Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0187 Transporter Info
Gene Name SLC25A26
Transporter Name S-adenosylmethionine mitochondrial carrier protein
Gene ID
115286
UniProt ID
Q70HW3
Epigenetic Regulations of This DT (EGR)

Methylation

  Cervical cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypermethylation of SLC25A26 in cervical cancer [ 1 ]

Location

 Promoter (-370 to +1 bp)

Epigenetic Type

 Methylation Experiment Method Bisulfite sequencing

Related Molecular Changes

 Down regulation of SLC25A26 Experiment Method RT-qPCR

Studied Phenotype

 Cervical cancer [ ICD-11: 2C77.Z]

Experimental Material

 Multiple cell lines of human

Additional Notes

 SLC25A26 is down-regulated due to gene promoter Hypermethylation, as a mechanism to promote cell survival and proliferation.

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A26 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 5'UTR (cg07643355)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.31E-07; Z-score: -1.06E+00

Methylation in Case

 7.57E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A26 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 5'UTR (cg16206838)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 1.70E-06; Z-score: -7.67E-01

Methylation in Case

 3.07E-01 (Median) Methylation in Control 3.90E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A26 in breast cancer [ 3 ]

Location

 5'UTR (cg07643355)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.32E+00 Statistic Test p-value: 1.85E-05; Z-score: 8.88E-01

Methylation in Case

 2.01E-01 (Median) Methylation in Control 1.52E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A26 in breast cancer [ 3 ]

Location

 5'UTR (cg16206838)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 1.05E-03; Z-score: 8.01E-01

Methylation in Case

 1.08E-01 (Median) Methylation in Control 8.51E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A26 in breast cancer [ 3 ]

Location

 TSS200 (cg02784780)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 3.27E-16; Z-score: -2.82E+00

Methylation in Case

 6.99E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A26 in breast cancer [ 3 ]

Location

 TSS200 (cg15364450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 4.24E-06; Z-score: -1.26E+00

Methylation in Case

 7.00E-01 (Median) Methylation in Control 8.27E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A26 in colorectal cancer [ 4 ]

Location

 5'UTR (cg16206838)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 5.52E-03; Z-score: -5.67E-01

Methylation in Case

 1.90E-01 (Median) Methylation in Control 2.08E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A26 in colorectal cancer [ 4 ]

Location

 TSS200 (cg02784780)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 3.59E-09; Z-score: -2.74E+00

Methylation in Case

 7.82E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A26 in colorectal cancer [ 4 ]

Location

 TSS200 (cg15364450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 8.24E-05; Z-score: -1.20E+00

Methylation in Case

 8.72E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A26 in colorectal cancer [ 4 ]

Location

 TSS200 (cg07847658)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.01E-03; Z-score: -5.68E-01

Methylation in Case

 8.94E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A26 in HIV infection [ 5 ]

Location

 5'UTR (cg16206838)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 1.21E-04; Z-score: 9.12E-01

Methylation in Case

 1.80E-01 (Median) Methylation in Control 1.44E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A26 in HIV infection [ 5 ]

Location

 5'UTR (cg07643355)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 3.19E-02; Z-score: -6.54E-01

Methylation in Case

 3.54E-01 (Median) Methylation in Control 4.13E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A26 in lung adenocarcinoma [ 6 ]

Location

 5'UTR (cg16206838)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 8.87E-04; Z-score: 3.82E+00

Methylation in Case

 1.93E-01 (Median) Methylation in Control 1.47E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A26 in lung adenocarcinoma [ 6 ]

Location

 TSS200 (cg15364450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.63E-02; Z-score: -1.01E+00

Methylation in Case

 7.87E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A26 in panic disorder [ 7 ]

Location

 5'UTR (cg07643355)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 7.68E-01 Statistic Test p-value: 4.24E-02; Z-score: 4.13E-01

Methylation in Case

 -8.72E-01 (Median) Methylation in Control -1.14E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A26 in panic disorder [ 7 ]

Location

 TSS200 (cg07847658)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.54E-03; Z-score: -5.34E-01

Methylation in Case

 2.52E+00 (Median) Methylation in Control 2.66E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A26 in papillary thyroid cancer [ 8 ]

Location

 5'UTR (cg16206838)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 1.57E-02; Z-score: 5.21E-01

Methylation in Case

 1.35E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A26 in papillary thyroid cancer [ 8 ]

Location

 TSS200 (cg15364450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.52E-02; Z-score: -4.82E-01

Methylation in Case

 8.47E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A26 in systemic lupus erythematosus [ 9 ]

Location

 5'UTR (cg07643355)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 7.56E-03; Z-score: -2.73E-01

Methylation in Case

 4.02E-01 (Median) Methylation in Control 4.25E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A26 in systemic lupus erythematosus [ 9 ]

Location

 TSS200 (cg07847658)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 5.49E-03; Z-score: -3.62E-01

Methylation in Case

 8.66E-01 (Median) Methylation in Control 8.74E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A26 in pancretic ductal adenocarcinoma [ 10 ]

Location

 TSS1500 (cg18074184)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 1.37E-08; Z-score: 1.50E+00

Methylation in Case

 6.16E-01 (Median) Methylation in Control 5.18E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A26 in pancretic ductal adenocarcinoma [ 10 ]

Location

 TSS200 (cg09103232)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.58E-02; Z-score: -9.94E-02

Methylation in Case

 6.95E-02 (Median) Methylation in Control 7.17E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A26 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg05070518)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.50E+00 Statistic Test p-value: 1.23E-10; Z-score: 1.28E+00

Methylation in Case

 1.86E-01 (Median) Methylation in Control 1.24E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A26 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg11189357)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 6.64E-05; Z-score: -4.88E-01

Methylation in Case

 4.41E-01 (Median) Methylation in Control 4.86E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A26 in bladder cancer [ 11 ]

Location

 TSS200 (cg02784780)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.06E+00 Statistic Test p-value: 5.13E-13; Z-score: -1.62E+01

Methylation in Case

 3.99E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A26 in bladder cancer [ 11 ]

Location

 TSS200 (cg07847658)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.67E+00 Statistic Test p-value: 1.72E-11; Z-score: -4.02E+01

Methylation in Case

 4.93E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A26 in bladder cancer [ 11 ]

Location

 TSS200 (cg15364450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.50E+00 Statistic Test p-value: 2.23E-09; Z-score: -1.77E+01

Methylation in Case

 5.56E-01 (Median) Methylation in Control 8.35E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A26 in hepatocellular carcinoma [ 12 ]

Location

 TSS200 (cg02784780)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.94E-07; Z-score: -1.50E+00

Methylation in Case

 7.69E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A26 in hepatocellular carcinoma [ 12 ]

Location

 TSS200 (cg15364450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.35E-02; Z-score: -1.65E-01

Methylation in Case

 8.12E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A26 in hepatocellular carcinoma [ 12 ]

Location

 Body (cg17143291)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.86E+00 Statistic Test p-value: 1.26E-13; Z-score: -2.03E+00

Methylation in Case

 2.67E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A26 in prostate cancer [ 13 ]

Location

 Body (cg18256640)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 7.16E-03; Z-score: 2.89E+00

Methylation in Case

 7.88E-01 (Median) Methylation in Control 5.89E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1301 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1301 miRNA Mature ID miR-1301-3p

miRNA Sequence

 UUGCAGCUGCCUGGGAGUGACUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-3160 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3160 miRNA Mature ID miR-3160-5p

miRNA Sequence

 GGCUUUCUAGUCUCAGCUCUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-329 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

 AACACACCUGGUUAACCUCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-342 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-342 miRNA Mature ID miR-342-3p

miRNA Sequence

 UCUCACACAGAAAUCGCACCCGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-362 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

 AACACACCUAUUCAAGGAUUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-377 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-377 miRNA Mature ID miR-377-3p

miRNA Sequence

 AUCACACAAAGGCAACUUUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-4660 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4660 miRNA Mature ID miR-4660

miRNA Sequence

 UGCAGCUCUGGUGGAAAAUGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-4768 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4768 miRNA Mature ID miR-4768-5p

miRNA Sequence

 AUUCUCUCUGGAUCCCAUGGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-5047 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5047 miRNA Mature ID miR-5047

miRNA Sequence

 UUGCAGCUGCGGUUGUAAGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-6809 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6809 miRNA Mature ID miR-6809-3p

miRNA Sequence

 CUUCUCUUCUCUCCUUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-6833 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6833 miRNA Mature ID miR-6833-3p

miRNA Sequence

 UUUCUCUCUCCACUUCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-6873 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6873 miRNA Mature ID miR-6873-3p

miRNA Sequence

 UUCUCUCUGUCUUUCUCUCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-7156 directly targets SLC25A26 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7156 miRNA Mature ID miR-7156-3p

miRNA Sequence

 CUGCAGCCACUUGGGGAACUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 SLC25A26 overexpression impairs cell function via mtDNA hypermethylation and rewiring of methyl metabolism. FEBS J. 2017 Mar;284(6):967-984.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 DNA Methylation Dynamics in Urological Tumors.
12 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
13 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.