Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0237 Transporter Info | ||||
| Gene Name | SLC26A9 | ||||
| Transporter Name | Anion transporter/exchanger protein 9 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
44 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-1321 directly targets SLC26A9 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1321 | miRNA Mature ID | miR-1321 | ||
|
miRNA Sequence |
CAGGGAGGUGAAUGUGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 2 |
miR-185 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-185 | miRNA Mature ID | miR-185-5p | ||
|
miRNA Sequence |
UGGAGAGAAAGGCAGUUCCUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-302b directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302b | miRNA Mature ID | miR-302b-5p | ||
|
miRNA Sequence |
ACUUUAACAUGGAAGUGCUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 4 |
miR-302d directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-302d | miRNA Mature ID | miR-302d-5p | ||
|
miRNA Sequence |
ACUUUAACAUGGAGGCACUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 5 |
miR-3065 directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3065 | miRNA Mature ID | miR-3065-3p | ||
|
miRNA Sequence |
UCAGCACCAGGAUAUUGUUGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 6 |
miR-3125 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3125 | miRNA Mature ID | miR-3125 | ||
|
miRNA Sequence |
UAGAGGAAGCUGUGGAGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-3150b directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3150b | miRNA Mature ID | miR-3150b-3p | ||
|
miRNA Sequence |
UGAGGAGAUCGUCGAGGUUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 8 |
miR-3175 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3175 | miRNA Mature ID | miR-3175 | ||
|
miRNA Sequence |
CGGGGAGAGAACGCAGUGACGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-3187 directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3187 | miRNA Mature ID | miR-3187-3p | ||
|
miRNA Sequence |
UUGGCCAUGGGGCUGCGCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-3202 directly targets SLC26A9 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3202 | miRNA Mature ID | miR-3202 | ||
|
miRNA Sequence |
UGGAAGGGAGAAGAGCUUUAAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 11 |
miR-3914 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3914 | miRNA Mature ID | miR-3914 | ||
|
miRNA Sequence |
AAGGAACCAGAAAAUGAGAAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 12 |
miR-3916 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3916 | miRNA Mature ID | miR-3916 | ||
|
miRNA Sequence |
AAGAGGAAGAAAUGGCUGGUUCUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 13 |
miR-3928 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3928 | miRNA Mature ID | miR-3928-3p | ||
|
miRNA Sequence |
GGAGGAACCUUGGAGCUUCGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 14 |
miR-4306 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4306 | miRNA Mature ID | miR-4306 | ||
|
miRNA Sequence |
UGGAGAGAAAGGCAGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 15 |
miR-4435 directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4435 | miRNA Mature ID | miR-4435 | ||
|
miRNA Sequence |
AUGGCCAGAGCUCACACAGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 16 |
miR-4476 directly targets SLC26A9 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4476 | miRNA Mature ID | miR-4476 | ||
|
miRNA Sequence |
CAGGAAGGAUUUAGGGACAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 17 |
miR-4640 directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4640 | miRNA Mature ID | miR-4640-3p | ||
|
miRNA Sequence |
CACCCCCUGUUUCCUGGCCCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 18 |
miR-4644 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4644 | miRNA Mature ID | miR-4644 | ||
|
miRNA Sequence |
UGGAGAGAGAAAAGAGACAGAAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 19 |
miR-4667 directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4667 | miRNA Mature ID | miR-4667-3p | ||
|
miRNA Sequence |
UCCCUCCUUCUGUCCCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 20 |
miR-4701 directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4701 | miRNA Mature ID | miR-4701-5p | ||
|
miRNA Sequence |
UUGGCCACCACACCUACCCCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 21 |
miR-4716 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4716 | miRNA Mature ID | miR-4716-3p | ||
|
miRNA Sequence |
AAGGGGGAAGGAAACAUGGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 22 |
miR-4723 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4723 | miRNA Mature ID | miR-4723-5p | ||
|
miRNA Sequence |
UGGGGGAGCCAUGAGAUAAGAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 23 |
miR-4739 directly targets SLC26A9 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4739 | miRNA Mature ID | miR-4739 | ||
|
miRNA Sequence |
AAGGGAGGAGGAGCGGAGGGGCCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 24 |
miR-4756 directly targets SLC26A9 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4756 | miRNA Mature ID | miR-4756-5p | ||
|
miRNA Sequence |
CAGGGAGGCGCUCACUCUCUGCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 25 |
miR-4764 directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4764 | miRNA Mature ID | miR-4764-3p | ||
|
miRNA Sequence |
UUAACUCCUUUCACACCCAUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 26 |
miR-4784 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4784 | miRNA Mature ID | miR-4784 | ||
|
miRNA Sequence |
UGAGGAGAUGCUGGGACUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 27 |
miR-548s directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-548s | miRNA Mature ID | miR-548s | ||
|
miRNA Sequence |
AUGGCCAAAACUGCAGUUAUUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 28 |
miR-5698 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5698 | miRNA Mature ID | miR-5698 | ||
|
miRNA Sequence |
UGGGGGAGUGCAGUGAUUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 29 |
miR-588 directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-588 | miRNA Mature ID | miR-588 | ||
|
miRNA Sequence |
UUGGCCACAAUGGGUUAGAAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 30 |
miR-618 directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-618 | miRNA Mature ID | miR-618 | ||
|
miRNA Sequence |
AAACUCUACUUGUCCUUCUGAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 31 |
miR-6731 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6731 | miRNA Mature ID | miR-6731-5p | ||
|
miRNA Sequence |
UGGGAGAGCAGGGUAUUGUGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 32 |
miR-6758 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6758 | miRNA Mature ID | miR-6758-5p | ||
|
miRNA Sequence |
UAGAGAGGGGAAGGAUGUGAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 33 |
miR-6794 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6794 | miRNA Mature ID | miR-6794-5p | ||
|
miRNA Sequence |
CAGGGGGACUGGGGGUGAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 34 |
miR-6856 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6856 | miRNA Mature ID | miR-6856-5p | ||
|
miRNA Sequence |
AAGAGAGGAGCAGUGGUGCUGUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 35 |
miR-6859 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6859 | miRNA Mature ID | miR-6859-5p | ||
|
miRNA Sequence |
GAGAGGAACAUGGGCUCAGGACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 36 |
miR-6870 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6870 | miRNA Mature ID | miR-6870-5p | ||
|
miRNA Sequence |
UGGGGGAGAUGGGGGUUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 37 |
miR-6871 directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6871 | miRNA Mature ID | miR-6871-3p | ||
|
miRNA Sequence |
CAGCACCCUGUGGCUCCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 38 |
miR-6876 directly targets SLC26A9 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6876 | miRNA Mature ID | miR-6876-5p | ||
|
miRNA Sequence |
CAGGAAGGAGACAGGCAGUUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 39 |
miR-6887 directly targets SLC26A9 | [ 3 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6887 | miRNA Mature ID | miR-6887-3p | ||
|
miRNA Sequence |
UCCCCUCCACUUUCCUCCUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 40 |
miR-7106 directly targets SLC26A9 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7106 | miRNA Mature ID | miR-7106-5p | ||
|
miRNA Sequence |
UGGGAGGAGGGGAUCUUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 41 |
miR-7111 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7111 | miRNA Mature ID | miR-7111-5p | ||
|
miRNA Sequence |
UGGGGGAGGAAGGACAGGCCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 42 |
miR-7515 directly targets SLC26A9 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-7515 | miRNA Mature ID | miR-7515 | ||
|
miRNA Sequence |
AGAAGGGAAGAUGGUGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 43 |
miR-765 directly targets SLC26A9 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-765 | miRNA Mature ID | miR-765 | ||
|
miRNA Sequence |
UGGAGGAGAAGGAAGGUGAUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 44 |
miR-8085 directly targets SLC26A9 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8085 | miRNA Mature ID | miR-8085 | ||
|
miRNA Sequence |
UGGGAGAGAGGACUGUGAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Methylation |
|||||
|
Liver cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant/significant hypermethylation of SLC26A9 in liver cancer than that in healthy individual/adjacent tissue | ||||
Studied Phenotype |
Liver cancer [ICD-11:2C12] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.93E-11; Fold-change: -0.371479338; Z-score: -2.185370184 | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 1.13E-17; Fold-change: -0.396091941; Z-score: -7.649001796 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Peripheral neuroectodermal tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC26A9 in peripheral neuroectodermal tumour than that in healthy individual | ||||
Studied Phenotype |
Peripheral neuroectodermal tumour [ICD-11:2B52] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.011551441; Fold-change: 0.282891522; Z-score: 0.836031628 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Pulmonary hypertension |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC26A9 in pulmonary hypertension than that in healthy individual | ||||
Studied Phenotype |
Pulmonary hypertension [ICD-11:BB01] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.016234259; Fold-change: 0.246981524; Z-score: 2.425512893 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Melanoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC26A9 in melanoma than that in healthy individual | ||||
Studied Phenotype |
Melanoma [ICD-11:2C30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000221784; Fold-change: -0.23702148; Z-score: -11.5345965 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Obesity |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC26A9 in obesity than that in healthy individual | ||||
Studied Phenotype |
Obesity [ICD-11:5B81] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.88E-07; Fold-change: -0.236241857; Z-score: -3.08540699 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Ovarian cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC26A9 in ovarian cancer than that in healthy individual | ||||
Studied Phenotype |
Ovarian cancer [ICD-11:2C73] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.014071479; Fold-change: -0.253133791; Z-score: -1.127840331 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Arterial aneurysm |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC26A9 in arterial aneurysm than that in healthy individual | ||||
Studied Phenotype |
Arterial aneurysm [ICD-11:BD51] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000267469; Fold-change: 0.706624502; Z-score: 1.899896576 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Atypical teratoid rhabdoid tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC26A9 in atypical teratoid rhabdoid tumour than that in healthy individual | ||||
Studied Phenotype |
Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.39E-07; Fold-change: 0.436197209; Z-score: 1.28832318 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC26A9 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000361349; Fold-change: 0.453903588; Z-score: 4.627337545 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC26A9 in prostate cancer than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer [ICD-11:2C82] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.95E-07; Fold-change: 0.461784475; Z-score: 3.266756661 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC26A9 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.29E-10; Fold-change: -0.408997771; Z-score: -1.163699696 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Brain neuroepithelial tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC26A9 in brain neuroepithelial tumour than that in healthy individual | ||||
Studied Phenotype |
Brain neuroepithelial tumour [ICD-11:2A00.2Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 9.86E-11; Fold-change: -0.491677721; Z-score: -1.612321906 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Posterior fossa ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC26A9 in posterior fossa ependymoma than that in healthy individual | ||||
Studied Phenotype |
Posterior fossa ependymoma [ICD-11:2D50.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.22E-48; Fold-change: -0.483042883; Z-score: -1.86178338 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
RELA YAP fusion ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC26A9 in rela yap fusion ependymoma than that in healthy individual | ||||
Studied Phenotype |
RELA YAP fusion ependymoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 2.55E-13; Fold-change: -0.35999925; Z-score: -1.299436665 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Vestibular melanotic schwannoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC26A9 in vestibular melanotic schwannoma than that in healthy individual | ||||
Studied Phenotype |
Vestibular melanotic schwannoma [ICD-11:2A02.3] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 2.17E-05; Fold-change: -0.307898545; Z-score: -4.497786905 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Renal cell carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC26A9 in renal cell carcinoma than that in adjacent tissue | ||||
Studied Phenotype |
Renal cell carcinoma [ICD-11:2C90] | ||||
The Methylation Level of Disease Section Compare with the Adjacent Tissue |
p-value: 0.000599789; Fold-change: -0.236917322; Z-score: -1.485921732 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
|
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples