Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0290 Transporter Info
Gene Name SLC35A4
Transporter Name Probable UDP-sugar transporter protein SLC35A4
Gene ID
113829
UniProt ID
Q96G79
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35A4 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS200 (cg22426397)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.74E-02; Z-score: -2.95E-01

Methylation in Case

 8.23E-02 (Median) Methylation in Control 8.79E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35A4 in bladder cancer [ 2 ]

Location

 Body (cg27337021)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.24E-02; Z-score: -9.04E-01

Methylation in Case

 9.17E-01 (Median) Methylation in Control 9.29E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC35A4 in lung adenocarcinoma [ 3 ]

Location

 Body (cg27337021)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 9.81E-04; Z-score: -2.47E+00

Methylation in Case

 9.35E-01 (Median) Methylation in Control 9.50E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7a directly targets SLC35A4 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 let-7a miRNA Mature ID let-7a-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 let-7c directly targets SLC35A4 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 let-7c miRNA Mature ID let-7c-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUAUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 let-7d directly targets SLC35A4 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 let-7d miRNA Mature ID let-7d-5p

miRNA Sequence

 AGAGGUAGUAGGUUGCAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-103a directly targets SLC35A4 [ 5 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-103a miRNA Mature ID miR-103a-3p

miRNA Sequence

 AGCAGCAUUGUACAGGGCUAUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-125b directly targets SLC35A4 [ 6 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-125b miRNA Mature ID miR-125b-5p

miRNA Sequence

 UCCCUGAGACCCUAACUUGUGA

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 miR-16 directly targets SLC35A4 [ 7 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-26a directly targets SLC35A4 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-26a miRNA Mature ID miR-26a-5p

miRNA Sequence

 UUCAAGUAAUCCAGGAUAGGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-93 directly targets SLC35A4 [ 4 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-93 miRNA Mature ID miR-93-3p

miRNA Sequence

 ACUGCUGAGCUAGCACUUCCCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
4 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
5 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
6 Widespread deregulation of microRNA expression in human prostate cancer. Oncogene. 2008 Mar 13;27(12):1788-93.
7 A microarray-based approach identifies ADP ribosylation factor-like protein 2 as a target of microRNA-16. J Biol Chem. 2011 Mar 18;286(11):9468-76.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.