Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0244 Transporter Info
Gene Name SLC28A1
Transporter Name Concentrative nucleoside transporter 1
Gene ID
9154
UniProt ID
O00337
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A1 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg20023155)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.51E+00 Statistic Test p-value: 1.76E-15; Z-score: -8.83E+00

Methylation in Case

 6.06E-01 (Median) Methylation in Control 9.18E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A1 in prostate cancer [ 2 ]

Location

 Body (cg25194194)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 2.31E-02; Z-score: 2.05E+00

Methylation in Case

 9.05E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A1 in atypical teratoid rhabdoid tumor [ 3 ]

Location

 3'UTR (cg24945881)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.51E+00 Statistic Test p-value: 1.78E-09; Z-score: 1.69E+00

Methylation in Case

 4.70E-01 (Median) Methylation in Control 3.11E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A1 in bladder cancer [ 4 ]

Location

 3'UTR (cg24945881)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.98E-02; Z-score: -5.95E-02

Methylation in Case

 7.17E-01 (Median) Methylation in Control 7.18E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A1 in breast cancer [ 5 ]

Location

 3'UTR (cg24945881)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.11E-10; Z-score: -1.69E+00

Methylation in Case

 7.16E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A1 in colorectal cancer [ 6 ]

Location

 3'UTR (cg24945881)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.42E-03; Z-score: -4.20E-01

Methylation in Case

 8.89E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A1 in lung adenocarcinoma [ 7 ]

Location

 3'UTR (cg24945881)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 9.19E-03; Z-score: -2.49E+00

Methylation in Case

 7.55E-01 (Median) Methylation in Control 7.94E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A1 in papillary thyroid cancer [ 8 ]

Location

 3'UTR (cg24945881)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 9.66E-03; Z-score: -7.65E-01

Methylation in Case

 8.09E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer metastasis

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypermethylation of SLC28A1 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

 Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.000629878; Fold-change: 0.258551096; Z-score: 5.094875624
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Brain neuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC28A1 in brain neuroblastoma than that in healthy individual

Studied Phenotype

 Brain neuroblastoma [ICD-11:2A00.11]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.27E-14; Fold-change: -0.263286059; Z-score: -2.320729253
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Cerebellar liponeurocytoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC28A1 in cerebellar liponeurocytoma than that in healthy individual

Studied Phenotype

 Cerebellar liponeurocytoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.008684741; Fold-change: -0.227054797; Z-score: -1.318359979
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Chordoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC28A1 in chordoma than that in healthy individual

Studied Phenotype

 Chordoma [ICD-11:5A61.0]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.002002364; Fold-change: -0.273766242; Z-score: -9.330544424
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Lymphoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC28A1 in lymphoma than that in healthy individual

Studied Phenotype

 Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 3.94E-09; Fold-change: -0.277457671; Z-score: -3.144490514
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Posterior fossa ependymoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC28A1 in posterior fossa ependymoma than that in healthy individual

Studied Phenotype

 Posterior fossa ependymoma [ICD-11:2D50.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.68E-194; Fold-change: -0.343948709; Z-score: -5.634705005
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

          83 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-103a directly targets SLC28A1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-103a miRNA Mature ID miR-103a-3p

miRNA Sequence

 AGCAGCAUUGUACAGGGCUAUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-106a directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-106a miRNA Mature ID miR-106a-5p

miRNA Sequence

 AAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-106b directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

 UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-107 directly targets SLC28A1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-107 miRNA Mature ID miR-107

miRNA Sequence

 AGCAGCAUUGUACAGGGCUAUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-1193 directly targets SLC28A1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1193 miRNA Mature ID miR-1193

miRNA Sequence

 GGGAUGGUAGACCGGUGACGUGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-1224 directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1224 miRNA Mature ID miR-1224-3p

miRNA Sequence

 CCCCACCUCCUCUCUCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-1225 directly targets SLC28A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1225 miRNA Mature ID miR-1225-5p

miRNA Sequence

 GUGGGUACGGCCCAGUGGGGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-1244 directly targets SLC28A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1244 miRNA Mature ID miR-1244

miRNA Sequence

 AAGUAGUUGGUUUGUAUGAGAUGGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-1245b directly targets SLC28A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1245b miRNA Mature ID miR-1245b-3p

miRNA Sequence

 UCAGAUGAUCUAAAGGCCUAUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-1261 directly targets SLC28A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1261 miRNA Mature ID miR-1261

miRNA Sequence

 AUGGAUAAGGCUUUGGCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-1301 directly targets SLC28A1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1301 miRNA Mature ID miR-1301-3p

miRNA Sequence

 UUGCAGCUGCCUGGGAGUGACUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-17 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

 CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-186 directly targets SLC28A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-186 miRNA Mature ID miR-186-5p

miRNA Sequence

 CAAAGAAUUCUCCUUUUGGGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-20a directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

 UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-20b directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-20b miRNA Mature ID miR-20b-5p

miRNA Sequence

 CAAAGUGCUCAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-26b directly targets SLC28A1 [ 14 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 17

 miR-302a directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-302a miRNA Mature ID miR-302a-3p

miRNA Sequence

 UAAGUGCUUCCAUGUUUUGGUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 18

 miR-302b directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-302b miRNA Mature ID miR-302b-3p

miRNA Sequence

 UAAGUGCUUCCAUGUUUUAGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 19

 miR-302c directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-302c miRNA Mature ID miR-302c-3p

miRNA Sequence

 UAAGUGCUUCCAUGUUUCAGUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 20

 miR-302d directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-302d miRNA Mature ID miR-302d-3p

miRNA Sequence

 UAAGUGCUUCCAUGUUUGAGUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 21

 miR-302e directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-302e miRNA Mature ID miR-302e

miRNA Sequence

 UAAGUGCUUCCAUGCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-3130 directly targets SLC28A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3130 miRNA Mature ID miR-3130-3p

miRNA Sequence

 GCUGCACCGGAGACUGGGUAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-3133 directly targets SLC28A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3133 miRNA Mature ID miR-3133

miRNA Sequence

 UAAAGAACUCUUAAAACCCAAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 24

 miR-3194 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3194 miRNA Mature ID miR-3194-5p

miRNA Sequence

 GGCCAGCCACCAGGAGGGCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 25

 miR-3663 directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3663 miRNA Mature ID miR-3663-5p

miRNA Sequence

 GCUGGUCUGCGUGGUGCUCGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-3682 directly targets SLC28A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3682 miRNA Mature ID miR-3682-5p

miRNA Sequence

 CUACUUCUACCUGUGUUAUCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-371a directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-371a miRNA Mature ID miR-371a-5p

miRNA Sequence

 ACUCAAACUGUGGGGGCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-371b directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-371b miRNA Mature ID miR-371b-5p

miRNA Sequence

 ACUCAAAAGAUGGCGGCACUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-372 directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-372 miRNA Mature ID miR-372-5p

miRNA Sequence

 CCUCAAAUGUGGAGCACUAUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-372 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-372 miRNA Mature ID miR-372-3p

miRNA Sequence

 AAAGUGCUGCGACAUUUGAGCGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 31

 miR-373 directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-373 miRNA Mature ID miR-373-5p

miRNA Sequence

 ACUCAAAAUGGGGGCGCUUUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-373 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-373 miRNA Mature ID miR-373-3p

miRNA Sequence

 GAAGUGCUUCGAUUUUGGGGUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 33

 miR-378a directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-378a miRNA Mature ID miR-378a-5p

miRNA Sequence

 CUCCUGACUCCAGGUCCUGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-421 directly targets SLC28A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-421 miRNA Mature ID miR-421

miRNA Sequence

 AUCAACAGACAUUAAUUGGGCGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 35

 miR-4253 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4253 miRNA Mature ID miR-4253

miRNA Sequence

 AGGGCAUGUCCAGGGGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 36

 miR-4275 directly targets SLC28A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4275 miRNA Mature ID miR-4275

miRNA Sequence

 CCAAUUACCACUUCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-432 directly targets SLC28A1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-432 miRNA Mature ID miR-432-3p

miRNA Sequence

 CUGGAUGGCUCCUCCAUGUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 38

 miR-433 directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-433 miRNA Mature ID miR-433-3p

miRNA Sequence

 AUCAUGAUGGGCUCCUCGGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-4470 directly targets SLC28A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4470 miRNA Mature ID miR-4470

miRNA Sequence

 UGGCAAACGUGGAAGCCGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-4506 directly targets SLC28A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4506 miRNA Mature ID miR-4506

miRNA Sequence

 AAAUGGGUGGUCUGAGGCAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 41

 miR-4703 directly targets SLC28A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4703 miRNA Mature ID miR-4703-3p

miRNA Sequence

 UGUAGUUGUAUUGUAUUGCCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 42

 miR-4709 directly targets SLC28A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4709 miRNA Mature ID miR-4709-5p

miRNA Sequence

 ACAACAGUGACUUGCUCUCCAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 43

 miR-4731 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4731 miRNA Mature ID miR-4731-5p

miRNA Sequence

 UGCUGGGGGCCACAUGAGUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 44

 miR-4731 directly targets SLC28A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4731 miRNA Mature ID miR-4731-3p

miRNA Sequence

 CACACAAGUGGCCCCCAACACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 45

 miR-4789 directly targets SLC28A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4789 miRNA Mature ID miR-4789-5p

miRNA Sequence

 GUAUACACCUGAUAUGUGUAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 46

 miR-4790 directly targets SLC28A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4790 miRNA Mature ID miR-4790-3p

miRNA Sequence

 UGAAUGGUAAAGCGAUGUCACA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 47

 miR-4793 directly targets SLC28A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4793 miRNA Mature ID miR-4793-3p

miRNA Sequence

 UCUGCACUGUGAGUUGGCUGGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 48

 miR-4801 directly targets SLC28A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4801 miRNA Mature ID miR-4801

miRNA Sequence

 UACACAAGAAAACCAAGGCUCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 49

 miR-4802 directly targets SLC28A1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4802 miRNA Mature ID miR-4802-3p

miRNA Sequence

 UACAUGGAUGGAAACCUUCAAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 50

 miR-490 directly targets SLC28A1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-490 miRNA Mature ID miR-490-5p

miRNA Sequence

 CCAUGGAUCUCCAGGUGGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 51

 miR-497 directly targets SLC28A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-497 miRNA Mature ID miR-497-3p

miRNA Sequence

 CAAACCACACUGUGGUGUUAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 52

 miR-5047 directly targets SLC28A1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5047 miRNA Mature ID miR-5047

miRNA Sequence

 UUGCAGCUGCGGUUGUAAGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 53

 miR-5089 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5089 miRNA Mature ID miR-5089-5p

miRNA Sequence

 GUGGGAUUUCUGAGUAGCAUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 54

 miR-512 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-512 miRNA Mature ID miR-512-3p

miRNA Sequence

 AAGUGCUGUCAUAGCUGAGGUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 55

 miR-5197 directly targets SLC28A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5197 miRNA Mature ID miR-5197-5p

miRNA Sequence

 CAAUGGCACAAACUCAUUCUUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 56

 miR-519d directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-519d miRNA Mature ID miR-519d-3p

miRNA Sequence

 CAAAGUGCCUCCCUUUAGAGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 57

 miR-520a directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-520a miRNA Mature ID miR-520a-3p

miRNA Sequence

 AAAGUGCUUCCCUUUGGACUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 58

 miR-520c directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-520c miRNA Mature ID miR-520c-3p

miRNA Sequence

 AAAGUGCUUCCUUUUAGAGGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 59

 miR-520d directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-520d miRNA Mature ID miR-520d-3p

miRNA Sequence

 AAAGUGCUUCUCUUUGGUGGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 60

 miR-520g directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-520g miRNA Mature ID miR-520g-3p

miRNA Sequence

 ACAAAGUGCUUCCCUUUAGAGUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 61

 miR-520h directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-520h miRNA Mature ID miR-520h

miRNA Sequence

 ACAAAGUGCUUCCCUUUAGAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 62

 miR-526b directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-526b miRNA Mature ID miR-526b-3p

miRNA Sequence

 GAAAGUGCUUCCUUUUAGAGGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 63

 miR-544a directly targets SLC28A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-544a miRNA Mature ID miR-544a

miRNA Sequence

 AUUCUGCAUUUUUAGCAAGUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 64

 miR-548aa directly targets SLC28A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548aa miRNA Mature ID miR-548aa

miRNA Sequence

 AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 65

 miR-548t directly targets SLC28A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548t miRNA Mature ID miR-548t-3p

miRNA Sequence

 AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 66

 miR-5589 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5589 miRNA Mature ID miR-5589-5p

miRNA Sequence

 GGCUGGGUGCUCUUGUGCAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 67

 miR-5683 directly targets SLC28A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5683 miRNA Mature ID miR-5683

miRNA Sequence

 UACAGAUGCAGAUUCUCUGACUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 68

 miR-6131 directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6131 miRNA Mature ID miR-6131

miRNA Sequence

 GGCUGGUCAGAUGGGAGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 69

 miR-616 directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-616 miRNA Mature ID miR-616-5p

miRNA Sequence

 ACUCAAAACCCUUCAGUGACUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 70

 miR-619 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-619 miRNA Mature ID miR-619-5p

miRNA Sequence

 GCUGGGAUUACAGGCAUGAGCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 71

 miR-640 directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-640 miRNA Mature ID miR-640

miRNA Sequence

 AUGAUCCAGGAACCUGCCUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 72

 miR-6506 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6506 miRNA Mature ID miR-6506-5p

miRNA Sequence

 ACUGGGAUGUCACUGAAUAUGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 73

 miR-6516 directly targets SLC28A1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6516 miRNA Mature ID miR-6516-5p

miRNA Sequence

 UUUGCAGUAACAGGUGUGAGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 74

 miR-6790 directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6790 miRNA Mature ID miR-6790-3p

miRNA Sequence

 CGACCUCGGCGACCCCUCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 75

 miR-6807 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

 GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 76

 miR-6821 directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6821 miRNA Mature ID miR-6821-3p

miRNA Sequence

 UGACCUCUCCGCUCCGCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 77

 miR-6843 directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6843 miRNA Mature ID miR-6843-3p

miRNA Sequence

 AUGGUCUCCUGUUCUCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 78

 miR-6848 directly targets SLC28A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6848 miRNA Mature ID miR-6848-3p

miRNA Sequence

 GUGGUCUCUUGGCCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 79

 miR-6849 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

 ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 80

 miR-6862 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6862 miRNA Mature ID miR-6862-5p

miRNA Sequence

 CGGGCAUGCUGGGAGAGACUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 81

 miR-7156 directly targets SLC28A1 [ 9 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7156 miRNA Mature ID miR-7156-3p

miRNA Sequence

 CUGCAGCCACUUGGGGAACUGGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 82

 miR-767 directly targets SLC28A1 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-767 miRNA Mature ID miR-767-5p

miRNA Sequence

 UGCACCAUGGUUGUCUGAGCAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 83

 miR-93 directly targets SLC28A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

 CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
3 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
4 DNA Methylation Dynamics in Urological Tumors.
5 Genome-wide Scan for Methylation Profiles in Breast Cancer
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
10 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
11 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
12 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
13 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
14 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
15 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.