Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0232 Transporter Info | ||||
| Gene Name | SLC26A4 | ||||
| Transporter Name | Sodium-independent chloride/iodide transporter | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Pancretic ductal adenocarcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC26A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg20124450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 7.60E+00 | Statistic Test | p-value: 1.47E-06; Z-score: 1.97E+00 | ||
|
Methylation in Case |
3.82E-01 (Median) | Methylation in Control | 5.03E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC26A4 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg21248989) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 2.60E-16; Z-score: -2.71E+00 | ||
|
Methylation in Case |
5.48E-01 (Median) | Methylation in Control | 6.60E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC26A4 in prostate cancer | [ 2 ] | |||
|
Location |
1stExon (cg26923754) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 1.36E-02; Z-score: 2.21E+00 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 6.56E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC26A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg22054793) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.65E+00 | Statistic Test | p-value: 7.26E-14; Z-score: -1.58E+01 | ||
|
Methylation in Case |
2.57E-01 (Median) | Methylation in Control | 6.80E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC26A4 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg16793755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 9.83E-06; Z-score: -6.15E+00 | ||
|
Methylation in Case |
4.92E-01 (Median) | Methylation in Control | 6.55E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC26A4 in bladder cancer | [ 3 ] | |||
|
Location |
3'UTR (cg06535968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 9.68E-05; Z-score: -8.18E+00 | ||
|
Methylation in Case |
5.77E-01 (Median) | Methylation in Control | 6.90E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC26A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg22054793) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 4.10E-07; Z-score: -1.22E+00 | ||
|
Methylation in Case |
7.58E-01 (Median) | Methylation in Control | 8.33E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC26A4 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg16793755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.52E-04; Z-score: -1.09E+00 | ||
|
Methylation in Case |
6.27E-01 (Median) | Methylation in Control | 6.72E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC26A4 in breast cancer | [ 4 ] | |||
|
Location |
3'UTR (cg06535968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 8.66E-13; Z-score: 1.99E+00 | ||
|
Methylation in Case |
7.53E-01 (Median) | Methylation in Control | 5.89E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC26A4 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg22054793) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 1.69E-07; Z-score: -2.14E+00 | ||
|
Methylation in Case |
6.05E-01 (Median) | Methylation in Control | 7.57E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC26A4 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg16793755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.63E-03; Z-score: -7.39E-01 | ||
|
Methylation in Case |
8.07E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC26A4 in colorectal cancer | [ 5 ] | |||
|
Location |
3'UTR (cg06535968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.55E-07; Z-score: -2.18E+00 | ||
|
Methylation in Case |
7.98E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC26A4 in panic disorder | [ 6 ] | |||
|
Location |
Body (cg22054793) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 2.08E-02; Z-score: 3.29E-01 | ||
|
Methylation in Case |
1.11E+00 (Median) | Methylation in Control | 9.89E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC26A4 in panic disorder | [ 6 ] | |||
|
Location |
3'UTR (cg06535968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 1.30E-04; Z-score: -6.12E-01 | ||
|
Methylation in Case |
8.71E-01 (Median) | Methylation in Control | 1.14E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC26A4 in papillary thyroid cancer | [ 7 ] | |||
|
Location |
Body (cg22054793) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.23E-10; Z-score: 1.79E+00 | ||
|
Methylation in Case |
8.64E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC26A4 in papillary thyroid cancer | [ 7 ] | |||
|
Location |
Body (cg16793755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 4.44E-04; Z-score: 1.57E+00 | ||
|
Methylation in Case |
8.25E-01 (Median) | Methylation in Control | 7.42E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC26A4 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
3'UTR (cg06535968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 3.50E-09; Z-score: -2.18E+00 | ||
|
Methylation in Case |
6.67E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-124 directly targets SLC26A4 | [ 9 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-124 | miRNA Mature ID | miR-124-3p | ||
|
miRNA Sequence |
UAAGGCACGCGGUGAAUGCCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon 2 |
miR-26b directly targets SLC26A4 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
|
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.