Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0298 Transporter Info | ||||
| Gene Name | SLC35D1 | ||||
| Transporter Name | UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Pancretic ductal adenocarcinoma |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC35D1 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg12859923) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.13E-02; Z-score: -1.11E-01 | ||
|
Methylation in Case |
7.20E-02 (Median) | Methylation in Control | 7.32E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC35D1 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg19283196) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 9.82E-05; Z-score: 4.44E-01 | ||
|
Methylation in Case |
3.21E-01 (Median) | Methylation in Control | 2.96E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC35D1 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg23130076) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.20E-02; Z-score: 1.89E-01 | ||
|
Methylation in Case |
2.84E-02 (Median) | Methylation in Control | 2.71E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC35D1 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg00790847) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 2.17E-06; Z-score: 1.17E+00 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 7.25E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC35D1 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg27357229) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 3.97E-03; Z-score: -8.33E-01 | ||
|
Methylation in Case |
6.40E-01 (Median) | Methylation in Control | 7.00E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC35D1 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg19614911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.83E-02; Z-score: 2.48E-01 | ||
|
Methylation in Case |
3.64E-01 (Median) | Methylation in Control | 3.59E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC35D1 in prostate cancer | [ 2 ] | |||
|
Location |
5'UTR (cg16772035) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.41E+00 | Statistic Test | p-value: 1.97E-03; Z-score: 6.71E+00 | ||
|
Methylation in Case |
3.14E-01 (Median) | Methylation in Control | 7.13E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC35D1 in bladder cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg06794441) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 1.05E-03; Z-score: -2.41E+00 | ||
|
Methylation in Case |
7.88E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC35D1 in bladder cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg21115004) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.77E+00 | Statistic Test | p-value: 1.37E-02; Z-score: -1.54E+00 | ||
|
Methylation in Case |
5.55E-02 (Median) | Methylation in Control | 9.84E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC35D1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg09861436) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 1.12E-08; Z-score: -1.00E+01 | ||
|
Methylation in Case |
5.02E-01 (Median) | Methylation in Control | 7.42E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC35D1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg23015917) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.71E+00 | Statistic Test | p-value: 3.29E-04; Z-score: 3.36E+00 | ||
|
Methylation in Case |
5.08E-01 (Median) | Methylation in Control | 2.97E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC35D1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg19764326) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.95E-02; Z-score: -1.07E+00 | ||
|
Methylation in Case |
5.83E-01 (Median) | Methylation in Control | 6.15E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC35D1 in bladder cancer | [ 3 ] | |||
|
Location |
Body (cg13986884) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.04E-02; Z-score: -6.48E-01 | ||
|
Methylation in Case |
8.55E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC35D1 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg25208677) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.43E-02; Z-score: 5.12E-01 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 6.82E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC35D1 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg14626797) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 1.35E-03; Z-score: 1.28E+00 | ||
|
Methylation in Case |
1.47E-01 (Median) | Methylation in Control | 1.22E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC35D1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg23015917) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.97E+00 | Statistic Test | p-value: 6.16E-30; Z-score: 3.83E+00 | ||
|
Methylation in Case |
5.69E-01 (Median) | Methylation in Control | 2.88E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC35D1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg09861436) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.79E-04; Z-score: -3.32E-01 | ||
|
Methylation in Case |
8.05E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC35D1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg13986884) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.50E-02; Z-score: 4.86E-01 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 8.25E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC35D1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg17930550) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 2.92E-02; Z-score: 4.48E-01 | ||
|
Methylation in Case |
1.36E-01 (Median) | Methylation in Control | 1.21E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC35D1 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg19764326) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.01E-02; Z-score: -5.83E-01 | ||
|
Methylation in Case |
6.09E-01 (Median) | Methylation in Control | 6.47E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC35D1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg21115004) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 8.61E-03; Z-score: -3.87E-01 | ||
|
Methylation in Case |
7.89E-02 (Median) | Methylation in Control | 8.70E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC35D1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
TSS200 (cg14626797) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 4.45E-02; Z-score: -5.78E-01 | ||
|
Methylation in Case |
1.21E-01 (Median) | Methylation in Control | 1.36E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC35D1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg14607894) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.56E+00 | Statistic Test | p-value: 2.91E-21; Z-score: -2.95E+00 | ||
|
Methylation in Case |
4.44E-01 (Median) | Methylation in Control | 6.95E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC35D1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg19764326) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.69E-02; Z-score: -4.97E-01 | ||
|
Methylation in Case |
7.04E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC35D1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
Body (cg09861436) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.71E-02; Z-score: -1.66E-01 | ||
|
Methylation in Case |
8.56E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC35D1 in hepatocellular carcinoma | [ 5 ] | |||
|
Location |
3'UTR (cg23722790) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 4.38E-06; Z-score: 1.14E+00 | ||
|
Methylation in Case |
7.43E-01 (Median) | Methylation in Control | 7.07E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC35D1 in lung adenocarcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg21115004) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.37E+00 | Statistic Test | p-value: 1.90E-03; Z-score: -1.72E+00 | ||
|
Methylation in Case |
1.19E-01 (Median) | Methylation in Control | 1.63E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC35D1 in colorectal cancer | [ 7 ] | |||
|
Location |
TSS200 (cg14626797) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.21E-04; Z-score: 9.75E-01 | ||
|
Methylation in Case |
2.68E-01 (Median) | Methylation in Control | 2.36E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC35D1 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg19764326) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 6.21E-06; Z-score: -1.12E+00 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.71E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC35D1 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg09861436) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.86E-03; Z-score: 1.11E+00 | ||
|
Methylation in Case |
8.86E-01 (Median) | Methylation in Control | 7.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC35D1 in colorectal cancer | [ 7 ] | |||
|
Location |
Body (cg23015917) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 3.04E-02; Z-score: 4.07E-01 | ||
|
Methylation in Case |
6.37E-01 (Median) | Methylation in Control | 5.76E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC35D1 in colorectal cancer | [ 7 ] | |||
|
Location |
3'UTR (cg23722790) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 2.84E-04; Z-score: 1.25E+00 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 7.55E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC35D1 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
TSS200 (cg14626797) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.35E-03; Z-score: 7.71E-01 | ||
|
Methylation in Case |
1.28E-01 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC35D1 in papillary thyroid cancer | [ 8 ] | |||
|
Location |
3'UTR (cg23722790) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 3.61E-10; Z-score: 1.47E+00 | ||
|
Methylation in Case |
6.73E-01 (Median) | Methylation in Control | 5.71E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC35D1 in panic disorder | [ 9 ] | |||
|
Location |
1stExon (cg14206730) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 9.75E-01 | Statistic Test | p-value: 4.27E-02; Z-score: 3.62E-01 | ||
|
Methylation in Case |
-4.77E+00 (Median) | Methylation in Control | -4.89E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC35D1 in panic disorder | [ 9 ] | |||
|
Location |
Body (cg09861436) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.79E+00 | Statistic Test | p-value: 3.45E-08; Z-score: -9.74E-01 | ||
|
Methylation in Case |
5.84E-01 (Median) | Methylation in Control | 1.04E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC35D1 in panic disorder | [ 9 ] | |||
|
Location |
3'UTR (cg23722790) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 2.19E-02; Z-score: -5.08E-01 | ||
|
Methylation in Case |
1.19E+00 (Median) | Methylation in Control | 1.39E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
microRNA |
|||||
|
Unclear Phenotype |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-130b directly targets SLC35D1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
|
miRNA Stemloop ID |
miR-130b | miRNA Mature ID | miR-130b-3p | ||
|
miRNA Sequence |
CAGUGCAAUGAUGAAAGGGCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 2 |
miR-141 directly targets SLC35D1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-141 | miRNA Mature ID | miR-141-3p | ||
|
miRNA Sequence |
UAACACUGUCUGGUAAAGAUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 3 |
miR-19b directly targets SLC35D1 | [ 10 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Sequencing | ||
|
miRNA Stemloop ID |
miR-19b | miRNA Mature ID | miR-19b-3p | ||
|
miRNA Sequence |
UGUGCAAAUCCAUGCAAAACUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 4 |
miR-200a directly targets SLC35D1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-200a | miRNA Mature ID | miR-200a-3p | ||
|
miRNA Sequence |
UAACACUGUCUGGUAACGAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 5 |
miR-3529 directly targets SLC35D1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3529 | miRNA Mature ID | miR-3529-3p | ||
|
miRNA Sequence |
AACAACAAAAUCACUAGUCUUCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 6 |
miR-548ae directly targets SLC35D1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548ae | miRNA Mature ID | miR-548ae-3p | ||
|
miRNA Sequence |
CAAAAACUGCAAUUACUUUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 7 |
miR-548ah directly targets SLC35D1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548ah | miRNA Mature ID | miR-548ah-3p | ||
|
miRNA Sequence |
CAAAAACUGCAGUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 8 |
miR-548aj directly targets SLC35D1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548aj | miRNA Mature ID | miR-548aj-3p | ||
|
miRNA Sequence |
UAAAAACUGCAAUUACUUUUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 9 |
miR-548am directly targets SLC35D1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548am | miRNA Mature ID | miR-548am-3p | ||
|
miRNA Sequence |
CAAAAACUGCAGUUACUUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 10 |
miR-548aq directly targets SLC35D1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548aq | miRNA Mature ID | miR-548aq-3p | ||
|
miRNA Sequence |
CAAAAACUGCAAUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 11 |
miR-548j directly targets SLC35D1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548j | miRNA Mature ID | miR-548j-3p | ||
|
miRNA Sequence |
CAAAAACUGCAUUACUUUUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 12 |
miR-548x directly targets SLC35D1 | [ 11 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-548x | miRNA Mature ID | miR-548x-3p | ||
|
miRNA Sequence |
UAAAAACUGCAAUUACUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 13 |
miR-744 directly targets SLC35D1 | [ 12 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-744 | miRNA Mature ID | miR-744-5p | ||
|
miRNA Sequence |
UGCGGGGCUAGGGCUAACAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.