Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0195 Transporter Info | ||||
| Gene Name | SLC25A33 | ||||
| Transporter Name | Bone marrow stromal cell mitochondrial carrier protein | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Colon cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC25A33 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg03835296) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 4.41E-03; Z-score: -1.43E+00 | ||
|
Methylation in Case |
8.00E-01 (Median) | Methylation in Control | 8.42E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC25A33 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg18329052) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 1.33E-04; Z-score: -1.40E+00 | ||
|
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 6.95E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC25A33 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg24751648) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 5.95E-04; Z-score: -1.32E+00 | ||
|
Methylation in Case |
1.56E-01 (Median) | Methylation in Control | 2.40E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC25A33 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg00881552) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.13E+00 | Statistic Test | p-value: 7.79E-04; Z-score: 5.42E+00 | ||
|
Methylation in Case |
2.30E-01 (Median) | Methylation in Control | 1.08E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC25A33 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg11789820) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 4.77E-07; Z-score: -3.19E+00 | ||
|
Methylation in Case |
5.65E-01 (Median) | Methylation in Control | 7.34E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC25A33 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg06121808) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 1.37E-05; Z-score: -2.64E+00 | ||
|
Methylation in Case |
4.17E-01 (Median) | Methylation in Control | 5.41E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC25A33 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg18783781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 9.15E-08; Z-score: -7.13E+00 | ||
|
Methylation in Case |
4.73E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC25A33 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg11826452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 1.93E-05; Z-score: -3.08E+00 | ||
|
Methylation in Case |
5.04E-01 (Median) | Methylation in Control | 5.77E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC25A33 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg25369015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -4.32E+00 | Statistic Test | p-value: 2.38E-04; Z-score: -4.72E+00 | ||
|
Methylation in Case |
2.22E-02 (Median) | Methylation in Control | 9.60E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC25A33 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg19896639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.57E+00 | Statistic Test | p-value: 1.31E-03; Z-score: -3.11E+00 | ||
|
Methylation in Case |
5.54E-02 (Median) | Methylation in Control | 8.71E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC25A33 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg13557160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.77E-03; Z-score: -2.01E+00 | ||
|
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC25A33 in bladder cancer | [ 2 ] | |||
|
Location |
TSS200 (cg10009930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.62E-02; Z-score: -1.09E+00 | ||
|
Methylation in Case |
1.44E-01 (Median) | Methylation in Control | 1.56E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC25A33 in bladder cancer | [ 2 ] | |||
|
Location |
TSS200 (cg04621676) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 4.70E-02; Z-score: 8.81E-01 | ||
|
Methylation in Case |
4.79E-02 (Median) | Methylation in Control | 3.96E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC25A33 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg13688474) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.89E+00 | Statistic Test | p-value: 5.13E-12; Z-score: -1.21E+01 | ||
|
Methylation in Case |
1.26E-01 (Median) | Methylation in Control | 2.38E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC25A33 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg26607031) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.29E+00 | Statistic Test | p-value: 1.65E-06; Z-score: 7.37E+00 | ||
|
Methylation in Case |
7.59E-01 (Median) | Methylation in Control | 2.31E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC25A33 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg23824902) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.85E-04; Z-score: -3.78E+00 | ||
|
Methylation in Case |
6.96E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC25A33 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg06927343) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.20E-04; Z-score: -2.26E+00 | ||
|
Methylation in Case |
8.57E-01 (Median) | Methylation in Control | 8.89E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC25A33 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg09058554) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 2.45E-03; Z-score: -1.93E+00 | ||
|
Methylation in Case |
6.48E-01 (Median) | Methylation in Control | 7.38E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC25A33 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg25369015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -6.66E+00 | Statistic Test | p-value: 1.12E-14; Z-score: -1.96E+00 | ||
|
Methylation in Case |
3.33E-02 (Median) | Methylation in Control | 2.22E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC25A33 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg19896639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -4.28E+00 | Statistic Test | p-value: 7.07E-14; Z-score: -1.91E+00 | ||
|
Methylation in Case |
5.74E-02 (Median) | Methylation in Control | 2.46E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC25A33 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg18783781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 7.53E-09; Z-score: -1.80E+00 | ||
|
Methylation in Case |
6.65E-01 (Median) | Methylation in Control | 8.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC25A33 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg11826452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 9.39E-05; Z-score: -1.08E+00 | ||
|
Methylation in Case |
5.21E-01 (Median) | Methylation in Control | 5.77E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC25A33 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg13557160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 1.14E-03; Z-score: -9.97E-01 | ||
|
Methylation in Case |
6.95E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC25A33 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg10009930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 1.51E-02; Z-score: -3.01E-01 | ||
|
Methylation in Case |
1.44E-01 (Median) | Methylation in Control | 1.55E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC25A33 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg13688474) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.17E+00 | Statistic Test | p-value: 1.02E-27; Z-score: -3.52E+00 | ||
|
Methylation in Case |
1.41E-01 (Median) | Methylation in Control | 3.05E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC25A33 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg26607031) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.71E+00 | Statistic Test | p-value: 7.67E-24; Z-score: 5.18E+00 | ||
|
Methylation in Case |
4.98E-01 (Median) | Methylation in Control | 1.84E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC25A33 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg13631913) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -4.46E+00 | Statistic Test | p-value: 7.50E-16; Z-score: -2.11E+00 | ||
|
Methylation in Case |
5.44E-02 (Median) | Methylation in Control | 2.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC25A33 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg03901886) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.55E+01 | Statistic Test | p-value: 2.03E-12; Z-score: -1.67E+00 | ||
|
Methylation in Case |
1.55E-02 (Median) | Methylation in Control | 2.39E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC25A33 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg09058554) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 2.64E-07; Z-score: -1.28E+00 | ||
|
Methylation in Case |
5.87E-01 (Median) | Methylation in Control | 6.57E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC25A33 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg23824902) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 9.30E-06; Z-score: -1.31E+00 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC25A33 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg25369015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.52E+00 | Statistic Test | p-value: 5.96E-04; Z-score: 3.71E+00 | ||
|
Methylation in Case |
3.51E-02 (Median) | Methylation in Control | 2.32E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC25A33 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg19896639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 3.65E-03; Z-score: 1.39E+00 | ||
|
Methylation in Case |
3.44E-02 (Median) | Methylation in Control | 2.68E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC25A33 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
Body (cg09058554) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 1.10E-07; Z-score: 3.25E+00 | ||
|
Methylation in Case |
9.17E-01 (Median) | Methylation in Control | 7.51E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC25A33 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
Body (cg13688474) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 2.57E-05; Z-score: 2.04E+00 | ||
|
Methylation in Case |
2.54E-01 (Median) | Methylation in Control | 1.92E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC25A33 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
Body (cg13631913) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 4.95E-03; Z-score: 3.01E-01 | ||
|
Methylation in Case |
2.74E-02 (Median) | Methylation in Control | 2.54E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC25A33 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
Body (cg03901886) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 3.01E-02; Z-score: 1.22E+00 | ||
|
Methylation in Case |
3.16E-02 (Median) | Methylation in Control | 2.67E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC25A33 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg13557160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 9.17E-10; Z-score: -2.62E+00 | ||
|
Methylation in Case |
7.86E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC25A33 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg11826452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 4.19E-03; Z-score: -7.84E-01 | ||
|
Methylation in Case |
7.52E-01 (Median) | Methylation in Control | 8.07E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC25A33 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg02360478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.33E-02; Z-score: -4.47E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC25A33 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg25369015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 3.01E-02; Z-score: -2.96E-01 | ||
|
Methylation in Case |
2.08E-02 (Median) | Methylation in Control | 2.76E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC25A33 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg10009930) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 2.50E-05; Z-score: 1.20E+00 | ||
|
Methylation in Case |
1.56E-01 (Median) | Methylation in Control | 1.36E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC25A33 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg26607031) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 3.93E-06; Z-score: 1.25E+00 | ||
|
Methylation in Case |
5.39E-01 (Median) | Methylation in Control | 4.07E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC25A33 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg09058554) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.34E-03; Z-score: -5.13E-01 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 7.71E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC25A33 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg13557160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 4.42E-08; Z-score: -1.74E+00 | ||
|
Methylation in Case |
7.30E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC25A33 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg18783781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 5.94E-08; Z-score: -1.80E+00 | ||
|
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 6.82E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC25A33 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg25369015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 1.86E-03; Z-score: -5.03E-01 | ||
|
Methylation in Case |
2.56E-02 (Median) | Methylation in Control | 3.15E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC25A33 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg02360478) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.65E-02; Z-score: -4.86E-01 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 8.48E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC25A33 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg25370753) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.29E+00 | Statistic Test | p-value: 3.74E-22; Z-score: -1.50E+01 | ||
|
Methylation in Case |
3.93E-01 (Median) | Methylation in Control | 9.01E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC25A33 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg13631913) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 4.62E-06; Z-score: -6.64E-01 | ||
|
Methylation in Case |
6.58E-02 (Median) | Methylation in Control | 7.96E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC25A33 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg26607031) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.38E+00 | Statistic Test | p-value: 1.64E-03; Z-score: -7.91E-01 | ||
|
Methylation in Case |
2.33E-01 (Median) | Methylation in Control | 3.21E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC25A33 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg23824902) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 2.06E-02; Z-score: 1.96E-02 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC25A33 in pancretic ductal adenocarcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg25507121) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 1.57E-09; Z-score: -1.63E+00 | ||
|
Methylation in Case |
4.79E-01 (Median) | Methylation in Control | 6.10E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC25A33 in pancretic ductal adenocarcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg17653824) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.98E+00 | Statistic Test | p-value: 6.30E-19; Z-score: 3.15E+00 | ||
|
Methylation in Case |
3.57E-01 (Median) | Methylation in Control | 1.81E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC25A33 in pancretic ductal adenocarcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg24697682) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 4.22E-03; Z-score: -7.03E-01 | ||
|
Methylation in Case |
7.77E-02 (Median) | Methylation in Control | 8.80E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC25A33 in pancretic ductal adenocarcinoma | [ 7 ] | |||
|
Location |
1stExon (cg00364611) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 7.51E-05; Z-score: -2.17E-01 | ||
|
Methylation in Case |
8.48E-02 (Median) | Methylation in Control | 8.91E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC25A33 in pancretic ductal adenocarcinoma | [ 7 ] | |||
|
Location |
Body (cg22334665) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.49E+00 | Statistic Test | p-value: 6.74E-07; Z-score: 1.31E+00 | ||
|
Methylation in Case |
2.98E-01 (Median) | Methylation in Control | 2.00E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC25A33 in pancretic ductal adenocarcinoma | [ 7 ] | |||
|
Location |
Body (cg01440070) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.39E-02; Z-score: 6.17E-01 | ||
|
Methylation in Case |
6.91E-01 (Median) | Methylation in Control | 6.56E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC25A33 in panic disorder | [ 8 ] | |||
|
Location |
TSS1500 (cg18783781) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.28E-02; Z-score: 2.20E-01 | ||
|
Methylation in Case |
2.65E+00 (Median) | Methylation in Control | 2.56E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC25A33 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS1500 (cg19896639) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.49E+00 | Statistic Test | p-value: 4.05E-10; Z-score: 2.07E+00 | ||
|
Methylation in Case |
2.13E-01 (Median) | Methylation in Control | 1.43E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC25A33 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS1500 (cg13557160) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.68E-09; Z-score: 1.47E+00 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 7.74E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC25A33 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS1500 (cg25369015) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 1.71E-07; Z-score: 1.33E+00 | ||
|
Methylation in Case |
1.80E-01 (Median) | Methylation in Control | 1.31E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC25A33 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS1500 (cg11826452) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 9.57E-04; Z-score: 7.28E-01 | ||
|
Methylation in Case |
5.25E-01 (Median) | Methylation in Control | 5.00E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC25A33 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg26607031) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.38E+00 | Statistic Test | p-value: 1.09E-07; Z-score: 1.43E+00 | ||
|
Methylation in Case |
3.49E-01 (Median) | Methylation in Control | 2.54E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC25A33 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg13688474) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.22E-05; Z-score: 1.02E+00 | ||
|
Methylation in Case |
2.07E-01 (Median) | Methylation in Control | 1.74E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC25A33 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg09058554) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.68E-03; Z-score: 8.08E-01 | ||
|
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC25A33 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg13631913) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.42E-02; Z-score: -7.19E-02 | ||
|
Methylation in Case |
7.68E-02 (Median) | Methylation in Control | 7.79E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC25A33 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg23824902) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 3.90E-02; Z-score: 3.57E-01 | ||
|
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC25A33 in prostate cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg20677436) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 1.06E-02; Z-score: -2.07E+00 | ||
|
Methylation in Case |
4.14E-01 (Median) | Methylation in Control | 5.62E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC25A33 in prostate cancer | [ 10 ] | |||
|
Location |
TSS1500 (cg03483626) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 1.50E-02; Z-score: 1.61E+00 | ||
|
Methylation in Case |
7.65E-01 (Median) | Methylation in Control | 6.20E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC25A33 in prostate cancer | [ 10 ] | |||
|
Location |
TSS200 (cg04963424) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.99E+00 | Statistic Test | p-value: 7.86E-03; Z-score: -2.56E+00 | ||
|
Methylation in Case |
2.40E-01 (Median) | Methylation in Control | 4.78E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC25A33 in prostate cancer | [ 10 ] | |||
|
Location |
TSS200 (cg16829998) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.53E+00 | Statistic Test | p-value: 9.13E-03; Z-score: -2.84E+00 | ||
|
Methylation in Case |
1.13E-01 (Median) | Methylation in Control | 1.72E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC25A33 in prostate cancer | [ 10 ] | |||
|
Location |
Body (cg20241270) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.15E-03; Z-score: 5.14E+00 | ||
|
Methylation in Case |
9.48E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC25A33 in prostate cancer | [ 10 ] | |||
|
Location |
Body (cg13767768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.31E+00 | Statistic Test | p-value: 2.63E-03; Z-score: 5.02E+00 | ||
|
Methylation in Case |
8.96E-01 (Median) | Methylation in Control | 6.82E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC25A33 in prostate cancer | [ 10 ] | |||
|
Location |
Body (cg20730619) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.87E-02; Z-score: 1.63E+00 | ||
|
Methylation in Case |
9.30E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC25A33 in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg26607031) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.65E+00 | Statistic Test | p-value: 2.74E-04; Z-score: 5.96E+00 | ||
|
Methylation in Case |
6.18E-01 (Median) | Methylation in Control | 3.75E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC25A33 in lung adenocarcinoma | [ 11 ] | |||
|
Location |
Body (cg23824902) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.72E-03; Z-score: 1.81E+00 | ||
|
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 7.41E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
100 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-101 directly targets SLC25A33 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-101 | miRNA Mature ID | miR-101-3p | ||
|
miRNA Sequence |
UACAGUACUGUGAUAACUGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 2 |
miR-106a directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-106a | miRNA Mature ID | miR-106a-5p | ||
|
miRNA Sequence |
AAAAGUGCUUACAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-106b directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-106b | miRNA Mature ID | miR-106b-5p | ||
|
miRNA Sequence |
UAAAGUGCUGACAGUGCAGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 4 |
miR-122 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-122 | miRNA Mature ID | miR-122-5p | ||
|
miRNA Sequence |
UGGAGUGUGACAAUGGUGUUUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 5 |
miR-1234 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1234 | miRNA Mature ID | miR-1234-3p | ||
|
miRNA Sequence |
UCGGCCUGACCACCCACCCCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 6 |
miR-1268a directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1268a | miRNA Mature ID | miR-1268a | ||
|
miRNA Sequence |
CGGGCGUGGUGGUGGGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-1268b directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1268b | miRNA Mature ID | miR-1268b | ||
|
miRNA Sequence |
CGGGCGUGGUGGUGGGGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 8 |
miR-1289 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1289 | miRNA Mature ID | miR-1289 | ||
|
miRNA Sequence |
UGGAGUCCAGGAAUCUGCAUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-129 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-129 | miRNA Mature ID | miR-129-5p | ||
|
miRNA Sequence |
CUUUUUGCGGUCUGGGCUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-1304 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1304 | miRNA Mature ID | miR-1304-3p | ||
|
miRNA Sequence |
UCUCACUGUAGCCUCGAACCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 11 |
miR-1304 directly targets SLC25A33 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1304 | miRNA Mature ID | miR-1304-5p | ||
|
miRNA Sequence |
UUUGAGGCUACAGUGAGAUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 12 |
miR-134 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-134 | miRNA Mature ID | miR-134-3p | ||
|
miRNA Sequence |
CCUGUGGGCCACCUAGUCACCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 13 |
miR-143 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-143 | miRNA Mature ID | miR-143-3p | ||
|
miRNA Sequence |
UGAGAUGAAGCACUGUAGCUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 14 |
miR-143 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-143 | miRNA Mature ID | miR-143-5p | ||
|
miRNA Sequence |
GGUGCAGUGCUGCAUCUCUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 15 |
miR-17 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-17 | miRNA Mature ID | miR-17-5p | ||
|
miRNA Sequence |
CAAAGUGCUUACAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 16 |
miR-186 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-3p | ||
|
miRNA Sequence |
GCCCAAAGGUGAAUUUUUUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 17 |
miR-193b directly targets SLC25A33 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-193b | miRNA Mature ID | miR-193b-3p | ||
|
miRNA Sequence |
AACUGGCCCUCAAAGUCCCGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 18 |
miR-1976 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1976 | miRNA Mature ID | miR-1976 | ||
|
miRNA Sequence |
CCUCCUGCCCUCCUUGCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 19 |
miR-20a directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-20a | miRNA Mature ID | miR-20a-5p | ||
|
miRNA Sequence |
UAAAGUGCUUAUAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 20 |
miR-20b directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-20b | miRNA Mature ID | miR-20b-5p | ||
|
miRNA Sequence |
CAAAGUGCUCAUAGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 21 |
miR-2116 directly targets SLC25A33 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-2116 | miRNA Mature ID | miR-2116-5p | ||
|
miRNA Sequence |
GGUUCUUAGCAUAGGAGGUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 22 |
miR-22 directly targets SLC25A33 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-22 | miRNA Mature ID | miR-22-5p | ||
|
miRNA Sequence |
AGUUCUUCAGUGGCAAGCUUUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 23 |
miR-2276 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-2276 | miRNA Mature ID | miR-2276-3p | ||
|
miRNA Sequence |
UCUGCAAGUGUCAGAGGCGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 24 |
miR-26b directly targets SLC25A33 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-3p | ||
|
miRNA Sequence |
CCUGUUCUCCAUUACUUGGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 25 |
miR-302a directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302a | miRNA Mature ID | miR-302a-3p | ||
|
miRNA Sequence |
UAAGUGCUUCCAUGUUUUGGUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 26 |
miR-302b directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302b | miRNA Mature ID | miR-302b-3p | ||
|
miRNA Sequence |
UAAGUGCUUCCAUGUUUUAGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 27 |
miR-302c directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302c | miRNA Mature ID | miR-302c-3p | ||
|
miRNA Sequence |
UAAGUGCUUCCAUGUUUCAGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 28 |
miR-302d directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302d | miRNA Mature ID | miR-302d-3p | ||
|
miRNA Sequence |
UAAGUGCUUCCAUGUUUGAGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 29 |
miR-302e directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302e | miRNA Mature ID | miR-302e | ||
|
miRNA Sequence |
UAAGUGCUUCCAUGCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 30 |
miR-3115 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3115 | miRNA Mature ID | miR-3115 | ||
|
miRNA Sequence |
AUAUGGGUUUACUAGUUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 31 |
miR-3135b directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3135b | miRNA Mature ID | miR-3135b | ||
|
miRNA Sequence |
GGCUGGAGCGAGUGCAGUGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 32 |
miR-3136 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3136 | miRNA Mature ID | miR-3136-3p | ||
|
miRNA Sequence |
UGGCCCAACCUAUUCAGUUAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 33 |
miR-3198 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3198 | miRNA Mature ID | miR-3198 | ||
|
miRNA Sequence |
GUGGAGUCCUGGGGAAUGGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 34 |
miR-3199 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3199 | miRNA Mature ID | miR-3199 | ||
|
miRNA Sequence |
AGGGACUGCCUUAGGAGAAAGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 35 |
miR-3652 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3652 | miRNA Mature ID | miR-3652 | ||
|
miRNA Sequence |
CGGCUGGAGGUGUGAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 36 |
miR-365a directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-365a | miRNA Mature ID | miR-365a-5p | ||
|
miRNA Sequence |
AGGGACUUUUGGGGGCAGAUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 37 |
miR-365b directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-365b | miRNA Mature ID | miR-365b-5p | ||
|
miRNA Sequence |
AGGGACUUUCAGGGGCAGCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 38 |
miR-372 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-372 | miRNA Mature ID | miR-372-3p | ||
|
miRNA Sequence |
AAAGUGCUGCGACAUUUGAGCGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 39 |
miR-373 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-373 | miRNA Mature ID | miR-373-3p | ||
|
miRNA Sequence |
GAAGUGCUUCGAUUUUGGGGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 40 |
miR-377 directly targets SLC25A33 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-377 | miRNA Mature ID | miR-377-5p | ||
|
miRNA Sequence |
AGAGGUUGCCCUUGGUGAAUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 41 |
miR-4279 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4279 | miRNA Mature ID | miR-4279 | ||
|
miRNA Sequence |
CUCUCCUCCCGGCUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 42 |
miR-4294 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4294 | miRNA Mature ID | miR-4294 | ||
|
miRNA Sequence |
GGGAGUCUACAGCAGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 43 |
miR-4309 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4309 | miRNA Mature ID | miR-4309 | ||
|
miRNA Sequence |
CUGGAGUCUAGGAUUCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 44 |
miR-4430 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4430 | miRNA Mature ID | miR-4430 | ||
|
miRNA Sequence |
AGGCUGGAGUGAGCGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 45 |
miR-4433a directly targets SLC25A33 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4433a | miRNA Mature ID | miR-4433a-3p | ||
|
miRNA Sequence |
ACAGGAGUGGGGGUGGGACAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 46 |
miR-4485 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4485 | miRNA Mature ID | miR-4485-5p | ||
|
miRNA Sequence |
ACCGCCUGCCCAGUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 47 |
miR-4534 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4534 | miRNA Mature ID | miR-4534 | ||
|
miRNA Sequence |
GGAUGGAGGAGGGGUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 48 |
miR-4639 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4639 | miRNA Mature ID | miR-4639-3p | ||
|
miRNA Sequence |
UCACUCUCACCUUGCUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 49 |
miR-4677 directly targets SLC25A33 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4677 | miRNA Mature ID | miR-4677-5p | ||
|
miRNA Sequence |
UUGUUCUUUGGUCUUUCAGCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 50 |
miR-4708 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4708 | miRNA Mature ID | miR-4708-5p | ||
|
miRNA Sequence |
AGAGAUGCCGCCUUGCUCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 51 |
miR-4722 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4722 | miRNA Mature ID | miR-4722-3p | ||
|
miRNA Sequence |
ACCUGCCAGCACCUCCCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 52 |
miR-4731 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4731 | miRNA Mature ID | miR-4731-5p | ||
|
miRNA Sequence |
UGCUGGGGGCCACAUGAGUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 53 |
miR-4740 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4740 | miRNA Mature ID | miR-4740-3p | ||
|
miRNA Sequence |
GCCCGAGAGGAUCCGUCCCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 54 |
miR-4770 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4770 | miRNA Mature ID | miR-4770 | ||
|
miRNA Sequence |
UGAGAUGACACUGUAGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 55 |
miR-5001 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5001 | miRNA Mature ID | miR-5001-3p | ||
|
miRNA Sequence |
UUCUGCCUCUGUCCAGGUCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 56 |
miR-504 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-504 | miRNA Mature ID | miR-504-3p | ||
|
miRNA Sequence |
GGGAGUGCAGGGCAGGGUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 57 |
miR-5089 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5089 | miRNA Mature ID | miR-5089-5p | ||
|
miRNA Sequence |
GUGGGAUUUCUGAGUAGCAUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 58 |
miR-512 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-512 | miRNA Mature ID | miR-512-3p | ||
|
miRNA Sequence |
AAGUGCUGUCAUAGCUGAGGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 59 |
miR-519d directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-519d | miRNA Mature ID | miR-519d-3p | ||
|
miRNA Sequence |
CAAAGUGCCUCCCUUUAGAGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 60 |
miR-520a directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-520a | miRNA Mature ID | miR-520a-3p | ||
|
miRNA Sequence |
AAAGUGCUUCCCUUUGGACUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 61 |
miR-520c directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-520c | miRNA Mature ID | miR-520c-3p | ||
|
miRNA Sequence |
AAAGUGCUUCCUUUUAGAGGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 62 |
miR-520d directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-520d | miRNA Mature ID | miR-520d-3p | ||
|
miRNA Sequence |
AAAGUGCUUCUCUUUGGUGGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 63 |
miR-520g directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-520g | miRNA Mature ID | miR-520g-3p | ||
|
miRNA Sequence |
ACAAAGUGCUUCCCUUUAGAGUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 64 |
miR-520h directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-520h | miRNA Mature ID | miR-520h | ||
|
miRNA Sequence |
ACAAAGUGCUUCCCUUUAGAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 65 |
miR-526b directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-526b | miRNA Mature ID | miR-526b-3p | ||
|
miRNA Sequence |
GAAAGUGCUUCCUUUUAGAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 66 |
miR-5589 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5589 | miRNA Mature ID | miR-5589-5p | ||
|
miRNA Sequence |
GGCUGGGUGCUCUUGUGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 67 |
miR-5693 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5693 | miRNA Mature ID | miR-5693 | ||
|
miRNA Sequence |
GCAGUGGCUCUGAAAUGAACUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 68 |
miR-5698 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5698 | miRNA Mature ID | miR-5698 | ||
|
miRNA Sequence |
UGGGGGAGUGCAGUGAUUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 69 |
miR-582 directly targets SLC25A33 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-582 | miRNA Mature ID | miR-582-5p | ||
|
miRNA Sequence |
UUACAGUUGUUCAACCAGUUACU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 70 |
miR-6086 directly targets SLC25A33 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6086 | miRNA Mature ID | miR-6086 | ||
|
miRNA Sequence |
GGAGGUUGGGAAGGGCAGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 71 |
miR-6088 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6088 | miRNA Mature ID | miR-6088 | ||
|
miRNA Sequence |
AGAGAUGAAGCGGGGGGGCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 72 |
miR-610 directly targets SLC25A33 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-610 | miRNA Mature ID | miR-610 | ||
|
miRNA Sequence |
UGAGCUAAAUGUGUGCUGGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 73 |
miR-619 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-619 | miRNA Mature ID | miR-619-5p | ||
|
miRNA Sequence |
GCUGGGAUUACAGGCAUGAGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 74 |
miR-6499 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6499 | miRNA Mature ID | miR-6499-3p | ||
|
miRNA Sequence |
AGCAGUGUUUGUUUUGCCCACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 75 |
miR-6506 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6506 | miRNA Mature ID | miR-6506-5p | ||
|
miRNA Sequence |
ACUGGGAUGUCACUGAAUAUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 76 |
miR-6514 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6514 | miRNA Mature ID | miR-6514-5p | ||
|
miRNA Sequence |
UAUGGAGUGGACUUUCAGCUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 77 |
miR-655 directly targets SLC25A33 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-655 | miRNA Mature ID | miR-655-5p | ||
|
miRNA Sequence |
AGAGGUUAUCCGUGUUAUGUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 78 |
miR-663b directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-663b | miRNA Mature ID | miR-663b | ||
|
miRNA Sequence |
GGUGGCCCGGCCGUGCCUGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 79 |
miR-665 directly targets SLC25A33 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-665 | miRNA Mature ID | miR-665 | ||
|
miRNA Sequence |
ACCAGGAGGCUGAGGCCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 80 |
miR-6716 directly targets SLC25A33 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6716 | miRNA Mature ID | miR-6716-5p | ||
|
miRNA Sequence |
UGGGAAUGGGGGUAAGGGCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 81 |
miR-6727 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6727 | miRNA Mature ID | miR-6727-3p | ||
|
miRNA Sequence |
UCCUGCCACCUCCUCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 82 |
miR-6736 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6736 | miRNA Mature ID | miR-6736-3p | ||
|
miRNA Sequence |
UCAGCUCCUCUCUACCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 83 |
miR-6741 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6741 | miRNA Mature ID | miR-6741-5p | ||
|
miRNA Sequence |
GUGGGUGCUGGUGGGAGCCGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 84 |
miR-6747 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6747 | miRNA Mature ID | miR-6747-3p | ||
|
miRNA Sequence |
UCCUGCCUUCCUCUGCACCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 85 |
miR-6778 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6778 | miRNA Mature ID | miR-6778-3p | ||
|
miRNA Sequence |
UGCCUCCCUGACAUUCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 86 |
miR-6787 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6787 | miRNA Mature ID | miR-6787-3p | ||
|
miRNA Sequence |
UCUCAGCUGCUGCCCUCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 87 |
miR-6789 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6789 | miRNA Mature ID | miR-6789-3p | ||
|
miRNA Sequence |
CGGCGCCCGUGUCUCCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 88 |
miR-6794 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6794 | miRNA Mature ID | miR-6794-3p | ||
|
miRNA Sequence |
CUCACUCUCAGUCCCUCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 89 |
miR-6840 directly targets SLC25A33 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6840 | miRNA Mature ID | miR-6840-3p | ||
|
miRNA Sequence |
GCCCAGGACUUUGUGCGGGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 90 |
miR-6890 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6890 | miRNA Mature ID | miR-6890-3p | ||
|
miRNA Sequence |
CCACUGCCUAUGCCCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 91 |
miR-7107 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7107 | miRNA Mature ID | miR-7107-5p | ||
|
miRNA Sequence |
UCGGCCUGGGGAGGAGGAAGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 92 |
miR-7108 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7108 | miRNA Mature ID | miR-7108-5p | ||
|
miRNA Sequence |
GUGUGGCCGGCAGGCGGGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 93 |
miR-7114 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7114 | miRNA Mature ID | miR-7114-5p | ||
|
miRNA Sequence |
UCUGUGGAGUGGGGUGCCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 94 |
miR-7155 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7155 | miRNA Mature ID | miR-7155-3p | ||
|
miRNA Sequence |
UGGCCCAAGACCUCAGACC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 95 |
miR-8052 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8052 | miRNA Mature ID | miR-8052 | ||
|
miRNA Sequence |
CGGGACUGUAGAGGGCAUGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 96 |
miR-8055 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8055 | miRNA Mature ID | miR-8055 | ||
|
miRNA Sequence |
CUUUGAGCACAUGAGCAGACGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 97 |
miR-8082 directly targets SLC25A33 | [ 14 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-8082 | miRNA Mature ID | miR-8082 | ||
|
miRNA Sequence |
UGAUGGAGCUGGGAAUACUCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 98 |
miR-92a directly targets SLC25A33 | [ 15 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
|
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 99 |
miR-93 directly targets SLC25A33 | [ 13 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-93 | miRNA Mature ID | miR-93-5p | ||
|
miRNA Sequence |
CAAAGUGCUGUUCGUGCAGGUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 100 |
miR-943 directly targets SLC25A33 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-943 | miRNA Mature ID | miR-943 | ||
|
miRNA Sequence |
CUGACUGUUGCCGUCCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.