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-124 directly targets SLC25A16			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-124	miRNA Mature ID	miR-124-3p
miRNA Sequence	UAAGGCACGCGGUGAAUGCCAA
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 3	miR-1285 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1285	miRNA Mature ID	miR-1285-3p
miRNA Sequence	UCUGGGCAACAAAGUGAGACCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-1289 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1289	miRNA Mature ID	miR-1289
miRNA Sequence	UGGAGUCCAGGAAUCUGCAUUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-129 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-129	miRNA Mature ID	miR-129-5p
miRNA Sequence	CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-1304 directly targets SLC25A16			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1304	miRNA Mature ID	miR-1304-3p
miRNA Sequence	UCUCACUGUAGCCUCGAACCCC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 7	miR-143 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-143	miRNA Mature ID	miR-143-3p
miRNA Sequence	UGAGAUGAAGCACUGUAGCUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-29a directly targets SLC25A16			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-29a	miRNA Mature ID	miR-29a-5p
miRNA Sequence	ACUGAUUUCUUUUGGUGUUCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 9	miR-3149 directly targets SLC25A16			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3149	miRNA Mature ID	miR-3149
miRNA Sequence	UUUGUAUGGAUAUGUGUGUGUAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 10	miR-3187 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3187	miRNA Mature ID	miR-3187-5p
miRNA Sequence	CCUGGGCAGCGUGUGGCUGAAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-3194 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3194	miRNA Mature ID	miR-3194-3p
miRNA Sequence	AGCUCUGCUGCUCACUGGCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-3198 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3198	miRNA Mature ID	miR-3198
miRNA Sequence	GUGGAGUCCUGGGGAAUGGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-32 directly targets SLC25A16			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-32	miRNA Mature ID	miR-32-5p
miRNA Sequence	UAUUGCACAUUACUAAGUUGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-3663 directly targets SLC25A16			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3663	miRNA Mature ID	miR-3663-5p
miRNA Sequence	GCUGGUCUGCGUGGUGCUCGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 15	miR-3689d directly targets SLC25A16			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3689d	miRNA Mature ID	miR-3689d
miRNA Sequence	GGGAGGUGUGAUCUCACACUCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-377 directly targets SLC25A16			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-377	miRNA Mature ID	miR-377-5p
miRNA Sequence	AGAGGUUGCCCUUGGUGAAUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-411 directly targets SLC25A16			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-411	miRNA Mature ID	miR-411-5p
miRNA Sequence	UAGUAGACCGUAUAGCGUACG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 18	miR-4258 directly targets SLC25A16			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4258	miRNA Mature ID	miR-4258
miRNA Sequence	CCCCGCCACCGCCUUGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 19	miR-4294 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4294	miRNA Mature ID	miR-4294
miRNA Sequence	GGGAGUCUACAGCAGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-4309 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4309	miRNA Mature ID	miR-4309
miRNA Sequence	CUGGAGUCUAGGAUUCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-431 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-431	miRNA Mature ID	miR-431-5p
miRNA Sequence	UGUCUUGCAGGCCGUCAUGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-4423 directly targets SLC25A16			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4423	miRNA Mature ID	miR-4423-5p
miRNA Sequence	AGUUGCCUUUUUGUUCCCAUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 23	miR-4524a directly targets SLC25A16			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4524a	miRNA Mature ID	miR-4524a-3p
miRNA Sequence	UGAGACAGGCUUAUGCUGCUAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 24	miR-4534 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4534	miRNA Mature ID	miR-4534
miRNA Sequence	GGAUGGAGGAGGGGUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-455 directly targets SLC25A16			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-455	miRNA Mature ID	miR-455-3p
miRNA Sequence	GCAGUCCAUGGGCAUAUACAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-4707 directly targets SLC25A16			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4707	miRNA Mature ID	miR-4707-3p
miRNA Sequence	AGCCCGCCCCAGCCGAGGUUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 27	miR-4708 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4708	miRNA Mature ID	miR-4708-5p
miRNA Sequence	AGAGAUGCCGCCUUGCUCCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-4770 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4770	miRNA Mature ID	miR-4770
miRNA Sequence	UGAGAUGACACUGUAGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-4781 directly targets SLC25A16			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4781	miRNA Mature ID	miR-4781-3p
miRNA Sequence	AAUGUUGGAAUCCUCGCUAGAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 30	miR-4793 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4793	miRNA Mature ID	miR-4793-3p
miRNA Sequence	UCUGCACUGUGAGUUGGCUGGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-488 directly targets SLC25A16			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-488	miRNA Mature ID	miR-488-3p
miRNA Sequence	UUGAAAGGCUAUUUCUUGGUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 32	miR-508 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-508	miRNA Mature ID	miR-508-5p
miRNA Sequence	UACUCCAGAGGGCGUCACUCAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 33	miR-510 directly targets SLC25A16			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-510	miRNA Mature ID	miR-510-3p
miRNA Sequence	AUUGAAACCUCUAAGAGUGGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 34	miR-5189 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5189	miRNA Mature ID	miR-5189-5p
miRNA Sequence	UCUGGGCACAGGCGGAUGGACAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 35	miR-5691 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5691	miRNA Mature ID	miR-5691
miRNA Sequence	UUGCUCUGAGCUCCGAGAAAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 36	miR-6086 directly targets SLC25A16			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6086	miRNA Mature ID	miR-6086
miRNA Sequence	GGAGGUUGGGAAGGGCAGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 37	miR-6088 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6088	miRNA Mature ID	miR-6088
miRNA Sequence	AGAGAUGAAGCGGGGGGGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 38	miR-612 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-612	miRNA Mature ID	miR-612
miRNA Sequence	GCUGGGCAGGGCUUCUGAGCUCCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 39	miR-6131 directly targets SLC25A16			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6131	miRNA Mature ID	miR-6131
miRNA Sequence	GGCUGGUCAGAUGGGAGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 40	miR-6134 directly targets SLC25A16			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6134	miRNA Mature ID	miR-6134
miRNA Sequence	UGAGGUGGUAGGAUGUAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 41	miR-6499 directly targets SLC25A16			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6499	miRNA Mature ID	miR-6499-3p
miRNA Sequence	AGCAGUGUUUGUUUUGCCCACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 42	miR-6501 directly targets SLC25A16			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6501	miRNA Mature ID	miR-6501-5p
miRNA Sequence	AGUUGCCAGGGCUGCCUUUGGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 43	miR-6512 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6512	miRNA Mature ID	miR-6512-3p
miRNA Sequence	UUCCAGCCCUUCUAAUGGUAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 44	miR-6514 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6514	miRNA Mature ID	miR-6514-5p
miRNA Sequence	UAUGGAGUGGACUUUCAGCUGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 45	miR-6516 directly targets SLC25A16			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6516	miRNA Mature ID	miR-6516-5p
miRNA Sequence	UUUGCAGUAACAGGUGUGAGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 46	miR-661 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-661	miRNA Mature ID	miR-661
miRNA Sequence	UGCCUGGGUCUCUGGCCUGCGCGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 47	miR-665 directly targets SLC25A16			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-665	miRNA Mature ID	miR-665
miRNA Sequence	ACCAGGAGGCUGAGGCCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 48	miR-6720 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6720	miRNA Mature ID	miR-6720-5p
miRNA Sequence	UUCCAGCCCUGGUAGGCGCCGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 49	miR-6805 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6805	miRNA Mature ID	miR-6805-3p
miRNA Sequence	UUGCUCUGCUCCCCCGCCCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 50	miR-6832 directly targets SLC25A16			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6832	miRNA Mature ID	miR-6832-5p
miRNA Sequence	AGUAGAGAGGAAAAGUUAGGGUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 51	miR-6840 directly targets SLC25A16			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6840	miRNA Mature ID	miR-6840-3p
miRNA Sequence	GCCCAGGACUUUGUGCGGGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 52	miR-6843 directly targets SLC25A16			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6843	miRNA Mature ID	miR-6843-3p
miRNA Sequence	AUGGUCUCCUGUUCUCUGCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 53	miR-6848 directly targets SLC25A16			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6848	miRNA Mature ID	miR-6848-3p
miRNA Sequence	GUGGUCUCUUGGCCCCCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 54	miR-6849 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6849	miRNA Mature ID	miR-6849-3p
miRNA Sequence	ACCAGCCUGUGUCCACCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 55	miR-6851 directly targets SLC25A16			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6851	miRNA Mature ID	miR-6851-5p
miRNA Sequence	AGGAGGUGGUACUAGGGGCCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 56	miR-6860 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6860	miRNA Mature ID	miR-6860
miRNA Sequence	ACUGGGCAGGGCUGUGGUGAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 57	miR-6872 directly targets SLC25A16			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6872	miRNA Mature ID	miR-6872-3p
miRNA Sequence	CCCAUGCCUCCUGCCGCGGUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 58	miR-6880 directly targets SLC25A16			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6880	miRNA Mature ID	miR-6880-5p
miRNA Sequence	UGGUGGAGGAAGAGGGCAGCUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 59	miR-744 directly targets SLC25A16			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-744	miRNA Mature ID	miR-744-3p
miRNA Sequence	CUGUUGCCACUAACCUCAACCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 60	miR-766 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-766	miRNA Mature ID	miR-766-3p
miRNA Sequence	ACUCCAGCCCCACAGCCUCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 61	miR-7703 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7703	miRNA Mature ID	miR-7703
miRNA Sequence	UUGCACUCUGGCCUUCUCCCAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 62	miR-7847 directly targets SLC25A16			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7847	miRNA Mature ID	miR-7847-3p
miRNA Sequence	CGUGGAGGACGAGGAGGAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 63	miR-8055 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8055	miRNA Mature ID	miR-8055
miRNA Sequence	CUUUGAGCACAUGAGCAGACGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 64	miR-8082 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8082	miRNA Mature ID	miR-8082
miRNA Sequence	UGAUGGAGCUGGGAAUACUCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 65	miR-924 directly targets SLC25A16			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-924	miRNA Mature ID	miR-924
miRNA Sequence	AGAGUCUUGUGAUGUCUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 66	miR-92a directly targets SLC25A16			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-92a	miRNA Mature ID	miR-92a-3p
miRNA Sequence	UAUUGCACUUGUCCCGGCCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 67	miR-92b directly targets SLC25A16			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-92b	miRNA Mature ID	miR-92b-3p
miRNA Sequence	UAUUGCACUCGUCCCGGCCUCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 68	miR-939 directly targets SLC25A16			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-939	miRNA Mature ID	miR-939-3p
miRNA Sequence	CCCUGGGCCUCUGCUCCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
9	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
13	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
14	The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
15	Ago HITS-CLIP expands understanding of Kaposi's sarcoma-associated herpesvirus miRNA function in primary effusion lymphomas. PLoS Pathog. 2012;8(8):e1002884.
16	A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
17	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
18	EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
19	The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
20	Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
21	Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence